CN1246530A - Human gene coding sequence, its encoded polypeptide and its preparing process - Google Patents
Human gene coding sequence, its encoded polypeptide and its preparing process Download PDFInfo
- Publication number
- CN1246530A CN1246530A CN 98111035 CN98111035A CN1246530A CN 1246530 A CN1246530 A CN 1246530A CN 98111035 CN98111035 CN 98111035 CN 98111035 A CN98111035 A CN 98111035A CN 1246530 A CN1246530 A CN 1246530A
- Authority
- CN
- China
- Prior art keywords
- sequence
- hslarp
- polypeptide
- seq
- nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to a new human protein HSLARP as homolog of Septin. The cDNA coding sequence of said human protein HSLARP, the polypeptide coded by said sequence and a method for preparing said protein HSLARP by reformation are disclosed. The application of said new human HSLARP is also disclosed.
Description
The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of people HSLARP, this albumen is the homologue of Septin.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.
The Septin family member extensively is present in the various eukaryotic cells such as fungi, fruit bat, Mammals and plant, is the another important component part except that tubulin, Actin muscle in the cytoskeleton, generally participates in the division of cytoplasm effect.Studies show that the yeast cell of septin abnormal protein can't carry out division of cytoplasm, final formation has the growth abnormal syncyte (Bacteriol.Rev.38:164-198,1971) that sprouts.The vital role of this participation cell growth is also proved (Cell 84:187-190,1996) by this family protein conservative sequence and function in various biologies.Member CDC3, the CDC10 that Septin family is four, CDC11, CDC12 are separated from budding yeast in 1971 by people such as Hartwell the earliest and obtain, this four proteic genes of encoding were cloned into (Method Cell Biology 31:357-435,1989) in 1989 by people such as Pringle.After 1994, people have found the gene of three septin families in fruit bat: pnut, sep1, sep2 (Journal of CellBiology 133:605-616,1996).So far, have at least five mammals septin genes to be found: the diff6 of mouse, nedd5 (Biochem.Biophys., Res.Commun.185:1155-1161,1992) and h5 (TrendsNeurosci 15:319-323,1992), people's hCDC10 (Biochem.Biophys., Res.Commun 202:82-87,1994) and KIAA0518 (DNA Res.2:167-174,1995).Before the present invention came forth, still nobody disclosed another the human septin family member Hslarp that relates among the application.
An object of the present invention is to provide a kind of new polynucleotide, a newcomer of this polynucleotide encoding septin family, septin of the present invention family is named as HSLARP.
Another object of the present invention provides a kind of new people's septin family member, and this albumen is named as HSLARP.
A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's septin family member.
The present invention also provides this people's the septin family member gene order and the application of polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people HSLARP protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 21-1121 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 21-1121 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 21-1121 position.
In another aspect of this invention, provide a kind of isolating HSLARP protein polypeptide, it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, the method that provides a kind of generation to have the polypeptide of HSLARP protein-active, this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of HSLARP protein-active operationally is connected in expression regulation sequence, form the HSLARP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 21-1121 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of HSLARP;
(c) be fit to express under the condition of HSLARP protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with HSLARP protein-active.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 1177 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 21-1121 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " HSLARP albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with HSLARP protein-active is as 21-1121 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 21-1121 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 21-1121 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 21-1121 position.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 21-1121 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have variant form with proteic, the SEQ ID NO.3 sequence of people HSLARP identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " HSLARP protein polypeptide " refers to have the SEQ ID NO.4 polypeptide of sequence of HSLARP protein-active.This term also comprises having and the variant form human efficient lymphocyte chemotactic factor identical function, SEQ IDNO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of HSLARP and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of HSLARP DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-HSLARP polypeptide to obtain.The present invention also provides other polypeptide, as comprises HSLARP polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of HSLARP polypeptide.Usually, this fragment have the HSLARP peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of HSLARP albumen or polypeptide.The difference of these analogues and natural HSLARP polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of HSLARP polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of HSLARP in the cell.
The present invention also comprises a kind of probe molecule, and this molecule has 8-100 of HSLARP polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the HSLARP that encodes.
The present invention also comprises the method that detects the HSLARP nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of HSLARP polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 20-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises HSLARP DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into HSLARP gene product or fragment.Preferably, refer to that those can combine with HSLARP gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of HSLARP, comprise that also those do not influence the antibody of HSLARP protein function.The present invention also comprise those can with modify or without the HSLARP gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the HSLARP gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing HSLARP or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block the HSLARP function and the antibody that does not influence the HSLARP function.Each antibody-like of the present invention can utilize the fragment or the functional zone of HSLARP gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of HSLARP gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
In the present invention, the cDNA nucleotide sequence of people HSLARP is so to obtain, with people's liver λ gt11cDNA library (available from Clontech company) is template, with two pairs of oligonucleotide is primer---A1:5 '-CAGTGATGGCTGGCGGAGTCATG-3 ' is a forward primer, oligonucleotide A2:5 '-ATTGGACAAGAGGCCGACTGAAG-3 ' is a reverse primer, carries out PCR.Obtain the full length cDNA sequence of SEQID NO.3 after the order-checking.
The Septin family member is found and extensively is present in the various biologies, participates in division of cytoplasm.We have cloned a new Human genome HSLARP, this gene and mouse diff6 gene height homology, thereby this shows that it is the homologous gene of septin family in the people, and have similar biological function with other member of septin family.At first, it has vital role in division of cytoplasm.The Septin family member has the GTP enzymic activity, since combination of cell cycle G1 phase and hydrolysis GTP, makes monomer polymerization form filamentary structure (J.Cell.Biol.133 (3): 605-616,1996).This filamentary structure can play the opposing ambient pressure, and assembles the proteic effect (Cell 77:371-379,1994) that other participates in division of cytoplasm.Secondly, at interphase cell, the fibril that septin albumen is formed is closely linked to actin filament, and is connected with intercellular channel point and contacts, and becomes the important component part (Genes of cytoskeleton; Development 11:1535-1547,1997).In addition, in the growth of fruit bat eye, confirmed that rod photoreceptor cell R7 heteroplasia and surface of cell membrane albumen septin vigor descend to contact directly (Cell 77:371-379,1994).More mammiferous septin albumen are found in tire brain and some neurones such as hippocampus, gasserian ganglion, retina and the purkinje's cell all expression, and prompting septin albumen may participate in developmental and sophisticated nervous function (Genes ﹠amp; Development 11:1535-1547.1997).According to septin family member's high conservative, wide expression and certified vital role in division of cytoplasm, can infer that septin albumen all plays an important role regulating cellularstructure and function aspects.There are some researches show, include people's a septin gene (Hum.Genet.101:6-12,1997) in a kind of chromosome deletion section of genetic defect disease, the present invention can provide a new way for molecular mechanism and the treatment of studying this kind disease.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of HSLARP
1. primer amplification
With people's liver λ gt11cDNA library (available from Clontech company) is template, with two pairs of oligonucleotide is primer---A1:5 '-CAGTGATGGCTGGCGGAGTCATG-3 ' (SEQ ID NO:1) is a forward primer, oligonucleotide A2:5 '-ATTGGACAAGAGGCCGACTGAAG-3 ' (SEQ ID NO:2) is a reverse primer, carries out PCR.The PCR condition of A1/A2 be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 62 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.Electrophoresis detection obtains the purpose fragment of about 1.2kd.
2.PCR the order-checking of product
With pcr amplification product A1/A2 and the pGEM-T that as above obtains
Carrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (pHarmacia).Use SequiTherm EXCEL
Dna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 1177bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 21-1121 position Nucleotide.
Derive the aminoacid sequence of HSLARP according to the full-length gene group sequence that obtains, totally 366 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.
Embodiment 2
Homology relatively
Full length cDNA sequence and proteins encoded thereof with HSLARP carry out nucleic acid and albumen homology retrieval with BLAST in Non-redundant GenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDS translations+PDB+SwissProt+Spupdate+PIR database.Found that they and septin family gene and proteins encoded thereof have high homology, with PCGENE software relatively, find that it and mouse diff6 gene reach respectively about 76% and 92.6% in the identity on nucleic acid and the protein level, they are considered to constitute a family, so can infer the function of HSLARP from these genes or proteic function.
Division of cytoplasm process when the Septin family member is considered to cell fission relevant (Cell 84:187-196,1996).Division of cytoplasm is a universal phenomenon that all exists in all eukaryotes.Although the division of cytoplasm mechanism of various biologies is different, the septin family member is found and extensively is present in the various biologies, participates in division of cytoplasm.Human genome HSLARP that the present invention is new and mouse diff6 gene height homology, thereby show that it is the homologous gene of septin family in the people, and have similar biological function with other member of septin family.At first, it has vital role in division of cytoplasm.Its N terminal sequence contains the significant sequence of the binding nucleotide of a P shape circle: GX
4GKS--DX
2G--KXD, wherein Xn represents any n amino acid,--represent one section indefinite aminoacid sequence, this sequence is the significant sequence (Nature349:117-127,1991) of GTP enzyme superfamily.Corresponding sequence in the present invention is
32GESGLGKS--
89DTPG--
170KAD[annotates: the numeral in the amino acid lower left corner is an amino acid position].The Septin family member has the GTP enzymic activity, since combination of cell cycle G1 phase and hydrolysis GTP, make monomer polymerization form filamentary structure, the key factor (J.Cell.Biol.133 (3): 605-616,1996) of division Board position when becoming the decision division of cytoplasm.This filamentary structure can play the opposing ambient pressure, and assembles the proteic effect (Cell 77:371-379,1994) that other participates in division of cytoplasm.Secondly, at interphase cell, it is closely linked with actin filament that the fibril that septin albumen is formed is found, and be connected with intercellular channel point and contact, and becomes the important component part (Genes of cytoskeleton; Development 11:1535-1547,1997).In addition, in the growth of fruit bat eye, confirmed that rod photoreceptor cell R7 heteroplasia and surface of cell membrane albumen septin vigor descend to contact directly.Studies show that the proteic vigor of this septin descends, and has caused mitotic delaying, and this cell cycle delay further cause of the greatly decline (Cell 77:371-379,1994) of R7 cell to the reflection ability of inducement signal.More mammiferous septin albumen are found in tire brain and some neurones such as hippocampus, gasserian ganglion, retina and the purkinje's cell all expression, and prompting septin albumen may participate in developmental and sophisticated nervous function (Genes﹠amp; Development 11:1535-1547,1997).According to septin family member's high conservative, wide expression and certified vital role in division of cytoplasm, can infer that septin albumen all plays an important role regulating cellularstructure and function aspects.There are some researches show, include people's a septin gene in a kind of chromosome deletion section of genetic defect disease.This disease shows as congenital heart disease, parathyroid gland hypofunction, cell-mediated complexity effect such as immune deficiency (Hum.Genet.101:6-12,1997), and the present invention can provide a new way for molecular mechanism and the treatment of studying this kind disease.
Embodiment 3
The expression of HSLARP in intestinal bacteria
In this embodiment, use PCR Oligonucleolide primers to increase the cDNA sequence of coding HSLARP, obtain HSLARP and insert fragment corresponding to 5 of this dna sequence dna ' and 3 ' end.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5 '-TCAGGGATCCATGGACAAGGAGTACGTGG-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of the restricted restriction enzyme of BamHI, is 19 Nucleotide of the HSLARP encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5 '-TTGGGTCGACTCAGAGGGCGTCTGACTGC-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the HSLARP of the restricted restriction enzyme of SalI.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp
r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
With BamHI and SalI digestion pQE-9 carrier, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan
r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid, the cDNA fragment of sequence verification HSLARP has correctly been inserted carrier.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD
600) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved HSLARP from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out HSLARP from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 42KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 4
The expression of HSLARP in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment, use PCR Oligonucleolide primers to increase the cDNA sequence of coding HSLARP, obtain HSLARP cDNA as inserting fragment corresponding to 5 of this dna sequence dna ' and 3 ' end.
5 ' Oligonucleolide primers sequence of using in the PCR reaction is:
5′-TCAGGGATCCATGGACAAGGAGTACGTGG-3′(SEQ?ID?NO.5)
This primer contains the restriction enzyme site of the restricted restriction enzyme of BamHI, is 19 Nucleotide of the HSLARP encoding sequence that begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5’-TTGGTCTAGATCAGAGGGCGTCTGACTGC-3’(SEQ?ID?NO.7)
This primer contains the part encoding sequence of the restriction enzyme site of the restricted restriction enzyme of XbaI, translation termination and HSLARP.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp
rAnd Neo
r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
With BamHI and XbaI digestion pcDNA3 carrier, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid cuts evaluation with the ApaI enzyme and insert clip size and direction, and the cDNA fragment of sequence verification HSLARP has correctly been inserted carrier.
The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 42KDa.
In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.
Embodiment 5
Preparation antibody
The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation HSLARP gene translation product with it.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Information (i) sequence signature of sequence table (2) SEQ ID NO:1
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:1CAGTGATGGC TGGCGGAGTC ATG 23 (2) SEQ ID NO:2
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2ATTGGACAAG AGGCCGACTG AAG 23 (2) SEQ ID NO.3: (i) sequence signature
(A) length: 1177bp
(B) type: nucleic acid
(C) chain: strand
( D ) : ( ii ) :cDNA ( xi ) :SEQ ID NO.3 1 CAGTGATGGCTGGCGGAGTCATGGACAAGGAGTACGTGGGTTTTGCTGCTCTCCCCAACC 61 AGCTGCACCGCAAGTCTGTCAAGAAGGGGTTTGACTTCACGCTAATGGTGGCAGGGGAGT 121 CAGGCCTAGGGAAATCCACCCTCATCAACAGCCTCTTCCTCACCAACCTCTATGAGGATC 181 GCCAGGTGCCAGAGGCAGGTGCTCGCTTGACACAGACCCTGGCCATTGAGCGCCGGGGCG 241 TAGAGATTGAGGAAGGGGGTGTGAAAGTGAAGCTGACCCTTGTGGACACACCTGGCTTTG 301 GGGACTCAGTGGACTGCTCTGACTGCTGGCTTCCGGTGGTGAAATTCATCGAGGAGCAAT 361 TTGAGCAGTACCTTAGGGATGAGAGTGGCCTGAACCGGAAGAACATCCAGGACTCCCGAG 421 TCCACTGCTGCCTCTACTTCATCTCACCCTTCGGCCGGGGGTCCCGCCTAGATGTGGCCT 481 TCCTCCGGGCAGTACACGAGAAAGTCAACATCATCCCAGTCATTGGCAAAGCGGATGCTC 541 TGATGCCCCAGGAAACCCAGGCCCTCAAGCAGAAGATCCGGGATCAGTTGAAGGAAGAGG 601 AGATCCACATCTACCAGTTCCCCGAATGTGACTCTGATGAAGATGAAGACTTCAAGAGGC 661 AGGATGCAGAGATGAAGGAAAGCATCCCTTTTGCAGTCGTGGGATCATGCGAGGTGGTGA 721 GGGATGGCGGGAACGGCCTGGTGAGGGGACGCCGCTACTCCTGGGGGACCGTGGAGGTGG 781 AGAACCCACATCACTGCGATTTCCTGAACCTGCGACGGATGCTGGTGCAGACACACCTGC 841 AGGACCTGAAAGAGGTGACGCACGATCTGCTCTACGAGGGCTACCGGGCCCGCTGCCTAC 901 AGAGCCTGGCCCGGCCTGGGGCTCGCGATCGAGCCAGCCGCAGTAAGCTTTCCCGCCAGA 961 GCGCCACAGAGATCCCGCTGCCCATGCCTCCTCTGGCGGACACCGAGAAGCTGATCCGCG1021 AGAAAGACGAAGAGCTGCGCCGCATGCAAGAGATGCTGGAGAAGATGCAGGCCCAAATGC1081 AGCAGAGCCAGGCCCAGGGCGAGCAGTCAGACGCCCTCTGAGCACACGCCCCGCCCGGCC1141 TTACCCCGGTCCGCCTTCAGTCGGCCTCTTGTCCAAT ( 2 ) SEQ ID NO.4: ( i )
(A) length: 366 amino acid
(B) type: amino acid
( C ) : ( ii ) : ( xi ) :SEQ ID NO.4 1 Met Asp Lys Glu Tyr Val Gly Phe Ala Ala Leu Pro Asn Gln Leu16 His Arg Lys Ser Val Lys Lys Gly Phe Asp Phe Thr Leu Met Val31 Ala Gly Glu Ser Gly Leu Gly Lys Ser Thr Leu Ile Asn Ser Leu46 Phe Leu Thr Asn Leu Tyr Glu Asp Arg Gln Val Pro Glu Ala Gly 61 Ala Arg Leu Thr Gln Thr Leu Ala Ile Glu Arg Arg Gly Val Glu 76 Ile Glu Glu Gly Gly Val Lys Val Lys Leu Thr Leu Val Asp Thr 91 Pro Gly Phe Gly Asp Ser Val Asp Cys Ser Asp Cys Trp Leu Pro106 Val Val Lys Phe Ile Glu Glu Gln Phe Glu Gln Tyr Leu Arg Asp121 Glu Ser Gly Leu Asn Arg Lys Asn Ile Gln Asp Ser Arg Val His136 Cys Cys Leu Tyr Phe Ile Ser Pro Phe Gly Arg Gly Ser Arg Leu151 Asp Val Ala Phe Leu Arg Ala Val His Glu Lys Val Asn Ile Ile166 Pro Val Ile Gly Lys Ala Asp Ala Leu Met Pro Gln Glu Thr Gln181 Ala Leu Lys Gln Lys Ile Arg Asp Gln Leu Lys Glu Glu Glu Ile196 His Ile Tyr Gln Phe Pro Glu Cys Asp Ser Asp Glu Asp Glu Asp211 Phe Lys Arg Gln Asp Ala Glu Met Lys Glu Ser Ile Pro Phe Ala226 Val Val Gly Ser Cys Glu Val Val Arg Asp Gly Gly Asn Gly Leu241 Val Arg Gly Arg Arg Tyr Ser Trp Gly Thr Val Glu Val Glu Asn256 Pro His His Cys Asp Phe Leu Asn Leu Arg Arg Met Leu Val Gln271 Thr His Leu Gln Asp Leu Lys Glu Val Thr His Asp Leu Leu Tyr286 Glu Gly Tyr Arg Ala Arg Cys Leu Gln Ser Leu Ala Arg Pro Gly301 Ala Arg Asp Arg Ala Ser Arg Ser Lys Leu Ser Arg Gln Ser Ala316 Thr Glu Tle Pro Leu Pro Met Pro Pro Leu Ala Asp Thr Glu Lys331 Leu Ile Arg Glu Lys Asp Glu Glu Leu Arg Arg Met Gln Glu Met346 Leu Glu Lys Met Gln Ala Gln Met Gln Gln Ser Gln Ala Gln Gly361 Glu Gln Ser Asp Ala Leu ( 2 ) SEQ ID NO:5 ( i )
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:5TCAGGGATCC ATGGACAAGG AGTACGTGG 29 (2) SEQ ID NO:6
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:6TTGGGTCGAC TCAGAGGGCG TCTGACTGC 29 (2) SEQ ID NO:7
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:7TTGGTCTAGA TCAGAGGGCG TCTGACTGC 29
Claims (14)
1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people HSLARP protein-active,
Show at least 70% homology from the nucleotides sequence of Nucleotide 21-1121 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps
Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 21-1121 position.
2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.
3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 21-1121 position.
4. isolating HSLARP protein polypeptide is characterized in that it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.
5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.
9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.
10. a generation has the method for the polypeptide of HSLARP protein-active, it is characterized in that this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of HSLARP protein-active operationally is connected in expression regulation sequence, form the HSLARP protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 21-1121 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of HSLARP;
(c) be fit to express under the condition of HSLARP protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with HSLARP protein-active.
11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 21-1121 position among the SEQ ID NO.3.
12. energy and the described HSLARP protein polypeptide of claim 4 specificity bonded antibody.
13. a nucleic acid molecule is characterized in that, it is the antisense sequences of the described dna molecular of claim 1.
14. a probe molecule is characterized in that, it contains about 8-100 continuous nucleotide in the described dna molecular of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 98111035 CN1246530A (en) | 1998-08-31 | 1998-08-31 | Human gene coding sequence, its encoded polypeptide and its preparing process |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 98111035 CN1246530A (en) | 1998-08-31 | 1998-08-31 | Human gene coding sequence, its encoded polypeptide and its preparing process |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1246530A true CN1246530A (en) | 2000-03-08 |
Family
ID=5221044
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 98111035 Pending CN1246530A (en) | 1998-08-31 | 1998-08-31 | Human gene coding sequence, its encoded polypeptide and its preparing process |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1246530A (en) |
-
1998
- 1998-08-31 CN CN 98111035 patent/CN1246530A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1128878C (en) | Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process | |
CN1132939C (en) | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process | |
CN1246530A (en) | Human gene coding sequence, its encoded polypeptide and its preparing process | |
CN1125178C (en) | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process | |
CN1125177C (en) | Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process | |
CN1249347A (en) | Human calcineurin regulatory subunit, its coding sequence and its preparing process | |
CN1277259A (en) | Homologous protein of late embryo ample-protein and its code sequence | |
CN1237173C (en) | Hemolytic peptide precursor gene of Asian-African wasp aptoxin, polypeptide coded by it and its preparing process | |
CN1246532A (en) | Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process | |
CN1246529A (en) | Coding sequence of human translation initiation factor subunit, its encoded polypeptide and its preparing process | |
CN1277260A (en) | Human actin related protein subunit and its code sequence | |
CN1264739A (en) | Human protein and its coding sequence, preparing process and application | |
CN1259574A (en) | New human phosphatide transferase, its code sequence, prepn. and use thereof | |
CN1290749A (en) | Charcot-leyden crystal IB and its coding sequence and producing method and use | |
CN1248624A (en) | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process | |
CN1249341A (en) | Human protein kinase C arrestin coding sequence, its encoded polypeptide and its preparing process | |
CN1274727A (en) | New human protein and its code sequence, preparation and application | |
CN1261102A (en) | Human spindle protein and its coding sequence, preparing process and application | |
CN1250097A (en) | New human gene coding series and the polypeptide therewith and its preparation | |
CN1252448A (en) | Human actin related protein gene and encoded polypeptide and preparation and application | |
CN1251860A (en) | Human gene sequence and its coded polypeptide, preparing process and application | |
CN1275621A (en) | Human lambda crystallin and its coding sequence, preparation process and use | |
CN1252449A (en) | New human gene code sequence, encoded polypeptide and preparation | |
CN1394959A (en) | Human ring finger proteinase code sequence, its preparation method and application | |
CN1249345A (en) | Human gene coding sequence, its encoded polypeptide and its preparing process |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |