CN1249347A - Human calcineurin regulatory subunit, its coding sequence and its preparing process - Google Patents
Human calcineurin regulatory subunit, its coding sequence and its preparing process Download PDFInfo
- Publication number
- CN1249347A CN1249347A CN98121923A CN98121923A CN1249347A CN 1249347 A CN1249347 A CN 1249347A CN 98121923 A CN98121923 A CN 98121923A CN 98121923 A CN98121923 A CN 98121923A CN 1249347 A CN1249347 A CN 1249347A
- Authority
- CN
- China
- Prior art keywords
- sequence
- cnbii
- polypeptide
- seq
- nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention discloses the coding sequence of CNB II, which is a new member in human Calcineurin (CN) regulatory subunit CalcineurinB (CNB) family. The polypeptide coded by said sequence is the homolog of human CNB gene. The present invention also relates to the polypeptide coded by said polynucleotide, and the application and preparing process of said polynucleotide and said polypeptide.
Description
The present invention relates to a kind of new polynucleotide.More specifically, the present invention relates to people's calcineurin (Calcineurin, abbreviation " CN ") encoding sequence of a newcomer CNBII in adjusting subunit (Calcineurin B is called for short " the CNB ") family, the polypeptide of this sequence encoding is accredited as the homologue of people CNB gene.The invention still further relates to polypeptide, the application of these polynucleotide and polypeptide, and the production of described polynucleotide and described polypeptide by this polynucleotide encoding.
Known CNB gene is relevant with biological intravital immunoloregulation function.The earliest member is a kind of albumen of finding in the ox brain in the CNB family.Then be people's CNB genes that the clone obtained from mouse spermatocyte cDNA library in 1989 such as Guerini.D by cloned genes the earliest in this family.The somebody's who is cloned simultaneously CNB gene (DNA, 1989,8 (9), 675-682), the homology degree through relatively finding them is very high.Subsequently, people such as Cyert.M.S. cloned zymic CNB gene (Proc.Natl.Acad.Sci.USA 88,7376-7380) in 1991; People such as Guerini.D in 1992 clone obtained fruit bat the CNB gene (J.Biol.Chem.267,22542-22549).All these CNB genes all have the height homology (Biochem Biophys Res Commun 1997,235,271-275).
Before the present invention, do not find or delivered people's calcineurin regulatory gene of the present invention.
An object of the present invention is to provide a kind of new polynucleotide, these polynucleotide are homologous genes of coding people CNB gene, the homologue called after CNBII of people CNB of the present invention.
Another object of the present invention provides a kind of new people CNB homologous protein, called after CNBII albumen.
A further object of the present invention provides a kind of recombinant technology that utilizes and produces the proteic method of described CNBII.
The invention still further relates to the application of this CNBII nucleotide sequence and polypeptide.
In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people CNBII protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 1-513 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 1-513 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has the sequence of Nucleotide 1-513 position among the SEQ ID NO.3.
In another aspect of this invention, provide a kind of isolating CNBII protein polypeptide, it comprises: have polypeptide or its active fragments of SEQID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.
In another aspect of this invention, provide a kind of described carrier transformed host cells.
In another aspect of this invention, the method that provides a kind of generation to have the polypeptide of CNBII protein-active, this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of CNBII protein-active operationally is connected in expression regulation sequence, form the CNBII protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 1-513 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of CNBII;
(c) be fit to express under the condition of CNBII protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with CNBII protein-active.
In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 517 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 1-513 position Nucleotide.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, term " CNBII albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with CNBII protein-active is as 1-513 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 1-513 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 1-513 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprise can be under the moderate stringent condition with SEQ IDNO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-513 position.More preferably, also be included in the height stringent condition down with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-513 position.In addition, this term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 1-513 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises encoding to have the variant form of open reading frame sequence among proteic, the SEQ ID NO.3 with people CNBII identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.
In the present invention, term " CNBII protein polypeptide " refers to have the SEQ ID NO.4 polypeptide of sequence of CNBII protein-active.This term also comprises having and variant form people's calcineurin regulatory subunit identical function, SEQ IDNO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of CNBII and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of CNBII DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-CNBII polypeptide to obtain.The present invention also provides other polypeptide, as comprises CNBII polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also comprises the soluble fragments of CNBII polypeptide.Usually, this fragment have the CNBII peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of CNBII albumen or polypeptide.The difference of these analogues and natural CNBII polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of CNBII polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of CNBII in the cell.
The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of CNBII polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the CNBII that encodes.
The present invention also comprises the method that detects the CNBII nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of CNBII polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 20-50 Nucleotide.
In the present invention, can select various carrier known in the art for use, as commercially available carrier.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.
On the other hand, the present invention also comprises CNBII cDNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into CNBII gene product or fragment.Preferably, refer to that those can combine with CNBII gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of CNBII, comprise that also those do not influence the antibody of CNBII protein function.The present invention also comprise those can with modify or without the CNBII gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ＇ or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the CNBII gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing CNBII or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block the CNBII function and the antibody that does not influence the CNBII function.Each antibody-like of the present invention can utilize the fragment or the functional zone of CNBII gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of CNBII gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
People CNBII nucleotide sequence full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or the cDNA storehouse of press the currently known methods preparation as template, increase and must be about sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
In one embodiment of the invention, CNBII polynucleotide total length of the present invention is 517 Nucleotide, and its detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 1-513 position Nucleotide.These polynucleotide are so to obtain, with human brain λ gt11cDNA library (available from Clontech company) is template, synthetic forward primer A1:5 ＇-ATGGGAAACGAGGCCAGTTACC-3 ＇, reverse primer A2:5 ＇-AGGCTCATACGATGAGGACCAG-3 ＇ carries out the purpose fragment that PCR obtains 520bp (A1/A2).Obtain the full length cDNA sequence of SEQ ID NO:3 after the order-checking.
Biological immunologic function mainly comes catalysis to finish by calcineurin, and the catalytic activity of calcineurin then is to regulate subunit (CNB) by it to finish jointly with catalytic subunit (CNA).Wherein, regulating subunit plays a part even more important.CDNA sequence of the present invention is identified the CNBII gene into the people, belongs to calcineurin regulatory subunit CNB gene family.It plays an important role in the catalytic activity of regulating calcineurin.CNB in lymphsystem high expression level (Guerini.D 1997 Biochem.Biophys.Res.Commun 235 271-275), are a kind of important protein that self was invaded and protected to the external toxin of biological opposing.Especially in higher organism, it plays a part even more important.CNB may be relevant with the stability of catalytic subunit CNA; CNB is incorporated into Ca2+, and another regulates the adjusting activity of albumen calmodulin (CaM) can to improve calcineurin effectively; It may be mediation Ca2+ that this homologous gene also is considered to, and the important factor of raising immune system activity aspect (Merat.D.L 1985, J.Biolog.Chem, and 260 (20) Sep.15,11053-11059).Further report has shown CNB not only to immunity system tool regulatory function, also may relevant with intracellular transport (Aitken.A 1982, FEBSLett 150 (2) 314-318).CNBII gene of the present invention has or identical functions similar to the CNB gene.
In accompanying drawing of the present invention,
The homology comparison diagram of the aminoacid sequence of Fig. 1 people CNBII of the present invention albumen and people CNB albumen (HCNB).Wherein, identical amino acid marks with " | " between two sequences, and similar amino acid marks with " ".Similar amino acid is A, S, T; D, E; N, Q; R, K; I, L, M, V; F, Y, W.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, as people such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone and the mensuration of the cDNA sequence of CNBII
1. primer amplification
With human brain λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A1:5 ＇-ATGGGAAACGAGGCCAGTTACC-3 ＇ (SEQ ID NO:1) is a forward primer, oligonucleotide A2:5 ＇-AGGCTCATACGATGAGGACCAG-3 ' (SEQ ID NO:2) is a reverse primer, carries out PCR.The PCR condition of A1/A2 be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 68 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes; The PCR fragment that electrophoresis detection obtains, A1/A2 is the purpose fragment of 520bp.
2.PCR the order-checking of product
With pcr amplification product A1/A2 and the pGEM-T that as above obtains
TMCarrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (Pharmacia).Use SequiTherm EXCEL
TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 517bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 1-513 position Nucleotide.
Derive the aminoacid sequence of CNBII according to the full length cDNA sequence that obtains, totally 170 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.
Embodiment 2
Homology relatively
Full length cDNA sequence and proteins encoded thereof with CNBII carry out the homology retrieval with BLAST in the Non-redundantGenBank+EMBL+DDBJ+PDB database.Found that they and people CNB gene and proteins encoded thereof have very high homology, especially the identity on protein level (identity claims homogeny again) has reached 84%, and similarity has reached 88% (Fig. 2).
The characteristic sequence that particularly in the aminoacid sequence of CNBII, has 3 EF hand-type calcium binding sites of forming by 13 amino acid
-DX(D/N/S){ILVFYW}(D/E/N/S/T/G)(D/N/Q/G/H/R/K){GP}
(L/I/V/M/C)(D/E/N/Q/S/T/A/G/C)X2(D/E)(L/I/V/M/F/Y/W)
[annotate: X is an arbitrary amino acid in this sequence, and numerals such as " 2 " is an amino acid number, and an amino acid is selected in " (L/I/V/F/Y/W) " expression arbitrarily from these 6 amino acid, GP} represents can not be G or P herein].
The sequence fragment that meets above-mentioned pattern in albumen of the present invention is: DTDGDGEVDFKEF (63-75 position among the SEQ IDNO.4), DMDKDGYISNGEL (100-112 position among the SEQ ID NO.4), DKDGDGKISFEEF (141-153 position among the SEQ ID NO.4), this has confirmed that further people CNBII of the present invention belongs to a kind of calmodulin.In sum, can conclude that people's CNBII albumen belongs to calcineurin regulatory subunit family, and have the correlation function of calcineurin regulatory subunit family.
It is relevant with the lymphsystem immunologic function that CNB is considered to, and is biological opposing alien influence, protects a kind of albumen of self.Biological immunologic function mainly comes catalysis to finish by calcineurin, and the catalytic activity of calcineurin then is to regulate subunit (CNB) by it to finish jointly with catalytic subunit (CNA).Wherein, regulate subunit play a part even more important (Guerini.D 1997 Biochem.Biophys.Res.Commun 235,271-275).
The immunologic function that the catalytic activity that calcineurin regulatory subunit (CNB) is mainly regulated calcineurin catalytic subunit (CNA) by collaborative calmodulin (CaM) comes the immunocyte of mediator and animal to bring into normal play, the opposing foreign matter is to the detrimentally affect of human body.At first, CNB is considered to may be relevant with the stability of catalytic subunit, and CNB is with after CNA combines, and the stability of CNA is than high many under the standard state.Secondly, CNB is incorporated into Ca2+, and another regulates the adjusting activity of albumen calmodulin (CaM) can to improve calcineurin effectively.Though the regulating effect of CNB and CaM is separate, exist the relation of coordinative role between them again.Lacked either party, what the catalytic activity of CNA all can not highest level brings into play.It may be mediation Ca2+ that CNB also is considered to, improve the important factor of immune system activity aspect, people such as Merat found through experiments already, Ca2+ plays requisite effect aspect calcineurin active regulating, and in the presence of CNB, more obviously (Merat.D.L1985, the J.Biolog.Chem of the performance of the regulating effect of Ca2+, 260 (20), 11053-11059).
Show that CNB also may be relevant with intracellular transport not only to immunity system tool regulatory function.N-terminal at CNB has one section special aminoacid sequence, it is found that this sequence also exists in the protein kinase catalytic subunit that cyclisation AMP relies on.A plurality of amino acid of the N-terminal of CNBII of the present invention and the amino acid whose identity among the CNB are greater than 85%, and similarity is more up to 93%.And have corresponding this unusual zone among the CNBII, this fact shows that CNBII has also participated in the interaction of cytolemma, and participates in the cell transmembrane transhipment of material.The above-mentioned functions of CNB shows that CNBII can be used for improving immune level or is used for the treatment of the other diseases that causes because of the CNBII shortage.Owing to this uncommon zone is all arranged, so this zone may be relevant with the interaction of these albumen and its substrate in protein kinase and phosphokinase albumen.In addition, the existence in this zone makes these albumen to interact with cytolemma, and participates in the interior transmembrane transport of cell of material.More in depth the research in this zone is thought, the zone of this mystery may in the interaction of keeping CNB and two subunits of CNA, play an important role (FEBS Lett1982,150 (2), 314-318).
CNBII of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, CNBII of the present invention can also merge or exchange fragment with other members of this family, to produce new albumen, as the C end of CNBII of the present invention and the C end of people CNB are exchanged, to produce the albumen that new activity is higher or have new features.
At the antibody of CNBII of the present invention, can be used for screening other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).
For example, inventor CNBII nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people CNBII or the overexpression that suppresses people CNBII.People CNBII albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people CNBII disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.
Embodiment 3
The expression of CNBII in intestinal bacteria
The PCR Oligonucleolide primers of the cDNA sequence of coding CNBII corresponding to 5 ＇ of this dna sequence dna and 3 ＇ end for template increases, inserts fragment to synthesize with human brain λ gt11cDNA library (available from Clontech company).
5 ＇ Oligonucleolide primers sequences are
5＇-TCTGGGATCCATGGGAAACGAGGCCAGTT-3＇(SEQ?ID?NO.5)，
This primer contains the restriction enzyme site of BamHI restriction enzyme, and what connect is 19 Nucleotide of the CNBII encoding sequence that begun by initiator codon;
3 ' Oligonucleolide primers sequence is
5’-GTAGGGATCCTCATACGATGAGGACCAGC-3’(SEQ?ID?NO.6)，
This primer contains the restriction enzyme site of BamHI restriction enzyme, the encoding sequence of translation termination and CNBII.
The restriction enzyme site of restriction enzyme is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp
r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.
With BamHI digestion pQE-9 carrier, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kan
r).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid is cut with the SalI enzyme and to be identified and insert clip size and direction, and sequence verification result shows that the cDNA of CNBII inserts the fragment carrier of correctly packing into.
Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution is inoculated in the large volume substratum culturing cell to 600 optical density(OD) (OD then
600) be 0.4-0.6, add subsequently IPTG (" isopropylthio-B-D-galactoside ") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved CNBII from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out CNBII from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps from nickel-chelate column, isolate purifying protein.Sublimed albumen can be incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed to containing PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 20KDa.
In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.
Embodiment 4
The expression of CNBII in eukaryotic cell (Chinese hamster ovary celI strain)
In this embodiment, the cDNA sequence of coding CNBII being used corresponding to 5 ＇ of this dna sequence dna and the PCR Oligonucleolide primers of 3 ＇ end, is that template increases with human brain λ gt11eDNA library, inserts fragment thereby obtain synthetic.
The 5 ＇ Oligonucleolide primers sequences of using in the PCR reaction are:
5＇-TCTGAAGCTTATGGGAAACGAGGCCAGTT-3＇(SEQ?ID?NO.7)，
This primer contains the restriction enzyme site of HindIII restriction enzyme, and what connect is 19 Nucleotide of the CNBII encoding sequence that begun by initiator codon;
3 ＇ end primer sequence is:
5’-GTAGGGATCCTCATACGATGAGGACCAGC-3’(SEQ?ID?NO.8)
This primer contains the encoding sequence of the restriction enzyme site of BamHI restriction enzyme, translation termination and CNBII.
The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp
rAnd Neo
r), a phage replication starting point (fl ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.
With HindIII, BamHI digestion pcDNA3 carrier, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100g/ μ ml).The extracting plasmid is cut with the EcoRV enzyme and identify to be inserted clip size and direction, and sequence verification result shows that the cDNA of CNBII inserts the fragment carrier of correctly packing into.
The plasmid transfection Chinese hamster ovary celI is to use lipofection, adopts Lipofectin test kit (GiBcolife) to carry out.After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mMTrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.
SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 20KDa.
In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO:4 with ordinary method.
Embodiment 5
Preparation antibody
The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, specific as follows.Recombinant protein separates standby with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external deposit C NBII gene translation product with it.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (i) applicant: Fudan University is denomination of invention (ii): new people's calcineurin regulatory subunit, its encoding sequence and preparation method be the sequence number (iii): information (i) sequence signature of 8 (2) SEQ ID NO:1
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:1:ATGGGAAACG AGGCCAGTTA CC 22 (2) SEQ ID NO:2
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2AGGCTCATAC GATGAGGACC AG 22 (2) SEQ ID NO:3: (i) sequence signature:
(A) length: 517bp
(B) type: nucleic acid
(C) chain: strand
( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：3 1 ATGGGAAACGAGGCCAGTTACCCGGCGGAGATGTGCTCCCACTTTAACAATGATGAAATT 61 AAAAGGCTGGGCAGGAGGTTTAAGAAGTTGGACTTGGACAAATCAGGGTCTCTAAGCGTG121 GAGGAGTTCATGTCCCTGCCGGAGCTGCGCCACAACCCGTTGGTGCGGCGAGTGATCGAC181 GTCTTCGACACCGACGGTGATGGAGAAGTGGACTTCAAGGAATTCATCCTGGGGACCTCC241 CAGTTCAGCGTCAAGGGCGACGAGGAGCAGAAGTTGAGGTTTGCGTTCAGCATTTACGAC301 ATGGATAAAGATGGCTACATTTCCAACGGGGAGCTCTTCCAGGTGCTGAAGATGATGGTG361 GGCAACAACCTGACGGACTGGCAGCTCCAGCAGCTGGTCGACAAAACCATCATCATCCTG421 GACAAGGATGGCGATGGGAAGATATCCTTTGAGGAATTCAGTGCTGTGGTCAGAGACCTG481 GAGATCCACAAGAAGCTGGTCCTCATCGTATGAGCCT ( 2 ) SEQ ID NO：4： ( i ) ： ( A ) ：170 ( B ) ： ( D ) ： ( ii ) ： ( xi ) ：SEQ ID NO：4 1 Met Gly Asn Glu Ala Ser Tyr Pro Ala Glu Met Cys Ser His Phe 16 Asn Asn Asp Glu Ile Lys Arg Leu Gly Arg Arg Phe Lys Lys Leu 31 Asp Leu Asp Lys Ser Gly Ser Leu Ser Val Glu Glu Phe Met Ser 46 Leu Pro Glu Leu Arg His Asn Pro Leu Val Arg Arg Val Ile Asp 61 Val Phe Asp Thr Asp Gly Asp Gly Glu Val Asp Phe Lys Glu Phe 76 Ile Leu Gly Thr Ser Gln Phe Ser Val Lys Gly Asp Glu Glu Gln 91 Lys Leu Arg Phe Ala Phe Ser Ile Tyr Asp Met Asp Lys Asp Gly106 Tyr Ile Ser Asn Gly Glu Leu Phe Gln Val Leu Lys Met Met Val121 Gly Asn Asn Leu Thr Asp Trp Gln Leu Gln Gln Leu Val Asp Lys136 Thr Ile Ile Ile Leu Asp Lys Asp Gly Asp Gly Lys Ile Ser Phe151 Glu Glu Phe Ser Ala Val Val Arg Asp Leu Glu Ile His Lys Lys166 Leu Val Leu Ile Val ( 2 ) SEQ ID NO：5 ( i )
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:5:TCTGGGATCC ATGGGAAACG AGGCCAGTT 29 (2) SEQ ID NO:6
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:6:GTAGGGATCC TCATACGATG AGGACCAGC 29 (2) SEQ ID NO:7
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (iii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:7:TCTGAAGCTT ATGGGAAACG AGGCCAGTT 29 (2) SEQ ID NO:8
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:8:GTAGGGATCC TCATACGATG AGGACCAGC 29
Claims (14)
1. isolated dna molecular, it is characterized in that, it comprises: coding has the nucleotide sequence of the polypeptide of people CNBII protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 1-513 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 1-513 position.
2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.
3. dna molecular as claimed in claim 1 is characterized in that, this sequence has the sequence of Nucleotide 1-513 position among the SEQ ID NO.3.
4. isolating CNBII protein polypeptide is characterized in that it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.
5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.
6. a carrier is characterized in that, it contains the described DNA of claim 1.
7. one kind with the described carrier transformed host cells of claim 6.
8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.
9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.
10. a generation has the method for the polypeptide of CNBII protein-active, it is characterized in that this method comprises:
(a) nucleotide sequence that coding is had a polypeptide of CNBII protein-active operationally is connected in expression regulation sequence, form the CNBII protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 1-513 position among described nucleotide sequence and the SEQ ID NO.3;
(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of CNBII;
(c) be fit to express under the condition of CNBII protein polypeptide the reconstitution cell in the culturing step (b);
(d) isolate polypeptide with CNBII protein-active.
11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 1-513 position among the SEQ ID NO.3.
12. energy and the described CNBII protein polypeptide of claim 4 specificity bonded antibody.
13. a nucleic acid molecule is characterized in that, it is the antisense sequences of the described dna molecular of claim 1.
14. a probe molecule is characterized in that, it contains about 8-100 continuous nucleotide in the described dna molecular of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN98121923A CN1249347A (en) | 1998-09-30 | 1998-09-30 | Human calcineurin regulatory subunit, its coding sequence and its preparing process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN98121923A CN1249347A (en) | 1998-09-30 | 1998-09-30 | Human calcineurin regulatory subunit, its coding sequence and its preparing process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1249347A true CN1249347A (en) | 2000-04-05 |
Family
ID=5227417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN98121923A Pending CN1249347A (en) | 1998-09-30 | 1998-09-30 | Human calcineurin regulatory subunit, its coding sequence and its preparing process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1249347A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001072772A3 (en) * | 2000-03-30 | 2001-12-13 | Merck Patent Gmbh | Calcium binding regulatory subunit |
| CN105420209A (en) * | 2015-12-30 | 2016-03-23 | 海口奇力制药股份有限公司 | Method for preparing rhCNB dimer |
-
1998
- 1998-09-30 CN CN98121923A patent/CN1249347A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001072772A3 (en) * | 2000-03-30 | 2001-12-13 | Merck Patent Gmbh | Calcium binding regulatory subunit |
| CN105420209A (en) * | 2015-12-30 | 2016-03-23 | 海口奇力制药股份有限公司 | Method for preparing rhCNB dimer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1128878C (en) | Coding sequence of human methionine sulfoxide reductase, its encoded polypeptide and its preparing process | |
| CN1249347A (en) | Human calcineurin regulatory subunit, its coding sequence and its preparing process | |
| CN1132939C (en) | Coding sequence of pyrophosphate synthetase, its encoded polypeptide and its preparing process | |
| CN1287171A (en) | Human neuron calcium sensing protein and its code sequence, preparation and use | |
| CN1125177C (en) | Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process | |
| CN1125178C (en) | Coding sequence of human serine/threonine kinase II, its encoded polypeptide and its preparing process | |
| CN1246529A (en) | Coding sequence of human translation initiation factor subunit, its encoded polypeptide and its preparing process | |
| CN1277259A (en) | Homologous protein of late embryo ample-protein and its code sequence | |
| CN1248624A (en) | Novel human capside protein subunit coding sequence, its coded polypeptide and preparation process | |
| CN1249342A (en) | Human phosphatidyl ethanolamine-N-methyltransferase, its coding sequence and its preparing process | |
| CN1287169A (en) | New human G protein protomer and its code sequence | |
| CN1253180A (en) | Specific protein of human neuroendocrine, coding sequence and its preparating process and application | |
| CN1277260A (en) | Human actin related protein subunit and its code sequence | |
| CN1264739A (en) | Human protein and its coding sequence, preparing process and application | |
| CN1257921A (en) | Human melanoma growth correlation factor and its coding sequence, preparing process and usage | |
| CN1246532A (en) | Coding sequence of human heat shock associated protein, its encoded polypeptide and its preparing process | |
| CN1250096A (en) | New human protein phosphatase subunit and its coding series and preparation | |
| CN1261102A (en) | Human spindle protein and its coding sequence, preparing process and application | |
| CN1250097A (en) | New human gene coding series and the polypeptide therewith and its preparation | |
| CN1264740A (en) | Human UMP-CMP kinase and its coding sequence, preparing process and application | |
| CN1257920A (en) | Human melanoma growth correlation factor and its coding sequence, preparing process and usage | |
| CN1251860A (en) | Human gene sequence and its coded polypeptide, preparing process and application | |
| CN1287172A (en) | Human uridine kinase and its code sequence, preparation and application | |
| CN1252446A (en) | New human gene sequence and encoded polypeptide and the preparation and application | |
| CN1431306A (en) | Derivatization growth factors 5 of human liver cancer, its coding sequence, preparing method and usage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1044581 Country of ref document: HK |