CN1125177C - Coding sequence of human short-chain alcohol dehydrogenase, its encoded polypeptide and its preparing process - Google Patents

Abstract

The present invention relates to a new human short-chain alcohol dehydrogenase HSHEP27L. The present invention provides a cDNA coding sequence of the new human short-chain alcohol dehydrogenase and a method for using a recombination technique to produce the new human short-chain alcohol dehydrogenase. The present invention also provides the application of the new human short-chain alcohol dehydrogenase.

Description

HSHEP27L encoding sequence, its encoded polypeptides and preparation method

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of HSHEP27L.The invention still further relates to the production method of described polynucleotide sequence and described polypeptide, and the production method of these polynucleotide and described polypeptide.

Short-chain alcohol dehydrogenase family (SCAD), be one and extensively be present in the big class alcoholdehydrogenase of one in prokaryotic organism and the eukaryote, its function relates to biological nitrogen fixation, carbohydrate metabolism, the metabolism of steroid class, aromatic hydrocarbon and prostaglandin(PG), and antibiotic synthetic etc., be that a member is numerous, the crucial again extended familys of function ( J Steroid Biochem Mol Biol1994 Nov; 51 (3-4): 125-130.).Usually the size of short-chain alcohol dehydrogenase is about 300 amino acid, and needing NAD or NADP is prothetic group, and does not rely on any metal ion effect, and classical long-chain alcohol desaturase then is about 700 amino acid, highly rely in the time of in action zine ion ( Mol Cell Endocrinol1992 Mar; 84 (1-2): C25-C31.).It has been generally acknowledged that SCAD works in the transmission of intercellular information, be presented as the mutual conversion between the activity form of catalysis signaling molecule.Signaling molecule that some are important such as steroid, carbohydrate, prostaglandin(PG) etc., all have the hydroxyl that quantity does not wait, and SCAD is the reaction (and reversed reaction) of carbonyl by catalysis with these hydroxyl oxidizes, regulates the activity of these signaling molecules, changes the ability of it and receptors bind.In Mammals, SCAD mainly shows as steroid class fermentoid, can control the sensitivity of target cell to steroid hormones such as glucocorticosteroid, mineralocorticoid or sexual hormoue, reacts with different hormone responses and suppresses or promote cell growth.Clinical study shows, hypertension, Down's syndrome and senile dementia, all with SCAD relevant unusually ( J Steroid Biochem Mol Biol1994 Nov; 51 (3-4): 125-130.).

The short-chain alcohol dehydrogenase of first discovery is the ethanol dehydrogenase of fruit bat, during by 1991 member's number of SCAD family only be more than 20 ( Eur-J-Biochem.1991 Sep 1; 200 (2): 537-43.).In recent years, many short-chain alcohol dehydrogenases in plant, fungi, insect, Mammals, have all been found.People such as Donadel.G and Gabrielli.F found in people's liver embryoma cell in 1991 a kind of nucleoprotein ( Eur-J-Biochem.1991 Feb14; 195 (3): 723-9.), identify that in nineteen ninety-five it is one of SCAD family, and called after " HEP27 " ( Eur-J-Biochem.1995 Sep 1; 232 (2): 473-7.).So far, amount to existing more than 300 of the short-chain alcohol dehydrogenase of finding.Studies show that they all have certain dependency in phylogeny.However, before the present invention came forth, still nobody disclosed the newcomer of the human SCAD family that relates among the application.

An object of the present invention is to provide a kind of new polynucleotide, a newcomer of this polynucleotide encoding short-chain alcohol dehydrogenase family, short-chain alcohol dehydrogenase of the present invention is named as HSHEP27L (GenBankAccession No.AF064256).

Another object of the present invention provides a kind of new HSHEP27L family member, and this enzyme is named as HSHEP27L.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new HSHEP27L.

The present invention also provides the application of this HSHEP27L gene order and polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people HSHEP27L protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 28-864 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 28-864 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence is SEQ ID NO.3.

In another aspect of this invention, provide a kind of isolating HSHEP27L protein polypeptide, it comprises: have polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, the method that provides a kind of generation to have the polypeptide of HSHEP27L protein-active, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of HSHEP27L protein-active operationally is connected in expression regulation sequence, form the HSHEP27L protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 28-864 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of HSHEP27L;

(c) be fit to express under the condition of HSHEP27L protein polypeptide the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with HSHEP27L protein-active.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 1196 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 28-864 position Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " HSHEP27L albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with HSHEP27L protein-active is as 28-864 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 28-864 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 28-864 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition with SEQ ID NO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 28-864 position.In addition, this term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of the nucleotide sequence of Nucleotide 28-864 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people HSHEP27L identical function.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " HSHEP27L protein polypeptide " refers to have the SEQID NO.4 polypeptide of sequence of HSHEP27L protein-active.This term also comprises having and the variant form HSHEP27L identical function, SEQ IDNO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of HSHEP27L and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of HSHEP27L DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-HSHEP27L polypeptide to obtain.The present invention also provides other polypeptide, as comprises HSHEP27L polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention also provides the soluble fragments of HSHEP27L polypeptide.Usually, this fragment have the HSHEP27L peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of HSHEP27L albumen or polypeptide.The difference of these analogues and natural HSHEP27L polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue can also comprise having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

The present invention also comprises the antisense sequences of HSHEP27L polypeptid coding sequence.This antisense sequences can be used for suppressing the expression of HSHEP27L in the cell.

The present invention also comprises a kind of probe molecule, and this molecule has 8-100 of HSHEP27L polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of the HSHEP27L that encodes.

The present invention also comprises the method that detects the HSHEP27L nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer can be positioned at the both sides or the centre of this encoding sequence corresponding to the encoding sequence of HSHEP27L polypeptide.Primer length is generally 20-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises HSHEP27L DNA or the polypeptide of its fragment coding has specific antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into HSHEP27L gene product or fragment.Preferably, refer to that those can combine with HSHEP27L gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of HSHEP27L, comprise that also those do not influence the antibody of HSHEP27L protein function.The present invention also comprise those can with modify or without the HSHEP27L gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the HSHEP27L gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing HSHEP27L or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler, Nature256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block the HSHEP27L function and the antibody that does not influence the HSDHML function.Each antibody-like of the present invention can utilize the fragment or the functional zone of HSHEP27L gene product, obtains by immunological technique.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of HSHEP27L gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

In the present invention, the cDNA nucleotide sequence of HSHEP27L is so to obtain: with people's liver λ gt11cDNA library (available from Clontech company) is template, synthetic forward primer 5 '-GGAACCCATCACTTGCTGGTCGT-3 ' and reverse primer 5 '-TTCCACTCCAGGTTCCTTCTCTC-3 ', carry out PCR, obtain the purpose fragment of 1196bp.After identifying order-checking, obtain the full length cDNA sequence of SEQ ID NO.3.

Find that by the homology retrieval the present invention's (cDNA sequence of HSHEP27L) has and the gene height homologous sequence of being delivered and confirm as short-chain alcohol dehydrogenase (SCAD), and the albumen that the present invention relates to has the aminoacid sequence of short-chain alcohol dehydrogenase family high conservative.Further retrieval shows, the present invention with delivered and confirmed as human HEP27 gene and had high homology, and known HEP27 also belongs to short-chain alcohol dehydrogenase family.So we think that the HSHEP27L gene also belongs to SCAD family, and be a homologous gene of people HEP27 gene and have similar function.

Human cell tissue be grown in the adjusting that is subjected to hormone to a great extent, such as common glucocorticosteroid and mineralocorticoid, promote male hormone, the female hormone of growth and suppress the hydrocortisone etc. of growth.These hormones normally arrive earlier in the kytoplasm of target cell, and then enter in the nuclear, combine with specific intranuclear receptor, and and then performance regulating and controlling effect.If above-mentioned deduction is correct, just have reason to believe the hormone metabolism process that the albumen that the present invention relates to has participated in taking place, the change of the active structure by various hormones of catalysis and hormone receptor in cell, make cell be subjected to corresponding regulation and control, and corresponding the change taken place.Generally speaking, its function is to make the factor inactivation that promotes growth, or the generation of catalytic growth supressor, suppresses duplicating of DNA, has also suppressed cell simultaneously and has entered division stage.

Short-chain alcohol dehydrogenase with regard to recent findings, no matter be animal or plant, which express at position no matter be, SCAD is always relevant with growing of biont or embryo, therefore, the scholars of many sagacities now are considered as short-chain alcohol dehydrogenase SCAD to study the forward position and the focus of biological developmental mechanism.

In addition, be easy to make the people to expect with proteic all effects of homologous SCAD of the present invention family, its may be able to suppress growth of tumour cell, checks the further division that suppresses tumour cell by dna replication dna.In fact, the HEP27 albumen of close ties is arranged with the present invention, relevant with the vitro differentiation of certain liver neoplasm clone, just relevant really with tumor suppression.This valuable character also makes the present invention very likely become one of few cancer suppressor gene family member of quantity to the modern weapons that we have brought antagonism cancer and tumour.We think that enzymic activity of the present invention can be subjected to the adjusting of multiple factor, and have the regulation and control on the post-transcriptional level probably, and this more further studies cancer therapy and has brought gratifying hope.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of HSHEP27L

1. primer amplification

With people's liver λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A1:5 '-GGAACCCATCACTTGCTGGTCGT-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide A2:5 '-TTCCACTCCAGGTTCCTTCTCTC-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition of A1/A2 be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 62 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.Electrophoresis detection is carried out the product that pcr amplification obtains with A1, A2, and the purpose fragment length is 1196bp.

2.PCR the order-checking of product

Will be with A1, A2 the amplification product and the pGEM-T that obtain ^Carrier (Promega) connects, transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), carry out the mistake of orientations Lieque to inserting fragment, carry out Rapid identification and ordering with PCR to lacking son then with double-stranded nested type disappearance test kit (pHarmacia).Use SequiTherm EXCEL ^TMDna sequencing kit (Epicentre Technologies) checks order to disappearance of brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 1196bp, detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 28---864 position Nucleotide.Derive the aminoacid sequence of HSHEP27L according to the full length cDNA sequence that obtains, totally 278 amino-acid residues, its aminoacid sequence sees SEQ ID NO.4 for details.

Embodiment 2

Homology relatively

Full length cDNA sequence and proteins encoded thereof with HSHEP27L carry out nucleic acid and albumen homology retrieval with BLAST in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database.Found that it and delivered and confirm as to have height homologous sequence between the gene of short-chain alcohol dehydrogenase (SCAD), and the albumen that the present invention relates to has the aminoacid sequence of short-chain alcohol dehydrogenase family high conservative.Further retrieval shows, there is homology in it with the human HEP27 gene (nucleic acid and albumen searching number are respectively gb|U31875 and sp|Q13268) that has come forth on nucleic acid and protein level, wherein between their protein sequence 65%Identities is arranged, 89%Positives, though and the 30%Identities that only has an appointment between its nucleotide sequence, but be speculated as then very similar (the 155-332 bit base of HSHEP27L of sequence in enzymic activity decision zone at them, 80%identity), thus this gene be identified homologous gene into people HEP27 gene.Again because HEP27 has been accredited as human short-chain alcohol dehydrogenase family member, and Methionin that the strictness that has SCAD family in the protein sequence of HSHEP27L is conservative and tyrosine and conserved sequence (J Steroid BiochemMol Biol 1993 Apr that some are significant; 45 (1-3): 161-165),

Particularly in the aminoacid sequence of HSHEP27L, exist by what 26 amino acid were formed and be considered to the total characteristic sequence of short-chain alcohol dehydrogenase family (SCAD)---(L/I/V/S/P/A/D/K) X12Y (P/S/T/A/G/N/C/V) (S/T/A/G/N/Q/C/I/V/M) (S/T/A/G/C) K{P/C} (S/A/G/F/R) (L/I/V/M/T/A/G/D) X2 (L/Y/V/M/F/Y/W) (L/I/V/M/F/W/G/A/P/T/H) (G/S/A/C/Q/K/H/M) [notes: X is an arbitrary amino acid in this sequence, numerals such as " 2 " is an amino acid number, " (S/T/A/G/C) " expression is optional amino acid from these 5 amino acid, and P/C} represents that these two amino acid can not occur on this position].The sequence fragment that meets above-mentioned pattern in albumen of the present invention is: SIAAFSPSPGFSPYNVSKTALLGLTK (169-194 position among the SEQ ID NO.4).This has determined that further HSHEP27L of the present invention also belongs to short-chain alcohol dehydrogenase family, and has the correlation function of short-chain alcohol dehydrogenase family.

HEP27 has been proved dna replication dna effect (the Eur-J-Biochem.1991 Feb 14 that can suppress human liver embryoma clone; 195 (3): 723-9.﹠amp; Eur-J-Biochem.1995 Sep 1; 232 (2): 473-7.), albumen involved in the present invention is determining the specific biochemical theory of function owing to structurally quite similar with HEP27 from protein structure, and we think that HSHEP27L of the present invention also has this function.In addition,, HSHEP27L belongs to human short-chain alcohol dehydrogenase family, so infer that its some functions that also have this family equally and had are rational because being proved.Can suppress apparent type mineralocorticoid excessive (A.M.E.) (apparent mineralocorticoid excess) (J Steroid Biochem MolBiol 1993 Apr under certain condition as this family; 45 (1-3): 161-165), this characteristic can be used to regulate hormone level, and the protection cell is avoided the stimulation of excessive hormone and stopped or hypertrophy.Recently, some reports show the member of SCAD families also participate in the embryonic tissue some signal of interest approach ( Proc Natl Acad Sci U.S.A.1998 Apr.14; 95 (8): 4404-4409.).

Embodiment 3

The expression of HSHEP27L in intestinal bacteria

In this embodiment, the cDNA sequence (GenBank Accession No.AF064256) of coding HSHEP27L is the PCR Oligonucleolide primers of using corresponding to 5 of this dna sequence dna ' and 3 ' end, and personnel selection liver λ gt11cDNA library (available from Clontech company) obtains HSHEP27L and inserts fragment for template increases.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5′-TTGGGGATCCATGCACAAGGCGGGGCTGC-3′(SEQ?ID?NO.5)

This primer contains the restriction enzyme site of the restricted restriction enzyme of BamH1, and what connect is 19 Nucleotide of the HSHEP27L encoding sequence that begun by initiator codon;

3 ' end primer sequence is:

5’-CGTCGGATCCTCAGAGGCGGGACGGGGTT-3’(SEQ?ID?NO.6)

This primer contains the restriction enzyme site of the restricted restriction enzyme of BamH1,19 Nucleotide of the encoding sequence of translation termination and HSHEP27L.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Ampr), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.

With BamHI digestion pQE-9 carrier, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kanr).Screen transformant containing on the LB culture dish of Amp and Kan, the extracting plasmid cuts with Hind III enzyme and to identify and insert clip size and direction, and the cDNA fragment of sequence verification HSHEP27L has correctly been inserted carrier.

Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when reaching 0.4-0.6, add people IPTG (" isopropylthio-") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved HSHEP27L from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out HSHEP27L from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.At first, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein can be incorporated in second post from nickel-chelate column, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS-PAGE glue with 12% carries out electrophoresis, identifies the molecular weight size of expressing protein, and the molecular weight size that records HSHEP27L is about 30kDa.

In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 4

The expression of HSHEP27L in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, with the cDNA sequence (GenBank Accession No.AF064256) of coding HSHEP27L is the PCR Oligonucleolide primers of using corresponding to 5 of this dna sequence dna ' and 3 ' end, personnel selection liver λ gt11cDNA library (available from Clontech company) obtains HSHEP27L and inserts fragment for template increases.

5 ' the Oligonucleolide primers sequence of using in the PCR reaction is:

5′-TTGGGGATCCATGCACAAGGCGGGGCTGC-3′(SEQ?ID?NO.5)

This primer contains the restriction enzyme site of the restricted restriction enzyme of BamHI, is 19 Nucleotide of the HSHEP27L encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5’-CGTCGGATCCTCAGAGGCGGGACGGGGTT-3’(SEQ?ID?NO.6)

This primer contains the encoding sequence of the restriction enzyme site of the restricted restriction enzyme of BamHI, translation termination and HSHEP27L.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3 (Invitrogen company), and this plasmid vector coding antibiotics resistance (Ampr and Neor), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA are in proper order.

With BamHI digestion pcDNA3 carrier, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The extracting plasmid cuts evaluation with the ApaI enzyme and insert clip size and direction, and the cDNA fragment of sequence verification HSHEP27L has correctly been inserted carrier.

Plasmid transfection is to adopt lipofection, carries out with Lipofectin test kit (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mM TrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS-PAGE glue with 12% carries out electrophoresis, identifies the molecular weight size of expressing protein, and the molecular weight size that records HSHEP27L is about 30kDa.

In addition, the amino acid of expressing proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that as above obtains is used for immune animal to produce antibody, specific as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation HSHEP27L gene translation product with it.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Information (i) sequence signature of sequence table (2) SEQ ID NO.1

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.1:GGAACCCATC ACTTGCTGGT CGT 23 (2) SEQ ID NO.2

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: the information of SEQ ID NO:2TTCCACTCCA GGTTCCTTCT CTC 23 (2) SEQ ID NO.3: (i) sequence signature:

(A) length: 1196bp

(B) type: nucleic acid

(C) chain: strand

( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO.3 1 GGAACCCATCACTTGCTGGTCTGATCCATGCACAAGGCGGGGCTGCTAGGCCTCTGTGCC 61 CGGGCTTGGAATTCGGTGCGGATGGCCAGCTCCGGGATGACCCGCCGGGACCCGCTCGCA 121 AATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTCGCCATCGCCCGGCGT 181 TTGGCCCAGGACGGGGCCCATGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTGGACCAG 241 GCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACCGTGTGCATGGTGGGG 301 AAGGCGGAGGACCGGGAGCGGCTGGTGGCCACGGCTGTGAAGCTTCATGGAGGTATCGAT 361 ATCCTAGTCTCCAATGCTGCTGTCAACCCTTTCTTTGGAAGCATAATGGATGTCACTGAG 421 GAGGTGTGGGACAAGACTCTGGACATTAATGTGAAGGCCCCAGCCCTGATGACAAAGGCA 481 GTGGTGCCAGAAATGGAGAAACGAGGAGGCGGCTCAGTGGTGATCGTGTCTTCCATAGCA 541 GCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTCAGTAAAACAGCCTTGCTGGGC 601 CTGACCAAGACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTGAACTGCCTAGCA 661 CCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGGAA 721 AGCATGAAAGAAACCCTGCGGATAAGAAGGTTAGGCGAGCCAGAGGATTGTGCTGGCATC 781 GTGTCTTTCCTGTGCTCTGAAGATGCCAGCTACATCACTGGGGAAACAGTGGTGGTGGGT 841 GGAGGAACCCCGTCCCGCCTCTGAGGACCGGGAGACAGCCCACAGGCCAGAGTTGGGCTC 901 TAGCTCCTGGTGCTGTTCCTGCATTCACCCACTGGCCTTTCCCACCTCTGCTCACCTTAC 961 TGTTCACCTCATCAAATCAGTTCTGCCCTGTGAAAAGATCCAGCCTTCCCTGCCGTCAAG1021 GTGGCGTCTTACTCGGGATTCCTGCTGTTGTTGTGGCCTTGGGTAAAGGCCTCCCCTGAG1081 AACACAGGACAGGCCTGCTGACAAGGCTGAGTCTACCTTGGCAAAGACCAAGATATTTTT1141 TCCTGGGCCACTGGGGAATCTGAGGGGTGATGGGAGAGAAGGAACCTGGAGTGGAA ( 2 ) SEQ ID NO.4：

(i) sequence signature:

(A) length: 278 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: polypeptide

( xi ) ：SEQ ID NO.4 1 Met His Lys Ala Gly Leu Leu Gly Leu Cys Ala Arg Ala Trp Asn 16 Ser Val Arg Met Ala Ser Ser Gly Met Thr Arg Arg Asp Pro Leu 31 Ala Asn Lys Val Ala Leu Val Thr Ala Ser Thr Asp Gly Ile Gly 46 Phe Ala Ile Ala Arg Arg Leu Ala Gln Asp Gly Ala His Val Val 61 Val Ser Ser Arg Lys Gln Gln Asn Val Asp Gln Ala Val Ala Thr 76 Leu Gln Gly Glu Gly Leu Ser Val Thr Gly Thr Val Cys Met Val 91 Gly Lys Ala Glu Asp Arg Glu Arg Leu Val Ala Thr Ala Val Lys106 Leu His Gly Gly Ile Asp Ile Leu Val Ser Asn Ala Ala Val Asn121 Pro Phe Phe Gly Ser Ile Met Asp Val Thr Glu Glu Val Trp Asp136 Lys Thr Leu Asp Ile Asn Val Lys Ala Pro Ala Leu Met Thr Lys151 Ala Val Val Pro Glu Met Glu Lys Arg Gly Gly Gly Ser Val Val166 Ile Val Ser Ser Ile Ala Ala Phe Ser Pro Ser Pro Gly Phe Ser181 Pro Tyr Asn Val Ser Lys Thr Ala Leu Leu Gly Leu Thr Lys Thr196 Leu Ala Ile Glu Leu Ala Pro Arg Asn Ile Arg Val Asn Cys Leu211 Ala Pro Gly Leu Ile Lys Thr Ser Phe Ser Arg Met Leu Trp Met226 Asp Lys Glu Lys Glu Glu Ser Met Lys Glu Thr Leu Arg Ile Arg241 Arg Leu Gly Glu Pro Glu Asp Cys Ala Gly Ile Val Ser Phe Leu256 Cys Ser Glu Asp Ala Ser Tyr Ile Thr Gly Glu Thr Val Val Val271 Gly Gly Gly Thr Pro Ser Arg Leu

(2) information of SEQ ID NO.5

(i) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(xi) sequence description: SEQ ID NO.5:

TTGGGGATCC?ATGCACAAGG?CGGGGCTGC?29

(2) information of SEQ ID NO.6

(i) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO.6:CGTCGGATCC TCAGAGGCGG GACGGGGTT 29

Claims (11)

1. an isolated dna molecular is characterized in that, described dna molecule encode one polypeptide, and this polypeptide contains the sequence shown in the SEQ ID NO:4.

2. dna molecular as claimed in claim 1 is characterized in that, described dna molecule encode one polypeptide, and the sequence of this polypeptide is shown in SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence is SEQ ID NO.3.

4. an isolating HSHEP27L protein polypeptide is characterized in that, it contains SEQ ID NO.4 aminoacid sequence.

5. polypeptide as claimed in claim 4 is characterized in that, this amino acid sequence of polypeptide is shown in SEQ ID NO.4.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. host cell as claimed in claim 7 is characterized in that this cell is intestinal bacteria.

9. host cell as claimed in claim 7 is characterized in that this cell is an eukaryotic cell.

10. one kind produces the proteic method of HSHEP27L, it is characterized in that this method comprises:

(a) the proteic nucleotide sequence of HSHEP27L of will encoding operationally is connected in expression regulation sequence, forms the HSHEP27L protein expression vector, a described nucleotide sequence coded polypeptide, and this polypeptide contains the aminoacid sequence shown in the SEQ ID NO:4

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of HSHEP27L;

(c) be fit to express under the condition of HSHEP27L protein polypeptide the reconstitution cell in the culturing step (b);

(d) isolate HSHEP27L albumen.

11. method as claimed in claim 10 is characterized in that, this sequence is from Nucleotide 28-864 position among the SEQ ID NO.3.