CN1278557A - Human protein kinase inhibitor gamma and its code sequence, preparation and use - Google Patents

Abstract

The present invention provides a c DNA sequence of human protein kinase inhibitor gamma (called h PKI gamma). Said protein is member of PKI family. Said invention also relates to polypeptide of said nucleotide sequence code, application of these polynucleotides and polypeptide and production method of them.

Description

Human protein kinase inhibitor gamma and encoding sequence thereof and method for making and purposes

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of human protein kinase inhibitor gamma (human Protein KinaseInhibitor γ abbreviates " hPKI γ " as), this albumen is the member of PKI family.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.

The protein kinase (PKA) that cAMP relies on is a subfamily of Threonine/Serine family.The member of this family effect in the process that cell is reacted to hormone and neurotransmitter is important.In the time of the cAMP lower concentration, PKA forms the holoenzyme form by two adjusting (R) subunits and two catalysis (C) subunit, and is in inactive state (McKnight, G.S.Curr.Opin.Cell Biol.3:213-317,1991); When cAMP reached finite concentration, each R subunit all combined with cAMP, thereby discharged the C subunit.The C subunit can make the Threonine and the serine residue phosphorylation of protein substrate then, cause the variation of a series of biological functions, for example, change cell fission speed, cellular form, film ion permeability, participate in metabolic enzymic activity or gene transcription level (Francis, S.H.et al.Annu.Rev.Physiol.56:237-272,1994:Lee, K.A.W.Curr.Opin.Cell Biol.3:953-959,1991).The C subunit has three kinds of isoforms, and the R subunit has four kinds, their tissue expression situation difference, and also different with the binding ability of R subunit.

The C subunit except being suppressed also to be suppressed (Walsh, D.A.et al.Curr.Opin.Cell Biol.4:241-251,1992) by protein kinase inhibitor (PKI) the activity by the R subunit.PKI is single-minded, the effective supressor of C subunit, and the inhibition of PKI can not be alleviated by cAMP, because it does not contain the cAMP binding site, this point is different with the inhibition situation of R subunit.Similar to the situation of C subunit, found the isomer of multiple PKI up to now.Clone and the identification research of cDNA show to have two genes encoding PKI in the Mammals at least, according to the difference of tissue distribution characteristic, are named as PKI α and PKI β respectively.PKI α expresses (Olsen, S.R.et al J.Biol.Chem.266:11158-11162,1991 at heart, skeletal muscle, pallium, cerebellum height; Van Patten, S.M.et al.Mol.Endocrinol.6:2114-2122,1992), PKI β mainly expresses (Van Patten, S.M.et al.Mol.Endocrinol.6:2114-2122,1992) at the testis camber.

To the research of PKI is that skeletal muscle from rabbit begins, the PKI that therefrom is separated to (PKI α) albumen is made up of 75 amino-acid residues, (Scott, J.D.et al.Proc.Natl.Acad.Sci.U.S.A.82:5732-5736,1985) finished in examining order in 1985.People such as Van Patten are cloned into PKI β from rat, 70 amino-acid residues of encoding are formed, combine with C subunit specificity, and the amino-acid residue in its crucial counterfeit substrate site (pseudosubstrate site) is conservative, identical (Van Patten with PKI α, S.M.et al Proc.Natl.Acad.Sci.U.S.A.88:5383-5387,1991).From mouse brain cDNA library, clone again recently and identify two kinds of PKI β, be named as PKI β 1 and PKI β 2 (Marco, A.et al.J.Biol.Chem.266:10927-10931,1995).Not long ago, be reported in the another isoform PKI γ of clone's evaluation in the mouse, and can effectively suppress PKA and wide expression (Sean, P.et al.J.Biol.Chem.272:18169-18178,1997).Also relevant for PKI clone's report, reach 100% with the proteic identity of rabbit skeletal muscle PKI in human body, its expression can suppress PKA activity (Olsen, S.R.et al.Mol.Endocrinol.5:1246-1256,1991).

PKI is single-minded, the effective supressor of the C subunit of PKA.As preceding described, PKA has extensive and important effect in vivo, such as changing cellular form, gene transcription level, film ion permeability etc., therefore, PKI may bring into play necessary effect (Wiley, J.C.Et al.J.Biol.Chem.274:6381-6387,1997) (Wiley in being regulated by the genetic transcription that relies on cAMP activated PKA mediation, genetic expression sequential, J.C.Et al.J.Biol.Chem.274:6381-6387,1997).In addition, PKA has important regulatory role in the second messenger system of neurotransmitter, and PKI can suppress the activity of PKA, the signal transmission of assisting PKA to participate in.Micro-injection PKI experiment shows that PKI can effectively suppress the activity of PKA in the body, so PKI may become a strong tool (Fernandez, A.etal Exp.Cell.Res.195:468-477,1991) of specific function in the research PKA body.

Yet, before the present invention, still do not isolate, aminoacid sequence and the corresponding coding sequence of human protein kinase γ do not disclosed yet.

An object of the present invention is to provide a kind of new polynucleotide, a newcomer of this polynucleotide encoding PKI family, PKI family member of the present invention is named as human protein kinase inhibitor gamma (human ProteinKinase Inhibitor γ abbreviates " hPKI γ " as).

Another object of the present invention provides a kind of new people's PKI family member, and this albumen is named as hPKI γ albumen.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's hPKI γ polypeptide.

The present invention also provides this people's the hPKI γ nucleotide sequence and the application of polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people hPKI γ protein-active, shows at least 70% homology from the nucleotides sequence of 28-258 in Nucleotide among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of 28-258 in Nucleotide.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from 28-258 in Nucleotide.

In another aspect of this invention, provide a kind of isolating people hPKI γ protein polypeptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people hPKI γ protein-active, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people hPKI γ protein-active operationally is connected in expression regulation sequence, form people hPKI γ protein expression vector, show at least 70% homology from the nucleotides sequence of 28-258 in Nucleotide among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people hPKI γ;

(c) under the condition that is fit to expressing human hPKI γ protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people hPKI γ protein-active.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 354 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 28-258 Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people hPKI γ albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people hPKI γ protein-active is as 28-258 nucleotide sequences among the SEQ ID NO.3 and degenerate sequence thereof.This degenerate sequence is meant, is arranged in 28-258 Nucleotide of encoder block of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 28-258 nucleotide sequence homologies be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of 28-258 in Nucleotide.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of 28-258 in Nucleotide, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people hPKI γ identical function.These variant forms comprise (but being not limited to): several (are generally 1-30, preferably 1-20, more preferably 1-10,1-5 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 20 to hold interpolation 5 ' and/or 3 ', preferably being in 10, more preferably is in 5, is in 3 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people hPKI γ protein polypeptide " refers to have the SEQ ID NO.4 polypeptide of sequence of people hPKI γ protein-active.This term also comprises having and variant form people hPKI γ identical function, SEQ IDNO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-15, preferably 1-10, more preferably 1-5,1-3 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 10, preferably being in 5, more preferably is in 3) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people hPKI γ and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people hPKI γ DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people hPKI γ polypeptide to obtain.The present invention also provides other polypeptide, as comprises people hPKI γ polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people hPKI γ polypeptide.Usually, this fragment have people hPKI γ peptide sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 60 continuous amino acids, best at least about 70 continuous amino acids.

Invention also provides the analogue of people hPKI γ albumen or polypeptide.The difference of these analogues and natural human hPKI γ polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from natural L-amino acid whose residue (as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, γ-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " people hPKI γ conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID No.4, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser

Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The present invention also comprises people hPKI γ polypeptid coding sequence and segmental antisense sequences thereof.This antisense sequences can be used for suppressing the expression of people hPKI γ in the cell.

The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people hPKI γ polypeptid coding sequence, preferably 15-50 continuous nucleotides usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people hPKI γ.

The present invention also comprises the method that detects people hPKI γ nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people hPKI γ polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.Such as, select commercially available carrier for use, the nucleotide sequence with code book invention polypeptide operationally is connected in expression regulation sequence then, can form protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises people hPKI γ DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people hPKI γ gene product or fragment.Preferably, refer to that those can combine with people hPKI γ gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people hPKI γ, comprise that also those do not influence the antibody of people hPKI γ protein function.The present invention also comprise those can with modify or without the people hPKI γ gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people hPKI γ gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human hPKI γ or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people hPKI γ function and the antibody that does not influence people hPKI γ function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people hPKI γ gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people hPKI γ gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

People hPKI γ Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence (especially because the fragment of hPKI γ is shorter).Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

In one embodiment of the invention, the cDNA nucleotide sequence of people hPKI γ is so to obtain, with people's testis λ gt11cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A:5 '-ACAGGCCTGAGGAGCGATGCAC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-GGAGCTCAGAGAAGAGGCTGCTG-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 64 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment (SEQ ID NO:3) of 350bp.

PKI is single-minded, the effective supressor of the C subunit of PKA.HPKI γ of the present invention may have important regulatory role in neural second messenger system, because PKA is important second messenger in neural system, and the homologue PKI of hPKI γ can suppress the activity of PKA.HPKI γ of the present invention also may the necessary effect (Wiley, J.C.Et al.J.Biol.Chem.274:6381-6387,1997) of performance in being regulated by the genetic transcription that relies on cAMP activated PKA mediation, genetic expression sequential.In addition, hPKI γ of the present invention also may effectively suppress the PKA activity in vivo, thereby is a strong tool of specific function in the research PKA body.

In addition, because hPKI γ of the present invention has the natural acid sequence that is derived from the people, therefore, compare, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour with the albumen of the same clan that derives from other species.

In the accompanying drawings, Fig. 1 is the homology comparison diagram of the aminoacid sequence of people hPKI γ of the present invention and mouse PKI γ.Wherein, identical amino acid marks with " Shu " between two sequences, and similar amino acid marks with ": ".Similar amino acid is: A, S, T; D, E; N, Q; R, K; I, L, M, V; F, Y, W.

Fig. 2 is people hPKI γ of the present invention and mouse PKI γ (mPKI γ), people PKI α (hPKI α) and P of Rats KI β 4 kinds of proteic amino acid sequence homologous comparison diagrams such as (rPKI β).Wherein, identical amino acid below sequence with " ^*" mark, similar amino acid marks with " * ".

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of people hPKI γ

1. primer amplification

With people's testis λ gt10cDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer---A:5 '-ACAGGCCTGAGGAGCGATGCAC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-GGAGCTCAGAGAAGAGGCTGCTG-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 64 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment of 350bp.

2.PCR the order-checking of product

Above-mentioned pcr amplification product A/B is connected with pGEM-T carrier (Promega), transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), check order with disappearance of SequiThermEXCELTMDNA sequencing kit (Epicentre Technologies) to brachymemma successively, with computer software splicing order, obtain full length cDNA sequence at last, altogether 354bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 28-258 Nucleotide.

Derive the aminoacid sequence of people hPKI γ according to the full-length gene group sequence that obtains, totally 76 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.

Embodiment 2

Homology relatively

Full length cDNA sequence and proteins encoded thereof with people hPKI γ of the present invention, in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database, carry out nucleic acid and albumen homology retrieval with blast program.Found that the PKI γ (gb|U97170) with mouse on nucleotide level has higher homology, identity is more than 86%.Homologous protein is more also supported the correct of this sequence, and the PKI γ identity of hPKI γ derivation Argine Monohydrochloride and mouse reaches 91% on amino acid levels, and similarity reaches 92% (people, both PKI γ homologies of mouse are relatively seen Fig. 1).HPKI γ has the conservative amino-acid residue (Phe10 of specificity in PKI α and PKI β, Arg15) (Glass, D.B.et al.J.Biol.Chem.264:8802-8810) and to PKI in conjunction with the important counterfeit substrate site of the restraining effect ((Scott of Arg18-Arg19-Asn20-Ala21), J.D.et al.Proc.Natl.Acad.Sci.U.S.A.82:4379-4383,1985).In addition, PKI can be positioned the C subunit in the cell, experiment shows, (Wen soon when C-PKI mixture transports nuclear and transports separately than C subunit when outer, W.et al.J.Biol.Chem.269:32214-32220,1994), in hPKI γ, exist one section with nuclear similarly sequence: the L38XG40XM42XXL45XL47 of signal (nuclear export signal) " L37XL39XL41XXL44XHy46 (X is an arbitrary amino acid; Hy is a hydrophobic amino acid) " that moves out, this section is rich in leucic sequence also conservative (people PKI γ and people PKI α in PKI α and PKI β, mouse PKI β, the homology of mouse PKI γ is relatively seen Fig. 2).Therefore, hPKI γ has the basic molecular structure of the protein kinase inhibitor of cAMP dependence, may have the function of the C subunit of similar inhibition PKA.

According to the structures shape function, the Biological Principles that the structural similitude function is relevant can be inferred the biological function of hPKI γ of the present invention according to the function of PKI gene in the known different plant species and proteins encoded thereof.

PKI can suppress the activity of PKA.The high level of C subunit reflects its importance as the second messenger of many neurotransmitters in the brain.PKI is with the Worker's Stadium wide expression in brain, in mouse experiment, PKI α mainly is distributed in cerebellum, hypothalamus, hippocampus and cortex, and content is abundant, PKI β then at most of zone level than low many of PKI α, but content abundant (Seasholtz, A.F.et al.Prot.Natl.Acad.Sci.U.S.A.92:1734-1738,1995) in pons, medullary substance, hypothalamic nucleus and cerebellum.

PKI can also transport the C subunit.The PKA holoenzyme is arranged in kytoplasm, has only the C subunit after the release just can enter nucleus, and this is the key that activates the genetic transcription of PKA mediation.And PKI can freely enter nucleus, the accumulation of blocking-up C subunit in nuclear, thus transporting it back tenuigenin terminator induces, the holoenzyme that the C subunit combine with the R subunit revert to non-activity participates in the cell adjusting of next round dependence cAMP.This shows PKI necessary effect (Wiley, J.C.Et al.J.Biol.Chem.274:6381-6387,1997) of performance in the genetic expression sequential that is participated in by cAMP is regulated.HPKI γ of the present invention has the effect that similar regulatory gene is expressed.

PKA plays a role in the necessary function of a lot of cells, and for example gene activation, albumen synthesize, DNA is synthetic, mitotic division.Basic PKA level is hindered in the born of the same parents but the specific function research of PKA is owing to reducing.The discovery of PKI will help the work of this respect.With the C subunit micro-injection of PKA behind rat embryo fibroblast, the raising of discovery intracellular kinase level can cause the great variety of cell shape and cytoskeleton, this is because the change of phosphorylation state of protein causes the thorough rearrangement (Lamb of actinmicrofilament and middle silk screen, N.J.et al.J.Cell.Biol.106:1955-1971,1989; Lamb, N.J.et a l.J.Cell.Biol.108:2409-2423,1989).And with PKI purifying, modified trace note in cell, can stop the cell shape that causes behind the kinase activator and the variation of cytoskeleton, and the transformation period of the PKI of modified, the PKI than unmodified grew 5 times, highly stable (Fernandez, A.et al Exp.Cell.Res.195:468-477,1991).HPKI γ of the present invention also can effectively suppress the PKA activity in vivo, is a strong tool of function in the research PKA body.

Clone's identification research of mouse PKI γ shows, PKI γ extensively highly expresses at tissues such as heart, skeletal muscle, testis, can effectively suppress the activity of PKA and the genetic transcription of cAMP dependence in experiment in vitro, can also suppress to accumulate in the nuclear of C subunit.Difference (Collins, S.P.et al.1997, J.Biol.Chem.272:18169-18178) before the discovery of PKI γ helps to explain between observed PKI vigor and the PKI mRNA level.

People hPKI γ of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor hPKI γ can also merge with other members of this family or exchange fragment, to produce new albumen.For example the C end of inventor hPKI γ and the C end of mouse PKI γ are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor hPKI γ, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor hPKI γ nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people hPKI γ or the overexpression that suppresses people hPKI γ.People hPKI γ albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people hPKI γ disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The expression of people hPKI γ in intestinal bacteria

In this embodiment, be template with pcr amplification product A/B among the embodiment 1, with the cDNA sequence of coding people hPKI γ use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people hPKI γ cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5 '-TCAAGTCGACATGATGGAGGTCGAGTCCT-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of SalI restriction enzyme, is 19 Nucleotide of the people hPKI γ encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5 '-TTGGAAGCTTTCAAGACGAGGTGGTCCC-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the people hPKI γ of HindIII restriction enzyme.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Ampr), a bacterium replication orgin (ori), IPTG-adjustable promotor/operon (P/O), a ribosome bind site (RBS), 6-histidine mark thing (6-His) and the restriction enzyme cloning site.

With SalI and HindIII digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed the lacI repressor and carries kalamycin resistance (Kanr).Screen transformant containing on the LB culture dish of Amp and Kan, the cDNA fragment of extracting plasmid sequence verification people hPKI γ has correctly been inserted carrier.

Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spent the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when being 0.4-0.6, add IPTG (" isopropylthio-β-D-galactoside ") to final concentration be 1mM.By making lacI repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hours, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved hPKI γ from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out hPKI γ from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS with 12%-PAGE glue carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 8kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 4

The expression of people hPKI γ in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, be template with pcr amplification product A/B among the embodiment 1, with the cDNA sequence of coding people hPKI γ use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers of 3 ' end increase, obtain people hPKI γ cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5′—TCAGAAGCTTATGATGGAGGTCGAGTCCT—3′(SEQ?ID?NO．7)

This primer contains the restriction enzyme site of HindIII restriction enzyme, is 17 Nucleotide of the people hPKI γ encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5′—TTGGGGATCCTCAAGACGAGGTGGTCCC—3′(SEQ?ID?NO．8)

This primer contains the part encoding sequence of the restriction enzyme site of BamHI restriction enzyme, translation termination and people hPKI γ.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp ^rAnd Neo ^r), a phage replication starting point (f1 ori), a virus replication starting point (SV40 ori), T7 promotor, viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and corresponding polyA order.

With HindIII and BamHI digestion pcDNA3 carrier and insertion fragment, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The cDNA fragment of extracting plasmid sequence verification people hPKI γ has correctly been inserted carrier.

The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 weeks, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mMTrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS with 12%-PAGE glue carries out electrophoresis, identifies that the molecular weight size of expressing protein is 8kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsifications carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people hPKI γ gene translation product with it.Found that antibody can precipitate with albumen of the present invention specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table (1) general information: (ⅰ) applicant: Fudan University (ⅱ) denomination of invention: human protein kinase inhibitor gamma and encoding sequence thereof and method for making and purposes (ⅲ) sequence number: information (ⅰ) sequence signature of 8 (2) SEQ ID NO.1

(A) length: 22 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO.1:ACAGGCCTGA GGAGCGATGC AC 22 (2) SEQ ID NO.2

(A) length: 23 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: the information of SEQ ID NO:2GGAGCTCAGA GAAGAGGCTG CTG 23 (2) SEQ ID NO.3: (ⅰ) sequence signature:

(A) length: 354bp

(B) type: nucleic acid

(C) chain: strand

(D) topological structure: linear (ⅱ) molecule type: cDNA (ⅲ) sequence description: the information of SEQ ID NO.3ACAGGCCTGA GGAGCGATGC ACTAGGCATG ATGGAGGTCG AGTCCTCCTA CTCGGACTTC 60ATCTCCTGTG ACCGGACAGG CCGTCGGAAT GCGGTCCCTG ACATCCAGGG AGACTCAGAG 120GCTGTGAGCG TGAGGAAGCT GGCTGGAGAC ATGGGCGAGC TGGCACTCGA GGGGGCAGAA 180GGACAGGTGG AGGGAAGCGC CCCAGACAAG GAAGCTGGCA ACCAGCCCCA GAGCAGCGAT 240GGGACCACCT CGTCTTGAAT CTGACCTTGT CCAAGAAGGC TGGACGAGAG ACCTTCTGTC 300CCCTCCCAGA GGGGAAACCC TGGCACTGGC CCAGCAGCCT CTTCTCTGAG CTCC 354 (2) SEQ ID NO.4: (ⅰ) sequence signature:

(A) length: 76 amino acid

(B) type: amino acid

(D) topological structure: linear (ⅱ) molecule type: polypeptide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO.4Met Met Glu Val Glu Ser Ser Tyr Ser Asp Phe Ile Ser Cys Asp 15Arg Thr Gly Arg Arg Asn Ala Val Pro Asp Ile Gln Gly Asp Ser 30Glu Ala Val Ser Val Arg Lys Leu Ala Gly Asp Met Gly Glu Leu 45Ala Leu Glu Gly Ala Glu Gly Gln Val Glu Gly Ser Ala Pro Asp 60Lys Glu Ala Gly Asn Gln Pro Gln Ser Ser Asp Gly Thr Thr Ser 75Ser 76 (2) SEQ ID NO.5

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO.5:TCAAGTCGAC ATGATGGAGG TCGAGTCCT 29 (2) SEQ ID NO.6

(A) length: 28 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (i) sequence signature of SEQ ID NO.6:TTGGAAGCTT TCAAGACGAG GTGGTCCC 28 (2) SEQ ID NO.7

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO.7TCAGAAGCTT ATGATGGAGG TCGAGTCCT 29 (2) SEQ ID NO.8

(A) length: 28 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO.8TTGGGGATCC TCAAGACGAG GTGGTCCC 28

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people hPKI γ protein-active,

Show at least 70% homology from the nucleotides sequence of 28-258 in Nucleotide among described nucleotide sequence and the SEQ ID NO.3; Perhaps

Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of 28-258 in Nucleotide.

2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from 28-258 in Nucleotide.

4. isolating people hPKI γ protein polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people hPKI γ protein-active, it is characterized in that this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people hPKI γ protein-active operationally is connected in expression regulation sequence, form people hPKI γ protein expression vector, show at least 70% homology from the nucleotides sequence of 28-258 in Nucleotide among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people hPKI γ;

(c) under the condition that is fit to expressing human hPKI γ protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people hPKI γ protein-active.

9. energy and the described people hPKI of claim 4 γ protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it contains 8-100 continuous nucleotides in the described dna molecular of claim 1.

Images