CN1290747A - New human metal thioalbumen and its coding sequence - Google Patents

Abstract

The present invention provides the cDNA sequence of a new human Metallothionein-L(MTL) and the cDNA encoded protein MTL is one isomer of Metallothionein. The present invention also relates to polypeptide encoded by the nucleotide sequence, the application of these polynucleotides and polypeptides and the production process of the said polynucleotides and polypeptides.

Description

A kind of new human metal thioalbumen and encoding sequence thereof

The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of new human gene nucleotide sequence.More particularly, the present invention relates to the cDNA sequence of human metal thioalbumen L (Metallothionein-L abbreviates " MTL " as), this cDNA encoded protein is one of isomer of MT.The invention still further relates to by this nucleotide sequence coded polypeptide the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and described polypeptide.

Metallothionein(MT) (MT) be one low-molecular-weight, with heavy metal bonded protein family, each MT contains two metal sulphur bunch, can combine its cysteine content height with 7 to 12 heavy metal atoms, and do not contain die aromatischen Aminosaeuren, molecular weight is generally less than 10kDa.MT extensively is present in the animal and plant, and discovery is also arranged in prokaryotic organism.In Mammals, the cysteine residues of MT is extremely conservative, combines with heavy metal atoms such as zinc, copper, calcium, chromium by the mercaptan key.In the people, have 10 to 12 genes encoding MT at least, these genes are divided into two classes: (criteria for classification is the wash-out position of albumen on the DEAE-Mierocrystalline cellulose according to genes encoding for MT-I and MT-II, to the similar no positive connection on structure or the function), MT-I and MT-II are expressed in the great majority tissue.Found MT-III, MT-IV afterwards again, only in brain and multiple layer squamous epidermis, express respectively (Masters.B.A.et al Proc.Natl.Acad.Sci.USA.1994,91:584-588).MT has very strong inducibility, can be induced synthetic (Zhou Jiehao etc., 1995. physiological sciences progress 26:29-34) by metal, glucocorticosteroid, some poisonous substance, cytokine and stressors

MT can separate noxious metals; in growth course, regulate the homeostasis of zinc and copper; participate in metal metabolism and detoxifcation; MT is also having effect aspect the elimination free radical; in door gram syndrome (Menkes disease), mouse graniphyric phenotype, hepatolenticular degeneration (Wilson ' s disease), MT may protect body to avoid copper and poison.MT and some antineoplastic chemotherapy medicine, particularly Cis-Diaminedichloroplatinum (cDDP) interact in addition, can alleviate its cytotoxicity.

Clone's work of MT is carried out smoothly, just has the isomer of a plurality of MT genes to be cloned in the people.Nineteen eighty-two, people such as Karin at first are cloned into the cDNA sequence (Karin, M.et al.1982, Nucl.Acid Res.10:3165-3173) of MT.People MT-IIA (Karin, M.et al. 1982.Nature 299:797-802), MT-IA (Richards, R.I.et al.1984.Cell 37:263-272), MT-IE, MT-IF (Schmidt, C.J.etal.1985 J.Biol.Chem.260:3672-3675) genome sequence is separating clone successively also, and some pseudogene clone work (ψ MT-IIB, ψ MT-IC, ψ MT-ID, ψ MT-IG, ψ MT-I, φ MT-IH) of somebody also are in the news.The clone of MT cDNA in other species (mouse MT-I, rat MT-I, monkey MT-I and MT-II, Chinese hamster MT-I and MT-II, sheep MT-I) and genomic dna (mouse MT-I and MT-II) also make good progress (see ref.Hamer, D.H.1986.Ann.Rev.Biochem.55:914-951).

Yet before the application, also there is not to separate and disclosed MTL of the present invention.

An object of the present invention is to provide a kind of new polynucleotide, these polynucleotide are named as human metal thioalbumen L (human Metallothionein-L abbreviates " people MTL " or " hMTL " as).

Another object of the present invention provides a kind of new people MTL albumen.

A further object of the present invention provides a kind of method of utilizing recombinant technology to produce described new people's MTL polypeptide.

The present invention also provides this people's the MTL nucleotide sequence and the application of polypeptide.

In one aspect of the invention, a kind of isolated dna molecular is provided, it comprises: coding has the nucleotide sequence of the polypeptide of people MTL protein-active, shows at least 70% homology from the nucleotides sequence of Nucleotide 35-220 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 35-220 position.Preferably, described sequence encoding one polypeptide, this polypeptide has the sequence shown in the SEQ ID NO.4.More preferably, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 35-220 position.

In another aspect of this invention, provide a kind of isolating people MTL protein polypeptide, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

In another aspect of this invention, provide a kind of carrier, it contains above-mentioned isolated DNA.

In another aspect of this invention, provide a kind of described carrier transformed host cells.

In another aspect of this invention, provide a kind of generation to have the method for the polypeptide of people MTL protein-active, this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people MTL protein-active operationally is connected in expression regulation sequence, form people MTL protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 35-220 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people MTL;

(c) under the condition that is fit to expressing human MTL protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people MTL protein-active.

In a specific embodiments of the present invention, isolating polynucleotide total length of the present invention is 247 Nucleotide, and its detailed sequence is seen SEQ ID NO.3, and wherein open reading frame is positioned at 35-220 position Nucleotide.

In the present invention, " isolating ", " purifying " or " pure substantially " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, term " people MTL albumen (or polypeptide) encoding sequence " refer to the encode nucleotide sequence of polypeptide with people MTL protein-active is as 35-220 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.3.This degenerate sequence is meant, is arranged in the encoder block 35-220 position Nucleotide of SEQ ID NO.3 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.3 in 35-220 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.4 of also encoding out.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with among the SEQ ID NO.3 from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 35-220 position.Also term also comprise with SEQ ID NO.3 in from the homology of nucleotide sequence at least 70% of Nucleotide 35-220 position, preferably at least 80%, at least 90% nucleotide sequence more preferably.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.4 sequence of people MTL identical function.These variant forms comprise (but being not limited to): several (are generally 1-60, preferably 1-30, more preferably 1-15,1-6 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 30 to hold interpolation 5 ' and/or 3 ', preferably being in 15, more preferably is in 9, is in 5 best) Nucleotide.

In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.Substantially pure polypeptide is substantially free of the component of following it under the native state.

In the present invention, term " people MTL protein polypeptide " refers to have the SEQ ID NO.4 polypeptide of sequence of people MTL protein-active.This term also comprises having and variant form people MTL identical function, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-15, preferably 1-10, more preferably 1-5,1-3 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 15, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people MTL and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people MTL DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people MTL polypeptide to obtain.The present invention also provides other polypeptide, as comprises people MTL polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people MTL polypeptide.Usually, this fragment have people MTL peptide sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 40 continuous amino acids, more preferably at least about 50 continuous amino acids, best at least about 60 continuous amino acids.

Invention also provides the analogue of people MTL albumen or polypeptide.The difference of these analogues and natural human MTL polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " people MTL conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID No.4, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
Ala（A）	Val；Leu；Ile	Val
Arg（R）	Lys；Gln；Asn	Lys
Asn（N）	Gln；His；Lys；Arg	Gln
Asp（D）	Glu	Glu
Cys（C）	Ser	Ser

The present invention also comprises people MTL polypeptid coding sequence and segmental antisense sequences thereof.This antisense sequences can be used for suppressing the expression of people MTL in the cell.

The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of people MTL polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding people MTL.

The present invention also comprises the method that detects people MTL nucleotide sequence, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to the encoding sequence of people MTL polypeptide, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In the present invention, can select various carrier known in the art for use, as commercially available carrier.Such as, select commercially available carrier for use, the nucleotide sequence with code book invention polypeptide operationally is connected in expression regulation sequence then, can form protein expression vector.

As used herein, " operationally being connected in " refers to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is an eukaryotic cell, as Chinese hamster ovary celI, COS cell etc.

On the other hand, the present invention also comprises people MTL DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people MTL gene product or fragment.Preferably, refer to that those can combine with people MTL gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people MTL, comprise that also those do not influence the antibody of people MTL protein function.The present invention also comprise those can with modify or without the people MTL gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people MTL gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human MTL or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can be utilized hybridoma technology to prepare (to see people such as Kohler, Nature256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people MTL function and the antibody that does not influence people MTL function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people MTL gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people MTL gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

People MTL Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally with its human cloning carrier, changes cell over to again, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

In one embodiment of the invention, the cDNA nucleotide sequence of people MTL is so to obtain, with people liver λ gtllcDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-TCGCTTGAGATCTCCAGCCTTAC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-ACATCTGGGAGAAGAGCTGTTGC-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 60 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The PCR segment that electrophoresis detection obtains is about the purpose fragment (SEQ ID NO:3) of 250bp.

MT can separate noxious metals; in growth course, regulate the homeostasis of zinc and copper; participate in metal metabolism and detoxifcation; MT is also having effect aspect the elimination free radical; in door gram syndrome (Menkes disease), mouse graniphyric phenotype, hepatolenticular degeneration (Wilson ' s disease), MT may protect body to avoid copper and poison.MT and some antineoplastic chemotherapy medicine, particularly Cis-Diaminedichloroplatinum (cDDP) interact in addition, can alleviate its cytotoxicity.

Discovery of the present invention and isolated this new human metal thioalbumen are the useful tools of research metallothionein(MT).In addition, because people MTL of the present invention has the natural acid sequence that is derived from the people, therefore, compare, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour with the albumen of the same clan that comes from other species.

In the accompanying drawings, Fig. 1 is totally 4 kinds of proteic amino acid sequence homologous comparison diagrams of people MTL of the present invention and people MT-1B (sp|P07438), people MT-1E (sp|P04732), people MT-1I metallized metal sulfoproteins such as (sp|P80295).Wherein, identical amino acid marks with " * " below sequence, and similar amino acid marks with " ".

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The clone and the mensuration of the cDNA sequence of people MTL

1. primer amplification

With people liver λ gtllcDNA library (available from Clontech company) is template, with a pair of oligonucleotide is primer--A:5 '-TCGCTTGAGATCTCCAGCCTTAC-3 ' (SEQ ID NO.1) is a forward primer, oligonucleotide B:5 '-ACATCTGGGA GAAGAGCTGTTGC-3 ' (SEQ ID NO.2) is a reverse primer, carries out PCR.The PCR condition be 93 ℃ 4 minutes, carried out 35 circulations in 1 minute with 93 ℃ 1 minute, 60 ℃ 1 minute and 72 ℃ thereupon, last 72 ℃ were extended 5 minutes.The length that electrophoresis detection obtains is about PCR purpose Segment A/B of 250bp.

2.PCR the order-checking of product

Above-mentioned pcr amplification product A/B is connected with pGEM-T carrier (Promega), transformed into escherichia coli JM103, extract plasmid with QIAprep Plasmid test kit (QIAGEN), check order to inserting fragment with SequiThermEXCEL TMDNA sequencing kit (Epicentre Technologies), with computer software splicing order, obtain full length cDNA sequence at last, altogether 247bp, detailed sequence is seen SEQ ID NO:3, and wherein open reading frame is positioned at 35-220 position Nucleotide.

Derive the aminoacid sequence of people MTL according to the full length cDNA sequence that obtains, totally 61 amino-acid residues, its aminoacid sequence sees SEQ ID NO:4 for details.

Embodiment 2

Homology relatively

Full length cDNA sequence and proteins encoded thereof with people MTL of the present invention, in Non-redundantGenBank+EMBL+DDBJ+PDB database and Non-redundant GenBank CDStranslations+PDB+SwissProt+Spupdate+PIR database, carry out nucleic acid and albumen homology retrieval with blast program.Found that, on nucleotide level, there are higher homology, identity to be respectively 93%, 91%, 89%, 90% with MT (emb|V01533), people MT-IR (emb|X97261), people MT (emb|X64177), the people MT-IL (ref|NM_002450.1|) etc. of mouse respectively.Homologous protein is more also supported the correct of this sequence, and the identity of MTL derivation albumen and people MT-1B (sp|P07438), people MT-1E (sp|P04732), people MT-1I metallized metal sulfoproteins such as (sp|P80295) is respectively 86%, 86%, 85% (four homologies are relatively seen Fig. 1) on amino acid levels.

The proteic feature of mammiferous MT has: be made up of 60-68 amino-acid residue, wherein halfcystine accounts for 23-33%, there are 20 approximately, molecular weight is less than 10kDa, and contain one section consistent order C-x-C-[GSTP that forms by 19 residues at aminoterminal]-(wherein C is a halfcystine to x (2)-C-x-C00-x (2)-C-x-C-x (2)-C-x-K, x is an arbitrary amino acid, and numeral amino acid number, [GSTP] are represented any one in these four amino acid).This clearly demarcated MTL meets above feature: be made up of 61 amino-acid residues, wherein halfcystine is 20, accounts for 33%, and molecular weight is about 6kDa, and is positioned at the sequence of 13-31 position ₁₃CACTGSCKCKECKCTSCKK ₃₁Meet consistent order.Therefore, this shows another isomer that people MTL of the present invention is MT.

According to the structures shape function, the Biological Principles that the structural similitude function is relevant can be inferred the biological function of MTL of the present invention according to the function of MT gene in the known different plant species and proteins encoded thereof.

Existing research all shows, metallothionein(MT) has important in effects such as detoxifcations, and also has close dependency with some disease.For example, studies show that MT is relevant with the metal metabolism.Experiment in early days shows that MT has detoxification to heavy metal: induce MT to synthesize to Zn in advance to animal and can produce the Cytotoxic opposing to Cd, the Mammals of the active ability of forfeiture MT and the tissue of shortage MT are extremely sensitive to Cd toxicity.But the Cd-MT that discovers afterwards has cytotoxicity, in the blood plasma Cd-MT to the Gestation period parent blood vessel endotheliocyte damaging action is arranged, cause that symptoms such as endothelial cell inflammation, proteinuria, vasospasm, oedema produce, someone thinks that Cd-MT may be the major cause (Chisolm of hypertensive state of pregnancy in the blood plasma, J.C.et a1.3rdInternational Meeting on Metallothionein (Abstract) Dec8-11,1992.94).

The MenkeShi disease is the chain pediatric disease of a kind of X-, it is characterized in that copper distribution imbalance in the body, and copper and some copper dependent enzyme levels descend, and Cu-MT accumulates in the excessive tissue except that liver.The mutant of mouse graniphyric phenotype (the sick animal model of a kind of good MenkesShi) is consistent with some features of MenkesShi patient.The WilsonShi disease is also having obstacle aspect the copper metabolism, and congenital copper is congenital excessive savings in liver and brain.These three kinds of pathologies are all passed through the gene regulating of copper metabolic effect MT, otherwise their treatment mechanism may be undertaken by MT.In recent years the WilsonShi disease is mended the Zn treatment, obtained curative effect preferably.Induce the interior MT level of intestinal mucosa cells to increase after the oral Zn salt of patient, because MT and Cu binding ability are better than and Zn bonded ability, therefore Cu-MT can be shed to enteric cavity and discharged by ight soil with mucous membrane, plasma C u concentration lowers, thereby reach effect (Gurkan., V.Y.et al.1992.J.Lab.Clin.Med.120:380-386) to Zn salt decorporation Cu.

MT can eliminate free radical.1985, the Vasak isolated experiment showed, MT can eliminate because the OH free radical that radiation forms, and with GSH effect after, MT obtains regenerate (Thonally, P.et al.1985.Bioch.Biophys.Acta.827:36-44).The GSH of the MT of 13 μ mol/L and 10 μ mol/L avoids equally authentic aspect the á OH damage at the protection bovine chest gland DNA.Chinese hamster V79 cell to the Cd tolerance contains more MT, compares with control group, to H ₂O ₂, O ₂ ^-The tolerance that causes improve greatly (Temopleton, D.M.et al 1991.Riordan JF and Vallee BL ed.Methods of Enzymology.Vol.205,11-24).Effect about the MT Green Tea Extract in clinical medicine also has research, Mulder etc. find that oxyradical is relevant with the tissue injury of inflammatory bowel, find by the MT concentration of measuring among the patient, the concentration of MT is: cellular control unit endochylema＞inflammatory bowel non-inflammatory cell cytosol＞inflammatory bowel inflammatory cell endochylema, this discovery has the part cause of disease that helps illustrate inflammatory bowel, be that the enteric epithelium damage may be that the material of eliminating free radical is reduced, and cause oxyradical to produce the weighing apparatus (Mulder, T.P.J.et al.1991.Gut.32:1146-1150) that disappears.

MT and cDDP effect can alleviate the cDDP cytotoxicity.Cis-Diaminedichloroplatinum (cDDP) is a kind of chemotherapeutic commonly used, but because its damage to nephridial tissue, application is very limited.1985, Imura etc. caused the renal toxicity of cDDP to alleviate in advance mouse subcutaneous injection Bismuth trinitrate (BSN).Saijo etc. discover that further BSN can specially induce normal renal tissue to synthesize MT, and do not induce MT to produce to kidney and healthy tissues; Find that also cDDP gives the animal kidney damage of Bi salt little to pre-, and the effect of cDDP killing tumor cells does not subtract.Its mechanism may induce MT synthetic in nephridial tissue with Bi salt, and in tumor tissues, do not induce MT synthetic relevant (Saijo, N.et al Mrtallothionein 111, Basel:Birkhauser Verlag, 1993.279-292).

On the other hand, there are some researches show that MT is relevant with the tumour resistance.Several anti-cDDP clones are carried out the MT content analysis, and the interior MT content of tumor cell line born of the same parents of finding four kinds of anti-cDDP is than the high 2-4 of corresponding maternal side times; Personnel selection MT-II A dna fragmentation is that probe carries out nucleic acid hybridization, finds that MT mRNA content in the cell strain of anti-cDDP is than maternal high several times even tens times; People MT-II A dna fragmentation is changed in the original mouse cell to the cDDP sensitivity, find that this clone has improved 44 times to the resistance of cDDP, MT content has also improved 10 times (Kellley, S.L.et al.1988.Science 241:1813-1815) in the born of the same parents.

Be rich in MT in the liver, MT and hepatic diseases have certain relation.Measure liver problem sufferer liver MT content by radioimmunology analysis, the liver MT content of finding the chronic hepatitis patient is than normal people height, and patient with liver cirrhosis liver MT content is lower than the normal people, in the animal liver hardening model, induce synthesizing of liver MT with Zn, can obviously suppress liver tissue fibrosis, this shows that liver MT content descends may be relevant with the patient with liver cirrhosis tissue fibrosis (see ref. week outstanding sky etc., 1995. physiological sciences make progress 26:29-34).People such as Mulder observe the relation of primary biliary cirrhosis and MT, find that primary biliary cirrhosis patient blood plasma MT concentration increases the weight of with the state of an illness and rises, thereby the MT level can be used as a monitor control index (Mulder, T.P.J.et al.1991.Hepatology 14:1008-1012) of primary biliary cirrhosis PD.

People MTL of the present invention is used for further functional study except can be used as this family's a member, also can be used for producing fusion rotein with other albumen, such as producing fusion rotein with immunoglobulin (Ig).In addition, inventor MTL can also merge with other members of this family or exchange fragment, to produce new albumen.For example the N end of inventor MTL and the N end of mouse MT-II are exchanged, to produce the albumen that new activity is higher or have new features.

At the antibody of inventor MTL, be used to screen other members of this family, perhaps be used for affinity purification associated protein (as other members of this family).

In addition, inventor MTL nucleic acid (encoding sequence or antisense sequences) can be introduced into cell, with expression level that improves people MTL or the overexpression that suppresses people MTL.People MTL albumen of the present invention or its active polypeptide fragment can be applied to patient, with treatment or alleviate because of people MTL disappearance, no function or unusual cause related disorders arranged.In addition, can also be with carrying out relevant diagnosis or prognosis judgement based on nucleotide sequence of the present invention or antibody.

Embodiment 3

The expression of people MTL in intestinal bacteria

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people MTL use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.5 and 6) of 3 ' end increase, obtain people MTL cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5-CAAGGTCGACATGGACCCCAACTGCTCCT-3 ' (SEQ ID NO.5), this primer contains the restriction enzyme site of Sal I restriction enzyme, is 19 Nucleotide of the people MTL encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5 '-TAGGAAGCTTTCAGGCACAGCAGCTGCAG-3 ' (SEQ ID NO.6), this primer contains the part encoding sequence of restriction enzyme site, translation termination and the people MTL of Hind III restriction enzyme.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, the CA) restriction enzyme digestion sites on, this plasmid vector coding antibiotics resistance (Amp ^r), a bacterium replication orgin (ori), an adjustable promotor/operon of IPTG-(P/O), a ribosome bind site (RBS), a 6-histidine mark thing (6-His) and restriction enzyme cloning site.

With Sal I and Hind III digestion pQE-9 carrier and insertion fragment, will insert fragment subsequently and be connected to the pQE-9 carrier and keep open reading frame initial at bacterium RBS.Transform available from Qiagen with connecting mixture subsequently, the E.coli bacterial strain of commodity M15/rep4 by name, M15/rep4 contains the plasmid pREP4 of multiple copied, and it is expressed lac I repressor and carries kalamycin resistance (Kan ^r).Screen transformant containing on the LB culture dish of Amp and Kan, the cDNA fragment of extracting plasmid sequence verification people MTL has correctly been inserted carrier.

Incubated overnight (O/N) contains the positive transformant clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml) and Kan (25 μ g/ml).Spend the night (O/N) culture with 1: 100-1: 250 thinning ratio dilution, be inoculated into then in the large volume substratum, culturing cell grows to 600 optical density(OD) (OD ₆₀₀) when being 0.4-0.6, add IPTG (" isopropylthio-") to final concentration be 1mM.By making lac I repressor inactivation, IPTG induces startup P/O to cause gene expression dose to improve.Continued culturing cell 3-4 hour, centrifugal subsequently (6000 * g, 20 minutes).The ultrasonic degradation inclusion body, collecting cell also is dissolved in cell precipitation in the Guanidinium hydrochloride of 6M.After the clarification, by containing under the condition that 6-His marker albumen combines closely making, with nickel-chelate column chromatography purifying dissolved people MTL from solution.With 6M Guanidinium hydrochloride (pH5.0) wash-out people MTL from post.Available several method is the sex change protein precipitation from Guanidinium hydrochloride.Perhaps, use the dialysis step to remove Guanidinium hydrochloride, perhaps isolated purifying protein from nickel-chelate column.Protein behind the purifying is incorporated in second post, has the linear Guanidinium hydrochloride gradient of successively decreasing in this post.Protein denaturation when being attached to this post is used Guanidinium hydrochloride (pH5.0) wash-out subsequently.At last, soluble protein is dialysed with PBS, then protein is kept in the stock solution that final concentration is 10% (w/v) glycerine.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 6kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 4

The expression of people MTL in eukaryotic cell (Chinese hamster ovary celI strain)

In this embodiment, with pcr amplification product A/B among the embodiment 1 is template, with the cDNA sequence of coding people MTL use corresponding to 5 of this dna sequence dna ' and the PCR Oligonucleolide primers (SEQ ID NO.7 and 8) of 3 ' end increase, obtain people MTL cDNA as inserting fragment.

5 ' Oligonucleolide primers sequence of using in the PCR reaction is:

5 '-this primer of CAAGAAGCTTATGGACCCCAACTGCTCCT-3 ' (SEQ ID NO.7) contains the restriction enzyme site of Hind III restriction enzyme, is 19 Nucleotide of the people MTL encoding sequence that begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

This primer of 5 '-TAGGGGATCCTCAGGCACAGCAGCTGCAG-3 ' (SEQ ID NO.8) contains the part encoding sequence of the restriction enzyme site of BamH I restriction enzyme, translation termination and people MTL.

The restriction enzyme site of the restriction enzyme on the primer is corresponding to the restriction enzyme digestion sites on the expressing cho cell carrier pcDNA3, this plasmid vector coding antibiotics resistance (Amp ^rAnd Neo ^r), a phage replication starting point (fl ori), a virus replication starting point (SV40 ori), T7 promotor, a viral promotors (P-CMV), a Sp6 promotor, a SV40 promotor, a SV40 tailing signal and corresponding polyA order, a BGH tailing signal and a corresponding polyA order.

With Hind III and BamH I digestion pcDNA3 carrier and insertion fragment, will insert fragment subsequently and be connected to the pcDNA3 carrier.Subsequently with connecting mixture Transformed E .coli DH5 α bacterial strain.Screen transformant containing on the LB culture dish of Amp, incubated overnight (O/N) contains the clone of required construction in the LB liquid nutrient medium of adding Amp (100 μ g/ml).The cDNA fragment of extracting plasmid sequence verification people MTL has correctly been inserted carrier.

The plasmid transfection Chinese hamster ovary celI is to adopt lipofection, carries out with Lipofectin (GiBco Life).After the transfection 48 hours, through the lasting G418 pressurization screening in 2-3 week, collecting cell and cell conditioned medium are measured the expressing protein enzyme activity.Remove G418, continuous passage is cultivated; To mixing the clone cell Method of Limited Dilution, select to have the cell subclone of higher protein-active.The above-mentioned positive subclone of a large amount of according to a conventional method cultivations.After 48 hours, beginning collecting cell and supernatant are with ultrasonic degradation method smudge cells.With 50mMTrisHCl (pH7.6) solution that contains 0.05%Triton is balance liquid and elutriant, uses through the Superdex of pre-equilibration G-75 post and collects above-mentioned proteic active peak.Using 50mM TrisHCl (pH8.0) equilibrated DEAE-Sepharose post again, is that elutriant carries out gradient elution with 50mM TrisHCl (pH8.0) solution that contains 0-1M NaCl, collects above-mentioned proteic active peak.Be that dialyzate is dialysed to expressing protein solution with PBS (pH7.4) then.Last freeze-drying is preserved.

SDS-PAGE glue with 12% carries out electrophoresis, identifies that the molecular weight size of expressing protein is 6kDa.

In addition, the amino acid that reaches proteic N end and each 10 amino acid length of C end is checked order, find consistent with the sequence of SEQ ID NO.4 with ordinary method.

Embodiment 5

Preparation antibody

The recombinant protein that obtains in embodiment 3 and 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people MTL gene translation product with it.Found that antibody can precipitate with albumen of the present invention specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

( 1 ) ： ( ⅰ ) ： ( ⅱ ) ： ( ⅲ ) ：8 ( 2 ) SEQ ID NO．1 ( ⅰ ) ( A ) ：23 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．1：TCGCTTGAGA TCTCCAGCCT TAC 23 ( 2 ) SEQ ID NO．2 ( ⅰ ) ( A ) ：23 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO：2：ACATCTGGGA GAAGAGCTGT TGC 23 ( 2 ) SEQ ID NO．3： ( ⅰ ) ： ( A ) ：247bp ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ：cDNA ( ⅲ ) ：SEQ ID NO．3TCGCTTGAGA TCTCCAGCCT TACCGCGGCT CGAAATGGAC CCCAACTGCT CCTGCACCAC 60TGGTGTCTCC TGCGCCTGCA CCGGCTCCTG CAAGTGCAAA GAGTGCAAAT GCACCTCCTG 120CAAGAAGAGC TGCTGCTCCT GCTGCCCCGT GGGCTGTGCC AAGTGTGCCC ACGGCTGTGT 180CTGCAAAGGG ACGTTGGAGA ACTGCAGCTG CTGTGCCTGA TGTGGGAACA GCTCTTCTCC 240CAGATGT 247 ( 2 ) SEQ ID NO．4： ( ⅰ ) ： ( A ) ：61 ( B ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．4：Met Asp Pro Asn Cys Ser Cys Thr Thr Gly Val Ser Cys Ala Cys 15Thr Gly Ser Cys Lys Cys Lys Glu Cys Lys Cys Thr Ser Cys Lys 30Lys Ser Cys Cys Ser Cys Cys Pro Val Gly Cys Ala Lys Cys Ala 45His Gly Cys Val Cys Lys Gly Thr Leu Glu Asn Cys Ser Cys Cys 60Ala 61 ( 2 ) SEQ ID NO．5 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．5：CAAGGTCGAC ATGGACCCCA ACTGCTCCT 29 ( 2 ) SEQ ID NO．6 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．6：TAGGAAGCTTTCAGGCACAGCAGCTGCAG 29 ( 2 ) SEQ ID NO．7 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．7：CAAGAAGCTTATGGACCCCAACTGCTCCT 29 ( 2 ) SEQ ID NO．8 ( ⅰ ) ( A ) ：29 ( B ) ： ( C ) ： ( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO．8：TAGGGGATCCTCAGGCACAGCAGCTGCAG 29

Claims (10)

1. isolated dna molecular is characterized in that it comprises: coding has the nucleotide sequence of the polypeptide of people MTL protein-active,

Show at least 70% homology from the nucleotides sequence of Nucleotide 35-220 position among described nucleotide sequence and the SEQ ID NO.3; Perhaps

Described nucleotide sequence can be under the moderate stringent condition with SEQ ID NO.3 in from the nucleotide sequence hybridization of Nucleotide 35-220 position.

2. dna molecular as claimed in claim 1 is characterized in that, described sequence encoding one polypeptide, and this polypeptide has the sequence shown in the SEQ ID NO.4.

3. dna molecular as claimed in claim 1 is characterized in that, this sequence has among the SEQ ID NO.3 nucleotide sequence from Nucleotide 35-220 position.

4. isolating people MTL protein polypeptide is characterized in that it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.4 aminoacid sequence, or its reactive derivative.

5. polypeptide as claimed in claim 4 is characterized in that, this polypeptide is to have SEQ ID NO.4 polypeptide of sequence.

6. a carrier is characterized in that, it contains the described DNA of claim 1.

7. one kind with the described carrier transformed host cells of claim 6.

8. a generation has the method for the polypeptide of people MTL protein-active, it is characterized in that this method comprises:

(a) nucleotide sequence that coding is had a polypeptide of people MTL protein-active operationally is connected in expression regulation sequence, form people MTL protein expression vector, show at least 70% homology from the nucleotides sequence of Nucleotide 35-220 position among described nucleotide sequence and the SEQ ID NO.3;

(b) change the expression vector in the step (a) over to host cell, form the proteic reconstitution cell of people MTL;

(c) under the condition that is fit to expressing human MTL protein polypeptide, the reconstitution cell in the culturing step (b);

(d) isolate polypeptide with people MTL protein-active.

9. energy and the described people MTL of claim 4 protein polypeptide specificity bonded antibody.

10. a probe molecule is characterized in that, it contains 8-100 continuous nucleotide in the described dna molecular of claim 1.