CN115725615B - Upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton - Google Patents

Abstract

The invention discloses a upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton, and belongs to the technical field of genetic engineering. The nucleotide sequence of the gene is shown as SEQ ID NO:7, the invention also discloses application of the upland cotton GhABC1K14-A09 gene in improving drought resistance and salt tolerance of plants. According to the invention, the VIGS technology is utilized to silence the target gene in cotton, after drought and salt stress treatment, the target gene is found to cause the reduction of antioxidant enzyme (CAT, POD and SOD) activity, the reduction of soluble sugar and chlorophyll content and the increase of MDA content, and the expression of adversity stress related genes such as GhSOS1, ghNHX1, ghCBL3 and the like is reduced, namely the silencing target gene causes the reduction of cotton resistance, so that the gene positively regulates and controls cotton to respond to drought and salt stress, and the gene provides important gene resources for high drought resistance and salt resistance breeding of upland cotton.

Description

Upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton.

Background

Cotton (Gossypium spp.) is one of the most important commercial crops in the world and is also an important source of natural fibers in the textile industry. Wherein upland cotton (Gossypium hirsutum L.) is used as one of the cultivars of cotton crops, and occupies 95% of the annual cotton yield worldwide, and has wide application prospect. Cotton planting and production is mainly performed in arid and semiarid regions, cotton exhibiting higher drought tolerance than rice, wheat and corn. However, moisture and salt-alkali limitations still have a significant impact on cotton fiber yield and lint quality, a major non-biological factor affecting cotton production worldwide. Although the main goal of cotton breeders has been to increase productivity and fiber quality for many years, changes in climatic factors and extreme weather frequency events, such as drought and salt and alkali, pose a significant threat to cotton production.

ABC1K (Activity of bc1 complex kinase) gene family belongs to atypical protein kinase family, and its members are commonly existed in prokaryotes and eukaryotes, and play an important role in plant growth and development and responding to adverse stress, however, the excavation and screening utilization of drought-resistant and salt-tolerant gene resources in cotton ABC1K family members are not seen so far.

Disclosure of Invention

The invention aims to provide a upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton, so as to solve the problems in the prior art, and the gene positively regulates and controls cotton to respond to drought and salt stress reaction, and can up-regulate expression in plants so as to improve drought resistance and salt tolerance of the cotton.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a upland cotton GhABC1K14-A09 gene, the nucleotide sequence of which is shown in SEQ ID NO: shown at 7.

The invention also provides a primer for amplifying the upland cotton GhABC1K14-A09 gene, and the nucleotide sequence of the primer is shown as SEQ ID NO: 1-2.

The invention also provides a recombinant vector comprising the upland cotton GhABC1K14-A09 gene.

The invention also provides a recombinant bacterium comprising the recombinant vector.

The invention also provides a method for amplifying the upland cotton GhABC1K14-A09 gene, which uses the cDNA of cotton as a template and uses the primer to carry out PCR amplification to obtain the upland cotton GhABC1K14-A09 gene.

The invention also provides an application of the upland cotton GhABC1K14-A09 gene or the primer or the recombinant vector or the recombinant strain in drought resistance and/or salt tolerance of plants.

Further, drought and/or salt tolerance of the plant is increased by up-regulating the GhABC1K14-A09 gene level of the upland cotton in the plant.

Further, the plant is a malvaceae cotton plant.

Further, the plant comprises upland cotton.

The invention discloses the following technical effects:

the invention analyzes the expression modes of the upland cotton ABC1K gene (GhABC 1K) family under four abiotic stresses of high temperature, low temperature, drought and salt, discovers that the GhABC1K family members can respond to drought and salt stress, and discovers that GhABC1K14-A09 is highly expressed in the drought and salt stress. In order to further determine the molecular mechanism of GhABC1K14-A09 gene response in drought and salt stress, the VIGS technology is utilized to silence the target genes in cotton plants, and after drought and salt stress treatment, 4 target genes are found to cause antioxidant enzyme (CAT, POD and SOD) activity, reduction of soluble sugar and chlorophyll content and increase of MDA content, and the expression of stress related genes GhSOS1, ghNHX1, ghCBL3, ghCIPK6, ghSOS2, ghHDT4D, ghEREB2A, ghDREB2C, ghWRKY and GhRD29A is reduced, so that the defect that the GhABC1K14-A09 gene leads to reduced cotton resistance is proved, and important gene resources are provided for cotton drought resistance and salt stress resistance breeding by forward regulation of the GhABC1K14-A09 gene.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a map of the vectors pGM-T and TRV 2;

FIG. 2 shows the results of PCR amplification of the target gene, PCR of the bacterial liquid of the target gene and silencing vector construct and double digestion; a, amplifying a target gene by PCR; b, amplifying a target gene VIGS fragment; c, performing bacterial liquid PCR on the target gene VIGS fragment and the silencing vector construct; d, double enzyme digestion of the target gene and silencing vector construct; 14 represents GhABC1K14-A09; v and M represent TRV2 vector and Marker (D2000), respectively;

FIG. 3 shows the TRV2 GhPDS positive control phenotype;

FIG. 4 shows the results of the detection of silencing efficiency of a gene of interest in a TRV2 GhABC1K14-A09 plant;

FIG. 5 is a phenotypic analysis of upland cotton plants under drought and salt stress;

FIG. 6 shows the results of MDA content detection of a target gene silencing plant;

FIG. 7 is a graph showing the level of antioxidant enzyme SOD, POD and CAT activity in gene-silenced plants of interest;

FIG. 8 is a graph showing the results of the detection of soluble sugar content in a gene-silenced plant of interest;

FIG. 9 shows the chlorophyll content measurement results of the target gene silencing plant;

FIG. 10 shows the expression of stress-related genes in a silent plant.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The inventor analyzes the expression mode of the upland cotton ABC1K gene (GhABC 1K) family under four abiotic stresses of high temperature, low temperature, drought and salt, and discovers that GhABC1K family members can respond to drought and salt stress and simultaneously discovers that GhABC1K14-A09 presents high expression in drought and salt stress. In order to further define the molecular mechanism of GhABC1K14-A09 gene in response to drought and salt stress, the GhABC1K14-A09 gene is cloned, and a VIGS silencing vector of the gene is constructed to study the biological functions under drought and salt stress. The experiment is as follows:

1. experimental materials and methods

1.1 Experimental materials

The experimental material used was cotton 113 in upland cotton variety, and seeds were provided by cotton institute of national academy of agricultural sciences.

1.2 vectors and competent cells

pGM-T cloning vectors (VT 302-02, TOP 10-containing E.coli competent cells) and GV3101 Agrobacterium competent cells were purchased from Tiangen Biotechnology Co., ltd and Shanghai Biotechnology Co., ltd, respectively, and the VIGS vector systems (TRV 1, TRV2 and TRV 2-GhPDS) for gene silencing were given by cotton institute of China academy of agricultural sciences, the vector maps are shown in FIG. 1.

1.3 Experimental methods

1.3.1 primer design

Cloning primers, qRT-PCR primers, and primers for construction of the VIGS silencing vector for GhABC1K14-A09 gene were designed using NCBI Primer-BLAST (https:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /), the Primer sequences (SEQ ID NOS: 1-6) are shown in Table 1:

TABLE 1 primer sequences

Primer name	Primer sequence (5 '. Fwdarw.3')	Purpose(s)
			GhABC1K14-A09-F	GAACTATCTTCCTCTCTCTCTCT	Gene cloning
GhABC1K14-A09-R	TCAACATCTGCTATACAAGC	Gene cloning
			GhABC1K14-A09-F	TCAACGTCGTCAAGTCAGGG	qRT-PCR
GhABC1K14-A09-R	CGTGCTAACACACGAGACGA	qRT-PCR
			GhABC1K14-A09-F	CGGAATTCAGCTTCGGTTGGTTGAGGTT	VIGS
GhABC1K14-A09-R	CCGCTCGAGCCATGGCTGACCAAGTTCCT	VIGS

Note that: the underlined fonts in the table represent restriction sites, wherein GAATTC and CTCGAG represent EcoRI and XhoI restriction sites.

1.3.2 Cotton planting, total RNA extraction, cDNA Synthesis and qRT-PCR

1.3.2.1 Cotton planting

a. An equal amount of nutrient soil (substrate: vermiculite=1:1) was placed in each pot and immersed in a large pot containing tap water until water was absorbed onto the pot surface for cotton seed germination;

b. planting the seeds of the middle cotton 113 in the flowerpot, and culturing in a climatic incubator (16 h illumination, 8h darkness, temperature 28 ℃ and humidity 70%) to ensure that the emergence of the seeds is consistent, wherein the planting depth of the seeds is kept at 1.5 cm;

c. when cotton grows to the four-leaf stage, tender leaves are selected for sampling, and the sampled samples are quickly frozen in liquid nitrogen and then stored at the temperature of minus 80 ℃ for standby.

1.3.2.2 extraction of Total RNA from Cotton

Extraction was performed according to the RNAprep pure polysaccharide polyphenol plant total RNA extraction kit (cat. No. DP441, purchased from Tiangen Biochemical technologies Co., ltd.).

1.3.2.3 Cotton RNA reverse transcription (Synthesis of first Strand of cDNA)

Reverse transcription of the total RNA extracted above is performed according to the following steps:

a. thawing RNA taken from-80℃on ice; 5 XFastKing-RT Supermix reagent and RNase-free ddH removed from-20deg.C ₂ O was melted at room temperature and then quickly placed on ice and gently mixed before use.

b. The reaction system (table 2) was formulated according to the following table:

composition of components	Usage amount (mu L)
		5×FastKing-RT SuperMix	4
Total RNA	2
		RNase-free ddH 2 O	Make up to 20 mu L

c. The reverse transcription reaction (table 3) was performed according to the following reaction procedure:

reaction temperature (. Degree. C.)	Reaction time (min)
		42	15
95	3

d. After the reaction, the concentration and purity of cDNA were measured and stored at-20℃until use.

1.4 construction of Gene amplification and silencing vectors

1.4.1 PCR amplification of target Gene

Using the medium cotton 113cDNA as a template, ghABC1K14-A09 gene was amplified using a 2 XPro Taq premix (containing dye) kit (cat No. AG11109, available from Ai Kerui), and the system was as follows (Table 4):

after completion of the operation, the reaction was carried out by the following procedure (Table 5) after a short centrifugation after shaking and mixing:

amplifying the full length of GhABC1K14-A09 gene from upland cotton by adopting a PCR method, wherein the nucleotide sequence of the gene is shown as SEQ ID NO:7, as follows:

the nucleotide sequence of GhABC1K14-A09 is shown in SEQ ID NO:7, as follows:

>14-A09

ATGGACGCAGCAGCGCCGCCGTGGCTCGTCTACTGCGGTGTCGATCCCGTCCGTTTCTCTTCCCCGCGCTCTAACAGAGTATCTATTCGTACTCGAACCAGACCGGTTCTCGCTGTAGCAACCGACCCTAAACCTACTCGTAAGACTCCGTCTCAGTCCTCTCCTTCAAACAACAACGTCAACGGCTCCTCCAAGTCCTCCTTATCTAAAAAGTCCGTGAACGGAGTTCCTACGAGGATGGGAGACGTTTCACAGGAAATAAAAAGAGTGAGAGCACAAATGGAAGAAAATGAAGATTTGGCTATACTAATGAGAGGACTTCGTGGCCAAAATTTACGGGATTCACAGTTTGCTGATGACAATATTCAGCTTCGGTTGGTTGAGGTTGATGAAAGCAGTGAGTTCTTACCTTTGGCATATGATCCGGCTAGCATCTCAGCATACTGGGGGACACGGCCTCATGCTGTTGCAACTCGTATCATACAGTTACTATCTGTTGCTGGGGGTTTCCTCTCACGCTTGGCTATGGATGTGGTAAACAAGAAGGTCAAAGAGCATGAAGTGGCTAGAGCTATTGAATTAAGGGAAATTGTTACCTCTTTGGGCCCAGCGTATATAAAGCTTGGGCAAGCATTGAGCATTCGACCGGATATACTTTCTCCTGTTGCCATGATGGAGCTGCAAAAGCTTTGTGATAAGGTTCCTTCATTTCCAGATGACATAGCAATGGCTCTTATTGAAGAGGAACTTGGTCAGCCATGGCAAGAAATCTACTCTGAACTTTCCTCTTCGCCAATAGCTGCTGCATCTCTTGGACAAGTGTATAAAGGACGCTTGAAAGAGAATGGAGATCTGGTTGCTGTCAAAGTGCAGAGGCCTTTTGTTCTTGAGACAGTGACTGTTGATTTGTTCATCATAAGAAACTTGGGTTTGGTGCTCCGAAAGTTTCCTCAGATCTCCATAGATGTGGTTGGATTGGTTGATGAATGGGCTGCACGATTCTTTGAGGAGCTAGATTATATTAACGAGGGTGAAAATGGACAACTCTTTTCTGAAATGATGCGTAAGGACCTTCCACAGGTTGTTATACCAAGGACTTATCAGAAATACACATCAAGGAAGGTTCTTACTACAGAGTGGATCGAAGGAGAGAAGCTATCACAAAGTACAGAAAGTGATGTTGGTGAATTGGTCAATGTTGGAGTGATATGCTACCTAAAGCAGTTGCTTGATACCGGGTTTTTCCATGCTGACCCACATCCTGGGAATTTGATCCGTACTCCTGATGGAAAGCTAGCCATACTCGACTTTGGTCTCGTGACAAAATTAACTGATGACCAGAAGTATGGAATGATTGAAGCAATTGCTCATCTTATCCACCGGGACTATCCAGAAATAGTTAAGGATTTTGTTAAACTTGATTTCATTCCTGAGGGGGTTAATTTAGAGCCAATCTTGCCCGTTCTGGCAAAGGTTTTTGATCAAGCACTTGAGGGTGGGGGTGCAAAAAACATCAACTTTCAGGACCTGGCATCAGATTTGGCGCAGATAACATTTGATTATCCATTTAGGATACCTCCTTATTTTGCTCTTATAATTAGGGCAATTGGGGTGTTGGAAGGAATAGCTTTAGTGGGGAATCCTGATTTTGCTATCGTGGATGAGGCCTATCCTTATATTGCACAGAGACTGCTCACTGATGAATCCCCGCGGCTAAGGAATGCTTTGCGTTATACAATATACGGGAAATCAGGTGTTTTTGATGCTGAAAGATTCATTGATGTGATGCAAGCCTTTGAGAATTTCATAACTGCAGCAAAAAGTGGAGGTGGGGAGAATTTGAATGGGGATATGGCAGAACTAGGTCTTCTACAAAGGCAAGCAGATATTTCCTTCCCTAGATTTCTACCAAGTGAATCTCAATCAAAGCAACCTGTTCAAACAAGAGCGGCCTTAGGATTTCTACTGTCTGAGAAGGGAAATTTTTTCCGAGAATTTCTTCTTGATGAGATTGTGAAGGGCATTGATGCACTTAGCAGGGAACAGTTGGTTCAAATAATGTCAGTGTTGGGAGTAAGAAATGCTGCCCCAGTGTTTAGCTTGGTTCCAACAGTTGGACCCTTCAAACCAGCAGGACTTTTGCCTTCAATAACCGAGGAAGACAGAGTTATACTGAATAATGTCCAAAAAATTCTCGAATTCTTAACAGCGGGAAGTGCAATATCAACGTCGTCAAGTCAGGGTGTAAATGTTGCTCAGGTTATCCAGGAATTGCTTCCAGTGTTGCCAGGCATATCTGCCAGGGTTCTTCCTGAGTTGATTAGCCGGTTATCGTCTCGTGTGTTAGCACGTTTAATCCGGGATACATTTTTGTAA。

1.4.2 ligation of the Gene of interest to the cloning vector pGM-T

a. pGM-T vectors were removed from the-80℃refrigerator and thawed on ice.

b. The volume of the added target fragment (molar ratio of carrier to target fragment=1:5) was calculated and the following ingredients (whole procedure completed on ice) were added to a sterile 1.5mL centrifuge tube:

c. mix it gently, after a short centrifugation, connect overnight at 16 ℃.

1.4.3 transformation of TOP10 E.coli competent cells

The strain is transformed into TOP10 escherichia coli competent cells by a heat shock method, and bacterial liquid PCR verification and sequencing (completed by Shanghai Biotechnology Co., ltd.) are carried out by using a target gene sequence primer.

1.4.4 construction of silencing vectors

1.4.3 positive plasmid which is successfully sequenced is taken as a template, a silencing fragment is amplified by adding primers of restriction enzyme EcoR I and Xho I cleavage sites and a protective base, and a fragment of GhABC1K14-A09 is inserted into a TRV2 silencing vector by a double cleavage method, so that the TRV 2/GhABC 1K14-A09 silencing vector is constructed, wherein the specific cleavage system is as follows:

and (3) adding 10×loading Buffer to stop the reaction after 3 hours at 37 ℃, recovering the PCR product of the target gene fragment, recovering the large fragment by enzyme digestion of the vector, connecting the target fragment with the silencing vector, converting the connecting product into competent cells of escherichia coli for blue-white screening experiments, carrying out bacterial liquid PCR and double enzyme digestion identification, sequencing positive plasmids (Shanghai) after completion, and transferring the positive plasmids into the competent cells of agrobacterium GV 3101.

1.5VIGS silencing Gene of interest

VIGS silencing of cotton 113 seedlings was performed as follows:

a. planting middle cotton 113 seeds according to the method of 1.3.2.1, soaking the middle cotton 113 seeds until the seeds grow to the seventh day and the cotyledons are fully unfolded, stopping soaking until nutrient soil in the flowerpot absorbs water to the surface, and standing for later use.

b. Adding Kan to LB liquid Medium ⁺ And Rif standby, wherein Kan ⁺ And the final concentration of Rif was 50 μg/mL and 25 μg/mL, respectively. The VIGS vector system and the objective gene bacterial liquid taken out from-80 ℃ were thawed on ice, and activated at 28 ℃ and 200rpm for 12-16 hours (bacterial liquid: LB liquid medium=1:10). After activation, the propagation is carried out according to the same proportion。

c. After the bacterial liquid is propagated, centrifuging for 10min at 5000rpm, pouring out supernatant, retaining bacterial cells, suspending bacterial cells by using a wind-light photometer and using heavy suspension, and OD ₆₀₀ Between 0.8 and 1.0.

d. After resuspension was completed, the cells were left in the dark for 3 hours, and after resuscitating, TRV1 was mixed with 1:1 of a cell mass suspension containing TRV2 (as a blank control group), TRV2: ghPDS (as a positive control), and TRV2: ghABC1K14-A09 (as an experimental group), and the mixture was thoroughly mixed.

e. On the seventh day of cotton seedling growth, it was soaked in water according to the method of step a. VIGS injections were performed on cotton seedlings on the eighth day of growth, with specific manipulations: the back of the cotyledon is scratched by using a 1mL syringe needle (the wound is not easy to be oversized and the needle point is just as big as possible), the mixed bacterial liquid in the step d is injected into the cotton cotyledon, and the bacterial liquid fills the whole cotyledon as much as possible.

f. After injection, in order to achieve better infection effect, the seeds are wrapped by a plastic bag, and are cultivated under normal growth conditions after being placed in darkness at 25 ℃ for 24 hours.

g. And after the positive control cotton seedlings whiten, adopting the cotton young leaves of the experimental group and the blank group to carry out fluorescent quantitative experiments to detect the silencing efficiency.

1.5.1 drought and salt stress treatment of Gene-silenced cotton plants

After the injected positive cotton seedlings are whitened, blank control and experimental groups are respectively subjected to salt treatment and drought treatment by 200mmol/L NaCl and 15% PEG for carrying out phenotype observation on cotton seedlings grown to four weeks of age.

1.5.2 determination of the physiological index of the Gene-silenced cotton leaves

And detecting the antioxidant enzyme (SOD, POD and CAT) activity, MDA content, soluble sugar content and chlorophyll content of cotton leaves of the blank control group and the experimental group respectively according to a conventional method so as to analyze the response of the target gene silencing plant to drought and salt stress.

1.5.3 fluorescent quantification of stress-related genes in Gene silencing lines

Young leaves of the silent strain were picked, RNA was extracted by using RNAprep pure polysaccharide polyphenol plant total RNA extraction kit (cat No. DP441, purchased from the astronomical biotechnology company, ltd.) and reverse transcribed by using FastKing one-step method to remove genomic cDNA first strand synthesis premix kit (cat No. KR118, purchased from the astronomical technology company, ltd.) and finally expression levels of stress related genes such as GhSOS1, ghNHX1, ghCBL3, ghSOS2, ghCIPK6, ghHDT4D, ghDREB2C, ghDREB2A, ghWRKY, ghRD29A were detected by using SuperReal fluorescent quantitative premix reagent enhancer kit (cat No. FP205, purchased from the astronomical technology company, ltd.).

2 results and analysis

2.1 construction of the Gene fragment of interest and silencing vector

Gene full-length amplification was performed using the medium cotton 113cDNA as a template, and the primers as shown in Table 1, using 2 XPro Taq premix (Ai Kerui), and fragment sizes were detected by agarose gel electrophoresis and sequencing was performed to determine the sequence (FIG. 2 a). The positive plasmid detected correctly was used as a template, primers were shown in Table 1, the VIGS fragment was amplified using 2 XPoTaq premix (Ai Kerui), the fragment size was detected by agarose gel electrophoresis (FIG. 2 b), the target fragment of appropriate size was successfully ligated with pGM-T vector, the positive plasmid was ligated with TRV2 vector by double digestion, the positive plasmid was identified by bacterial liquid PCR (FIG. 2 c) and double digestion (FIG. 2 d), and sequencing was successful.

2.2 detection of silencing efficacy of the Gene of interest

Infection of the fully flattened cotyledon cotton seedlings with the TRV2: ghABC1K14-A09 silencing vector constructed in 2.1 was found to begin to whiten the positive control (TRV 2: ghPDS) plants on day 7 after infection, and whitening was evident on day 15 after VIGS silencing (FIG. 3), indicating successful construction of the VIGS silencing system. The silencing efficiency of the target gene is detected (shown in figure 4), compared with a control group, the expression of GhABC1K14-A09 in the TRV2 GhABC1K14-A09 plant is obviously inhibited, the silencing efficiency reaches 100 percent (36/36), and the expression quantity analysis of the VIGS silencing plant and the control plant shows that the target gene is silenced.

2.3 phenotypic analysis of Gene-silenced plants of interest by drought and salt stress

Four week old VIGS silenced lines were selected, including target gene silenced TRV2: ghabac 1K14-a09 and control TRV2:00 plants were subjected to drought and salt stress treatments. As a result, it was found (FIG. 5), after 12 days of treatment with 15% PEG and 200mmol/LNaCl, the cotyledons of the plants injected with TRV2:00 bacterial liquid and the desired gene silencing bacterial liquid were completely detached, that the true leaves were wilted and yellow, and that the TRV2:GhABC1K14-A09 silencing plants were severely dehydrated and the yellow and wilted were also more serious than the true leaves of the TRV2:00 plant lines, indicating that the GhABC1K14-A09 genes were involved in drought-resistance and salt-tolerance reactions of upland cotton.

2.4 Effect of drought and salt stress on MDA content of target Gene-silenced Cotton leaf

MDA content detection analysis is carried out on the GhABC1K14-A09 gene silencing plant and the empty vector plant after stress, and the MDA content of the GhABC1K14-A09 silencing plant under PEG and salt stress is obviously increased (figure 6), which indicates that the cotton resistance is reduced due to the silencing of the GhABC1K14-A09 gene.

2.5 Effect of drought and salt stress on the antioxidant enzyme Activity of Gene-silenced cotton leaves of interest

The antioxidant enzyme (SOD, POD and CAT) activities of the silenced plants were examined, and as shown in FIG. 7, ghABC1K14-A09 silenced plants showed a different decrease in CAT, SOD and POD activities after 10 days of drought and salt stress, as compared to TRV2:00 control plants.

2.6 Effect of drought and salt stress on soluble sugar content of Gene-silenced cotton leaves of interest

Silencing of the GhABC1K14-A09 gene resulted in a decrease in soluble sugar content compared to soluble sugar content in control TRV2:00 leaves, and was found to be more pronounced under salt stress than under PEG stress (FIG. 8), indicating that silencing the GhABC1K14-A09 gene increased cotton sensitivity to drought and salt stress, and was more responsive to salt stress.

2.7 Effect of drought and salt stress on the chlorophyll content of the Gene-silenced Cotton leaves of interest

When plants are subjected to high-intensity abiotic stress, plant leaves can be obviously yellowing and wilting. The detection of chlorophyll content is one of the important indexes for detecting plant stress tolerance. After stress, the chlorophyll content of cotton is detected, and the chlorophyll content of GhABC1K14-A09 gene silencing plant is found to be obviously lower than that of a control plant (figure 9), which shows that GhABC1K14-A09 gene silencing results in reduced drought tolerance and salt tolerance of cotton plants.

2.8 drought and salt stress vs. stress Gene expression in silent lines

The expression of GhSOS1, ghNHX1, ghCBL3, ghCIPK6, ghSOS2, ghHDT4D, ghEREB2A, ghDREB2C, ghWRKY and GhRD29A genes in TRV2: ghABC1K14-A09 plants was significantly reduced compared to TRV2:00 (FIG. 10), and silencing the GhABC1K14-A09 genes would affect the expression of the stress related genes.

Taken together, the reduced cotton resistance demonstrated by VIGS silencing of ghabac 1K14-a09 in upland cotton, which is more sensitive to drought and salt stress than controls, thus demonstrating that the above genes positively regulate cotton response to drought and salt stress responses.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (7)

1. The gene GhABC1K14-A09 of upland cotton is characterized in that the nucleotide sequence is shown in SEQ ID NO: shown at 7.

2. A primer for amplifying the gene GhABC1K14-A09 of upland cotton according to claim 1, wherein the nucleotide sequence is shown in SEQ ID NO: 1-2.

3. A recombinant vector comprising the gossypium hirsutum ghbc 1K14-a09 gene of claim 1.

4. A recombinant bacterium comprising the recombinant vector of claim 3.

5. A method for amplifying the upland cotton GhABC1K14-A09 gene according to claim 1, which is characterized in that cDNA of upland cotton is used as a template, and PCR amplification is carried out by using the primer according to claim 2, so as to obtain the upland cotton GhABC1K14-A09 gene.

6. Use of the upland cotton GhABC1K14-A09 gene according to claim 1 or the primer according to claim 2 or the recombinant vector according to claim 3 or the recombinant bacterium according to claim 4 in drought resistance and/or salt tolerance of upland cotton.

7. The use according to claim 6, wherein the upland cotton drought and/or salt tolerance is increased by up-regulating the upland cotton ghab 1K14-a09 gene level in upland cotton.

Images