CN117904178A

CN117904178A - Application of GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton

Info

Publication number: CN117904178A
Application number: CN202410113028.XA
Authority: CN
Inventors: 王彩香; 宿俊吉; 韦维; 彭佳泺; 张文姣; 张雪利; 李丹丹
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2024-01-26
Filing date: 2024-01-26
Publication date: 2024-04-19

Abstract

The invention discloses an application of GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton, and belongs to the technical field of genetic engineering. The nucleotide sequence of the GhBRXL4.3 gene is shown in SEQ ID NO:1, the invention utilizes VIGS technology to silence target gene in cotton, after salt and low temperature stress treatment, the target gene is found to cause antioxidant enzyme (SOD, POD and CAT) activity, soluble sugar and chlorophyll content reduction and MDA content increase, ghSOS1, ghSOS2, ghNHX1, ghCIPK, ghHDT4D, ghCBF1 and GhPP C and other adversity stress related gene expression reduction is found, namely, the silencing target gene leads to cotton resistance reduction, and the gene is proved to positively regulate cotton to respond to salt and low temperature stress.

Description

Application of GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton.

Background

Cotton is an annual herb of malvaceae, can provide natural textile fibers, can provide abundant seed oil and protein, and is one of important economic crops in the world. Therefore, cotton planting has important socioeconomic significance in the global field. While cotton is economically important, various environmental factors, including biotic and abiotic stresses, pose a great threat to cotton production. Due to global climate change, drought, salinity, extreme temperature, waterlogging, heavy metals, hypoxia and other main abiotic stresses, the growth and development of plants are hindered, the yield and quality of crops are influenced, and the sustainable development of agriculture is influenced. To maximize survival efficiency, plants develop a variety of defense mechanisms and strategies to address various adverse conditions. In the defense mechanisms of plants, many stress-responsive genes help plants withstand the adverse effects of various environmental factors by regulating transcriptome levels.

BREVIS RADIX (BRX) is a highly conserved family of plant-specific genes found in all higher plants for which data is available, involved in longitudinal and radial expansion of hypocotyls and roots, embryo and leaf development, and asymmetric division of stomatal cells. The BRX gene family plays an important role in plant growth and development and responding to adversity stress, but the excavation, screening and utilization of salt-tolerant and low-temperature-tolerant gene resources in cotton BRX family members are not seen so far.

Disclosure of Invention

The invention aims to provide application of the GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton, so as to solve the problems in the prior art, and the GhBRXL4.3 gene positively regulates and controls cotton response salt and low temperature stress reaction, and can improve the salt tolerance and low temperature resistance of cotton by up-regulating expression in cotton.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides application of a GhBRXL4.3 gene or a fragment thereof in regulation and control of salt tolerance and/or low temperature resistance of upland cotton, wherein the nucleotide sequence of the GhBRXL4.3 gene is shown as SEQ ID NO: 1.

The invention also provides application of the protein coded by the GhBRXL4.3 gene or the fragment thereof in regulation and control of salt tolerance and/or low temperature resistance of upland cotton.

The invention also provides application of the recombinant vector containing the GhBRXL4.3 gene or the fragment thereof in regulation and control of salt tolerance and/or low temperature resistance of upland cotton.

The invention also provides application of the host bacteria containing the recombinant vector in regulation and control of salt tolerance and/or low temperature resistance of upland cotton.

Preferably, the salt tolerance and/or low temperature tolerance of the upland cotton is increased by up-regulating the expression level of the ghbrxl4.3 gene or a fragment thereof in the upland cotton.

The invention also provides a construction method of the salt-tolerant and/or low-temperature-tolerant transgenic upland cotton, which comprises the step of up-regulating the expression level of the GhBRXL4.3 gene or fragments thereof in upland cotton to improve the salt-tolerant and/or low-temperature-tolerant property of upland cotton.

Preferably, the nucleotide sequence of the GhBRXL4.3 gene is shown in SEQ ID NO: 1.

The invention discloses the following technical effects:

The invention analyzes the expression modes of the upland cotton BRX gene (GhBRX) family under four abiotic stresses of salt, drought, high temperature and low temperature, finds that GhBRX family members can respond to the salt and low temperature stresses, and also finds that GhBRXL4.3 is highly expressed in the salt and low temperature stresses. In order to further determine the molecular mechanism of GhBRXL4.3 gene response in salt and low temperature stress, the VIGS technology is utilized to silence the target genes in cotton plants, and after salt and low temperature stress treatment, the fact that 4 target genes can cause antioxidant enzyme (CAT, POD and SOD) activity, reduction of soluble sugar and chlorophyll content and increase of MDA content is found, and the expression of stress related genes GhSOS1, ghSOS2, ghNHX1, ghCIPK6, ghHDT4D and GhCBF1 and GhPP C is reduced, so that the defect that the GhBRXL4.3 gene is silenced to cause the reduction of cotton resistance is proved, and important gene resources are provided for terrestrial cotton salt resistance and low temperature resistance breeding by positively regulating cotton response salt and low temperature stress.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the patterns of vector pEASY-T5 Zero (a) and TRV2 vector (b);

FIG. 2 shows the results of PCR amplification of the target gene, PCR of the bacterial liquid of the target gene silencing vector construct and double digestion; a, target gene PCR amplification results, wherein lane 1 is a PCR amplification product, and lane 2 is a Marker (D2000); b: the target gene silencing vector construct bacterial liquid PCR detection results show that lanes 1-5 are the target gene silencing vector construct bacterial liquid, and lane 6 is Marker (D2000); c: double cleavage results of the target gene and the silencing vector construct show that lanes 1-4 are double cleavage products, and lane 5 is Marker (D2000);

FIG. 3 phenotype of control and silencing plants; a is the phenotype of a TRV GhCLA positive control; b is the phenotype of TRV GhCLA, WT, TRV:00, TRV:GhBRXL4.3 before the VIGS stress;

FIG. 4 shows the results of the detection of the silencing efficiency of a target gene in a TRV GhBRXL4.3 plant under salt stress and low temperature stress;

FIG. 5 is a phenotypic analysis of upland cotton plants under salt and low temperature stress;

FIG. 6 shows the results of MDA content detection of a target gene silencing plant;

FIG. 7 is a graph showing the level of antioxidant enzyme SOD, POD and CAT activity in gene-silenced plants of interest;

FIG. 8 is a graph showing the results of the detection of soluble sugar content in a gene-silenced plant of interest;

FIG. 9 shows the chlorophyll content measurement results of the target gene silencing plant;

FIG. 10 shows the expression of stress-related genes GhSOS, ghSOS2, ghNHX1, ghCIPK, ghHDT D, ghCBF1 and GhPP C in silenced plants.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The invention analyzes the expression modes of the upland cotton BRX gene (GhBRX) family under four abiotic stresses of salt, drought, high temperature and low temperature, finds that GhBRX family members can respond to the salt and low temperature stresses, and also finds that GhBRXL4.3 is highly expressed in the salt and low temperature stresses. In order to further determine the molecular mechanism of GhBRXL4.3 gene response in salt and low temperature stress, the VIGS technology is utilized to silence the target gene in cotton plants, and after salt and low temperature stress treatment, the GhBRXL4.3 is found to cause antioxidant enzyme (CAT, POD and SOD) activity, reduction of soluble sugar and chlorophyll content and increase of MDA content, and the expression of adversity stress related genes GhSOS1, ghSOS2, ghNHX1, ghCIPK, ghHDT D and GhCBF1 and GhPP C is reduced, so that the defect that the GhBRXL4.3 gene is silenced leads to reduced cotton resistance is proved, and the GhBRXL4.3 gene positively regulates the cotton response to salt and low temperature stress reaction, thereby providing important gene resources for salt-tolerant and low temperature-tolerant breeding of upland cotton.

The technical scheme is further described below by specific examples.

The following examples relate to the main test materials and reagents:

(1) Test materials

Upland cotton new stone K25 (xinshiK), the seeds of which are provided by cotton institute of national academy of agricultural sciences.

Strains and vectors: GV3101 Agrobacterium competent cells and pEASY-T5 Zero cloning vector (CT 501-01, DH 5. Alpha. E.coli competent cells) were purchased from Shanghai Weidi Biotechnology Inc. and full gold Biotechnology Inc., respectively, and the VIGS vector systems (TRV 1, TRV2 and TRV: ghCLA) for gene silencing were given by the cotton institute transgenic subject group of China academy of agriculture, and the pEASY-T5 Zero vector map is shown in FIG. 1.

(2) Test reagent

The test reagents used are shown in Table 1.

Table 1 reagents used in the experiments

Preparing a solution:

a. the formulation of the medium is shown in Table 2:

table 2 culture medium formulation

Note that: the culture medium is sterilized at 121deg.C for 20min

B.100mL 50 xTAE buffer: 24.2g Tris+3.72g Na ₂EDTA·2H₂ o+5.71mL glacial acetic acid;

50mg/mL rifampicin (Rif) and 20mg/mL Acetosyringone (AS): dissolving 5g of Rif powder and 2g of acetosyringone powder in 100mL of DMSO solution respectively, filtering and sterilizing with 0.22 filter membrane respectively, packaging, and preserving at-20deg.C;

d.0.5M morpholinoethanesulfonic acid (MES): 10.65g MES powder is dissolved in 50mL ddH ₂ O, the pH value is adjusted to 5.6 by NaOH, the volume is fixed to 100mL, and the mixture is filtered and sterilized by a filter membrane of 0.22, packaged and stored at 4 ℃;

e.1m MgCl ₂: 9.521g of MgCl ₂ powder was dissolved in 100mL of ddH ₂ O, sterilized by filtration through a 0.22 filter membrane and stored at 4 ℃;

f.500mL of heavy suspension: 10mL 0.5M MES+1mL 20mg/mL AS+5mL 1M MgCl ₂, sterile ddH ₂ O was made up to 500mL.

(3) Test instrument

Visible spectrophotometers, high-speed refrigerated centrifuges, water baths, electrophoresis apparatuses, artificial climate boxes, gel cutting apparatuses, ultra-low temperature refrigerators, fluorescence quantitative apparatuses, gradient PCR apparatuses, sterilization pans, electronic balances, microwave ovens, table-type constant temperature shaking tables, ice-making machines, ultra-clean benches, biochemical incubators, ultra-micro spectrophotometers, ultra-pure water apparatuses and mini vortex mixing apparatuses.

Example 1 application of upland cotton GhBRXL4.3 Gene in regulating drought resistance and salt tolerance of upland cotton

1. Primer design

Cloning primers, qRT-PCR primers, VIGS silencing primers (VIGS silencing primer fragment size: 459 bp), fluorescent quantitative primers of the stress-related gene of the GhBRXL4.3 gene (SEQ ID NO: 1) were designed by NCBIPrimer-BLAST (https:// www.ncbi.nlm.nih.gov/tools/primer-BLAST /), and the primer sequences are shown in Table 3:

TABLE 3 primer list

Note that: the underlined fonts in the table indicate restriction sites, wherein GAATTC and GGTACC represent EcoRI and KpnI restriction sites.

2. Extraction and reverse transcription of RNA

RNA is extracted according to the instruction of the polysaccharide polyphenol plant total RNA extraction kit.

Reverse transcription (synthesis of the first strand of cDNA):

a. Taking out the packaged RNA from the refrigerator at-80 ℃ and melting on ice, taking out 5X FastKing-RT Supermix reagent and RNase-Free ddH ₂ O from the refrigerator at-20 ℃ and melting on ice, and mixing by light shaking;

b. The reaction system is shown in Table 4:

TABLE 4 reverse transcription reaction system

C. The reaction procedure is shown in Table 5:

Table 5 reaction procedure

D. After the reaction, the purity and concentration of cDNA were measured, and the cDNA was packaged and stored at-20 ℃.

3. Amplification of fragments of interest and ligation and transformation of cloning vectors

3.1 Amplification of fragments of interest

The cDNA of the Xinshi K25 (xinshiK) is used as a template, and Taq 2× PCR Mix with Dye V2 premix (containing dye) kit is used for amplifying the target gene, and the amplification system is shown in Table 6:

TABLE 6 amplification System

After the reaction solution is added according to the system, the mixture is gently mixed, centrifuged for a short time, and the reaction is carried out according to the reaction procedure of Table 7:

TABLE 7 amplification reaction procedure

After the completion of the reaction, 1.8% agarose gel electrophoresis was used to determine whether the size of the target gene was consistent with that expected.

3.2 Ligation of the Gene of interest to the cloning vector pEASY-T5 Zero

A. the pEASY-T5 Zero vector was removed from the-80℃refrigerator and thawed on ice.

B. The volume of the added target fragment (molar ratio of carrier to target fragment=1:5) was calculated and the following ingredients (whole procedure completed on ice) were added to a sterile 1.5mL centrifuge tube:

table 8 connection system

C. The mixture was gently mixed, centrifuged briefly, and then connected at 25℃for 5 minutes.

3.3 Transformation of DH 5. Alpha. E.coli competent cells

The strain is transformed into DH5 alpha escherichia coli competent cells by a heat shock method, and bacterial liquid PCR verification and sequencing (completed by Shanghai Biotechnology Co., ltd.) are carried out by using a target gene sequence primer (see Table 3).

4. Construction of silencing vector

The positive plasmid which is successfully sequenced in the 3.3 transformed DH5 alpha escherichia coli competent cells is used as a template, a silencing fragment is amplified by adding primers (see table 3) of restriction enzymes EcoRI and KpnI cleavage sites and protective bases, and a fragment of GhBRXL4.3 is inserted into a TRV2 silencing vector by a double cleavage method to construct a TRV:GhBRXL4.3 silencing vector, wherein the specific cleavage system is shown in the following table 9:

Table 9 enzyme digestion System

Stopping the reaction after 3 hours at 37 ℃, adding 10X Loading Buffer, recovering the PCR product of the target gene fragment, recovering the large fragment by enzyme digestion of the vector, connecting the target fragment with a silencing vector, converting the connecting product into competent cells of escherichia coli, carrying out bacterial liquid PCR and double enzyme digestion identification, and sequencing positive plasmids (Shanghai) after the completion, and transferring the positive plasmids into the competent cells of agrobacterium GV3101, wherein the specific operation is as follows:

a. GV3101 competent cells were removed from the-80℃ultra-low temperature refrigerator, thawed on ice, split into two tubes, 2. Mu.L of the successfully sequenced plasmid was aspirated, and added to centrifuge tubes for transformation.

B. After the above steps were completed, 350. Mu.L of LB liquid medium (without antibiotics) was added, shaking culture was performed for 2 hours (28 ℃,200 rpm), the bacterial liquid was uniformly spread on the solid medium (Kan ⁺ and Rif antibiotics were added), and the culture was performed for 2 days in the dark at 28 ℃.

C. After the culture is completed, picking the single colony into 5mL LB liquid culture medium (adding Kan ⁺ and Rif antibiotics), and culturing for 16h according to the condition of shaking culture in the step b;

d. After the cultivation is completed, the bacterial liquid is preserved by using 50% glycerol (bacterial liquid: glycerol=1:1), and is preserved at 80 ℃ for standby; and (5) performing bacterial liquid PCR to confirm that the vector is positive.

5. Upland cotton VIGS silencing target gene

VIGS silencing of new stone K25 seedlings was performed as follows:

a. Planting a new stone K25 seed, soaking the new stone K25 seed until the new stone K25 seed grows to the seventh day, and standing for standby after the cotyledon is fully unfolded until nutrient soil in the flowerpot absorbs water to the surface.

B. Kan ⁺ and Rif were added to LB liquid medium for use, wherein the final concentrations of Kan ⁺ and Rif were 50. Mu.g/mL and 25. Mu.g/mL, respectively. The VIGS vector system and the objective gene bacterial liquid taken out from-80 ℃ were thawed on ice, and activated at 28 ℃ and 200rpm for 12-16 hours (bacterial liquid: LB liquid medium=1:10). And after the activation is finished, the propagation is carried out according to the same proportion.

C. After the bacterial liquid is propagated, centrifuging for 10min at 5000rpm, pouring out supernatant, retaining bacterial cells, suspending the bacterial cells by using a spectrophotometry heavy suspension, and obtaining the bacterial cell with OD ₆₀₀ between 1.8 and 2.0.

D. After resuspension is completed, the cells are placed in the dark for 3 hours, and after resuscitating, TRV1 is respectively mixed with a cell body weight suspension 1:1 containing TRV 00 (as a blank control group), TRV GhCLA (as a positive control) and TRV GhBRXL4.3 (as an experimental group) and fully and uniformly mixed.

E. On the seventh day of cotton seedling growth, it was soaked in water according to the method of step a. VIGS injections were performed on cotton seedlings on the eighth day of growth, with specific manipulations: the back of the cotyledon is scratched by using a 1mL syringe needle (the wound is not too large and the needle point is just as large as possible), the mixed bacterial liquid in the step d is injected into the cotton cotyledon, and the bacterial liquid fills the whole cotyledon as much as possible.

F. after injection, in order to achieve better infection effect, the seeds are wrapped by a plastic bag, and are cultivated under normal growth conditions after being placed in darkness at 25 ℃ for 24 hours.

G. After the positive control cotton seedlings whiten, the silencing efficiency of the positive control cotton seedlings is detected by adopting a fluorescent quantitative experiment of WT (untreated), blank control group and experimental group cotton young leaves.

5.1 Salt and Low temperature stress treatment of Gene-silenced cotton plants

After the injected positive cotton seedlings are whitened, the cotton seedlings grown to four weeks old in the blank control group and the experimental group are respectively treated with 200mmol/L NaCl and 12 ℃ at low temperature for salt and low temperature, and phenotype observation is carried out.

5.2 Determination of physiological index of Gene-silenced cotton leaves

And detecting the antioxidant enzyme (SOD, POD and CAT) activity, MDA content, soluble sugar content and chlorophyll content of cotton leaves of a blank control group and an experimental group respectively according to a conventional method so as to analyze the response of a target gene silencing plant to salt and low-temperature stress.

5.3 Fluorescent quantification of adversity stress related Gene in the Gene silencing Strain

Young leaves of the silent strain were picked, RNA was extracted by using a RNAprep pure polysaccharide polyphenol plant total RNA extraction kit (cat No. DP441, purchased from the physcolio Biotechnology Co., ltd.) and reverse transcribed by using a FastKing one-step method to remove the first strand of genomic cDNA from the synthetic premix kit, and finally the expression levels of stress-related genes GhSOS, ghSOS2, ghNHX1, ghCIPK, ghHDT D, ghCBF1 and GhPP C were detected by using a SuperReal fluorescent quantitative premix reagent enhancement kit (cat No. FP205, purchased from the physcolio Biotechnology Co., ltd.).

6. Results and analysis

6.1 Construction of the Gene fragment of interest and silencing vector

Using the cDNA of the Xinshi K25 as a template, the primers are shown in table 3, using Taq 2× PCR Mix with Dye V2 premix (containing dye) kit to clone the gene silencing fragment, detecting the fragment size by agarose gel electrophoresis, and sending the sequence to determine the sequence, the result is shown in figure 2 a, the target fragment is successfully amplified, and the gene sequence is shown in SEQ ID NO: 2.

The nucleotide sequence of GhBRXL4.3 is shown in SEQ ID NO:1 is shown as follows:

/>

Note that: the cloning primer for the GhBRXL4.3 gene is shown in underlined font, and the start codon and stop codon of the GhBRXL4.3 gene are in bold font.

SEQ ID NO.2：

AGGTCTGAAGATGAGAGCTCGAAAATGGAATCGGCAGAAGAAAGCCCTGTAACACCACCATTGACCAAAGAACGCGTACCTCGTAATTTATACCGTCCAGCGGGGATGGGGATGGGCTACTCATCCTCAGATTCACTTGATCAGCACCCAATGCAGGCCAGGCATTATTGTGACTCTGGTCTTACTTCAACCCCAAAAGTTTCTAGCATTAGTGGTGCCAAGACAGAGATATCATCAATGGATGCCTCTATGAGGAGTAGCTCATCAAGAGAGGCTGATCAGTCCGGGGAGCTATCTATCAGTAACGCCAGTGATCTCGAGACTGAGTGGGTTGAACAAGATGAACCAGGCGTTTACATTACAATCAGAGCCTTGCCAGGAGGCAAAAGGGAGCTTAGGCGAGTTAGATTCAGCCGAGAAATATTTGGAGAAATGCATGCTAGACTGTGGTGGGAAGAG.

Note that: the sequence size of the GhBRXL4.3 gene silencing fragment is 459bp.

The primers shown in Table 3 were used to amplify the VIGS fragment using Taq 2X PCR Mix with Dye V2 premix (containing dye) kit, and the fragment size was detected by agarose gel electrophoresis, the results of which are shown in FIG. 2 b; after the target fragment with proper size is successfully connected with pGM-T vector, the positive plasmid is connected with TRV2 vector by a double-enzyme digestion method, and the positive plasmid is identified by bacterial liquid PCR and double-enzyme digestion (the result is shown in figure 2 c) and sequenced successfully.

6.2 Detection of silencing efficacy of the Gene of interest

The successfully constructed TRV: ghBRXL4.3 silencing vector is used for infecting cotton seedlings with fully flattened cotyledons, and whitening is found to start to appear on the 7 th day after infection of a positive control (TRV: ghCLA) plant, and the 15 th day after VIGS silencing is obvious (see figure 3), so that the successful construction of a VIGS silencing system is demonstrated. The result of the silencing efficiency detection of the target gene is shown in figure 4, and the result shows that compared with a control group, the expression of GhBRXL4.3 in the TRV: ghBRXL4.3 plant is obviously inhibited, the silencing efficiency reaches 100% (36/36), and the expression quantity analysis of the VIGS silencing plant and the control plant shows that the target gene is silenced.

6.3 Phenotypic analysis of Gene-silenced plants of interest by salt and Low temperature stress

Four weeks old VIGS silenced lines were selected, including target gene silencing TRV: ghbrxl4.3 and control TRV:00 plants subjected to salt and low temperature stress treatments. The results are shown in fig. 5, and found: after 200mmol/L NaCl and 12 ℃ low temperature treatment for 12 days, compared with a control group, plant cotyledons injected with TRV 00 bacterial liquid and target gene silencing bacterial liquid are completely fallen off, and the plant cotyledons with TRV GhBRXL4.3 silencing plants are found to be seriously dehydrated and are more seriously yellowing and wilting compared with TRV 00 plant cotyledons, so that the GhBRXL4.3 genes participate in salt-tolerant and low temperature-tolerant reactions of upland cotton.

6.4 Effect of salt and Low temperature stress on MDA content of target Gene-silenced Cotton leaf

MDA content detection analysis is carried out on the GhBRXL4.3 gene silencing plant and the empty vector plant after stress, the results are shown in figure 6, and the results are found that: the MDA content of the GhBRXL4.3 silencing plant under salt and low temperature stress is obviously increased, which indicates that the silencing of the GhBRXL4.3 gene causes the reduction of cotton resistance.

6.5 Effect of salt and Low temperature stress on the antioxidant Activity of Gene-silenced Cotton leaves of interest

The antioxidant enzyme (SOD, POD and CAT) activities of the silenced plants were examined, and the results are shown in FIG. 7, in which GhBRXL4.3 silenced plants showed a different decrease in CAT, SOD and POD activities after 8 days of salt and low temperature stress, compared to the TRV 00 control plants.

6.6 Effect of salt and Low temperature stress on the soluble sugar content of the Gene-silenced cotton leaves of interest

As a result, as shown in FIG. 8, silencing of the GhBRXL4.3 gene caused a decrease in soluble sugar content compared to soluble sugar content in the control TRV:00 leaf, indicating that silencing of the GhBRXL4.3 gene increased the sensitivity of cotton to salt and low temperature stress.

6.7 Effect of salt and Low temperature stress on the chlorophyll content of the Gene-silenced Cotton leaf of interest

When plants are subjected to high-intensity abiotic stress, plant leaves can be obviously yellowing and wilting. The detection of chlorophyll content is one of the important indexes for detecting plant stress tolerance. The chlorophyll content of the cotton after stress is detected, and the result shows that the chlorophyll content of the GhBRXL4.3 gene silencing plant is obviously lower than that of a control plant (see figure 9), which shows that the GhBRXL4.3 gene silencing results in the weakening of salt resistance and low temperature resistance of the cotton plant.

6.8 Effect of salt and Low temperature stress on expression of stress Gene in silent lines

As shown in FIG. 10, ghSOS1, ghSOS2, ghNHX.1, ghCIPK, ghHDT D, ghCBF.1 and GhPP C genes were significantly reduced in the TRV: ghBRXL4.3 plants relative to the TRV:00, indicating that silencing the GhBRXL4.3 gene would affect the expression of stress-related genes.

Taken together, silencing ghbrxl4.3 by VIGS is more sensitive to salt and low temperature stress than controls, demonstrating reduced cotton resistance, thus demonstrating that the above genes positively regulate cotton response to salt and low temperature stress.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

The application of the GhBRXL4.3 gene or the fragment thereof in regulating and controlling salt tolerance and/or low temperature resistance of upland cotton is characterized in that the nucleotide sequence of the GhBRXL4.3 gene is shown as SEQ ID NO: 1.
2. Use of a protein encoded by the ghbrxl4.3 gene or fragment thereof as defined in claim 1 for regulating salt and/or low temperature resistance of upland cotton.
3. Use of a recombinant vector comprising the ghbrxl4.3 gene or fragment thereof of claim 1 for regulating salt tolerance and/or low temperature tolerance of upland cotton.
4. Use of a host bacterium comprising the recombinant vector of claim 3 for regulating salt tolerance and/or low temperature tolerance of upland cotton.
5. The use according to any one of claims 1 to 4, wherein the salt and/or low temperature resistance of the upland cotton is increased by up-regulating the expression level of the ghbrxl4.3 gene or fragment thereof in the upland cotton.
6. A construction method of salt-tolerant and/or low-temperature-tolerant transgenic upland cotton is characterized by comprising the step of up-regulating the expression level of GhBRXL4.3 gene or fragments thereof in upland cotton to improve the salt-tolerant and/or low-temperature-tolerant of upland cotton.
7. The construction method according to claim 6, wherein the nucleotide sequence of the GhBRXL4.3 gene is shown in SEQ ID NO: 1.