CN105420245A - Salt-stress induced gene OsEAR1 of plants and encoding protein and application thereof - Google Patents
Salt-stress induced gene OsEAR1 of plants and encoding protein and application thereof Download PDFInfo
- Publication number
- CN105420245A CN105420245A CN201510809678.9A CN201510809678A CN105420245A CN 105420245 A CN105420245 A CN 105420245A CN 201510809678 A CN201510809678 A CN 201510809678A CN 105420245 A CN105420245 A CN 105420245A
- Authority
- CN
- China
- Prior art keywords
- gene
- plant
- osear1
- salt
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a salt-stress induced gene OsEAR1 of plants and application thereof. The nucleotide sequence of the gene is shown as SEQ ID NO:2, and the encoding amino acid sequence of the gene is shown as SEQ ID NO:1. By inhibiting expression of the rice OsEAR1 through an RNAi method, the salt-stress survival rate, growth rate and biomass of transgenic rice plants can be increased. The OsEAR1 gene supplies a basis to cultivation of crops of which the salt tolerance is improved.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of plant salt stress inducible gene OsEAR1 and application thereof.
Background technology
The soil salinization is a worldwide problem, according to UNESCO (UNESCO) and food and agricultural organization (FAO) incomplete statistics, and whole world saline-alkali soil ground area about 1,000,000,000 hectares.At present, be distributed in NORTHWEST CHINA, the saline-alkali wasteland of northeast and coastal region and saline and alkaline obstacle total cultivated area more than 500,000,000 mu, wherein there are nearly 200,000,000 mu of agricultural use potentiality, account for more than 10% of China total cultivated area.Saline and alkaline have remarkably influenced for growth and development of plants, is one of important factor causing crop failure.
Soil salinification causes China western part and coastal middle-and-low-yielding fields and big area soil resource to be difficult to the immediate cause effectively utilized.Although saltings can be irrigated by moisture, use chemical improvement agent carry out soil improvement, usually because of costly, take effect less and be difficult to realize.By conventional breeding seed selection Salt And Alkali Tolerance high-yield variety, often the cycle is long, also not easily obtains desirable result simultaneously.Cultivating resistance to inverse crop varieties by biotechnology is make full use of China saltings, alleviate shortage of water resources, ensure that high crop yield, stable yields are most economical, approach fast and effectively.
The response that plant grows at transcriptional level by regulating a series of activation and the molecular web influence of suppression and coerces arid, low temperature, salt stress and disease and pest etc.If the defensive raction of plant materials and environment stress reaction mechanism sustained activation, plant is by increase metabolism and consume more multi-energy.Therefore, plant evolution goes out a set of adaptation mechanism to ensure that plant closes these reactions under normal growth developmental state, and wherein most important means are exactly utilize the expression suppressing son to suppress environment stress genes involved.Transcription inhibition suppresses plant defense and environment stress related gene expression under non-environment stress, by suppressing some to activate the activity of sub-associated protein in defence and environment stress, to prevent because reaction too acutely produces injury to own cells.
There is suppression of EAR (ethylene-responsiveelementbindingfactor-associatedamphip hilicrepression) motif (L/FDLNL/F (x) P) in numerous plant transcription factor family, all include EAR motif as transcription factor family members such as ERF, MYB, ABI3/VP1, NIM1-INTERACTING1 and MADS and there is the function suppressing son.
By the system analysis of transgenic method to paddy rice EAR transcription factor, we find by paddy rice EAR gene OsEAR1 (
oryzasativaeAR1) salt tolerance of transgenic paddy rice can be improved after silence.
Summary of the invention
The object of this invention is to provide an EAR gene OsEAR1 deriving from paddy rice (
oryzasativasaltInducedEAR1), the salt tolerance of transgenic paddy rice can will be improved after rice Os EAR1 silence.
Paddy rice EAR transcription factor gene provided by the invention
oryzasativaeAR1, be called for short OsEAR1, derive from paddy rice (
oryzasativa), its proteins encoded aminoacid sequence is as shown in SEQIDNO:1.
The sequence of SEQIDNO:1 is made up of 355 amino-acid residues.
The present invention also provides the replacement and/or disappearance and/or interpolation and the protein that by SEQIDNO:1 sequence derived relevant to plant stress tolerance of the aminoacid sequence of SEQIDNO:1 being passed through one or several amino-acid residue.
In order to make described OsEAR1 albumen be convenient to purifying, label as shown in table 1 can be connected at the N-terminal of the protein be made up of the aminoacid sequence shown in SEQIDNO:1 or C-terminal.
The sequence of table 1 label
The above-mentioned protein derived by SEQIDNO:1 sequence can synthetic, also its encoding gene can first be synthesized, carry out biological expression again to obtain, its encoding gene is by the codon by lacking one or several amino-acid residue in the DNA sequence dna shown in SEQIDNO:2, and/or carry out the missense mutation of one or several base pair, and/or the encoding sequence connecting the label shown in table 1 is held to obtain at its 5 ' end and/or 3 '.
The present invention also provides a kind of coding described plant salt stress inducible gene OsEAR1, and its nucleotide sequence is as shown in SEQIDNO:2, or its degenerate sequence.
Meanwhile, the present invention also provides the DNA sequence dna as shown in SEQIDNO:2 to have more than 90% homology, and the DNA molecular of coding stress tolerance correlative protein.
The present invention is also provided in hybridizes and the DNA molecular of encoding said proteins with the DNA sequence dna shown in SEQIDNO:2 under strict conditions; Also provide simultaneously, with this DNA molecular, there is more than 90% homology, and the DNA molecular of coding stress tolerance correlative protein; Described stringent condition can be in the solution of 6 × SSC, 0.5%SDS, 65
ohybridize under C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
The present invention also provides the recombinant expression vector of described gene.
Available existing plant expression vector construction contains the recombinant expression vector of described gene.
Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.
When using described gene constructed recombinant plant expression vector, any one enhancement type promotor or constitutive promoter can be added before its transcription initiation Nucleotide, as the ubiquitin promoter (Ubiquitin) of cauliflower mosaic virus (CAMV) 35S promoter, corn, they can be used alone or are combined with other plant promoter.
For the ease of identifying transgenic plant cells or plant and screening, can process plant expression vector used, the coding can expressed in plant as added can produce enzyme or the gene (gus gene, luciferase genes etc.) of luminophor, the antibiotic marker thing (gentamicin marker, kantlex marker etc.) with resistance or the chemical resistance reagent marker gene (as anti-weedkiller gene) etc. of colour-change.From the security consideration of transgenic plant, any selected marker can not be added, directly with adverse circumstance screening transformed plant.
Described recombinant expression vector is the recombinant plasmid multiple clone site that described gene inserts pC5300 obtained.
The present invention also provide above arbitrary described gene (
osEAR1) expression cassette, transgenic cell line and recombinant bacterium.
Increase described gene (
osEAR1) primer pair of total length or arbitrary fragment also belongs to protection scope of the present invention.
The present invention also provides the described application of gene in the transgenic plant cultivating salt tolerance raising.
Above-mentioned application is imported in object plant (as vegetable cell or tissue) described for coding plant salt stress inducible gene fragment, obtains the transgenic plant of salt tolerance higher than described object plant.Particularly, described recombinant expression vector is imported in object plant, obtains the salt tolerance of transgenic plant higher than described recipient plant.
Experiment shows, by artificial tiny RNA method (artificialmicroRNA) by of the present invention
osEAR1after the expression silencing of gene, transgenic paddy rice salt tolerance can be improved, improve survival rate, growth velocity and biomass under the salt stress of transgenic rice plant.Paddy rice of the present invention
osEAR1gene is cultivate other crops with salt tolerance raising to provide the foundation.
Accompanying drawing explanation
Fig. 1 is that OsEAR1 transfer-gen plant PCR identifies.
Fig. 2 is the qualification of OsEAR1 transfer-gen plant real-time quantitative PCR.
Fig. 3 is water planting contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1.
Fig. 4 is the survival rate of water planting contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1 and Ri-2.
Fig. 5 is the plant height of water planting contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1 and Ri-2.
Fig. 6 is earth culture experiment contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1.
Fig. 7 is the survival rate of earth culture experiment contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1 and Ri-2.
Fig. 8 is the plant height of earth culture experiment contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1 and Ri-2.
Fig. 9 is the over-ground part single-strain fresh weight of earth culture experiment contrast and salt stress process wild-type and OsEAR1 transgenic line Ri-1 and Ri-2.
Embodiment
Detailed description below by embodiment illustrates the present invention further, but is not limitation of the present invention, only does example explanation.
Experimental technique in following embodiment, if no special instructions, is ordinary method, test materials used, if no special instructions, is and purchases available from routine biochemistry reagent shop, and experiment all arranges three repetitions, results averaged.
the clone of embodiment 1:OsEAR1cDNA
Japanese fine transcription factor database (PlantTranscriptionFactorDatabasev2.0 is searched for PatMatch1.2 (www.arabidopsis.org), http://planttfdb.cbi.pku.edu.cn), in 2424 rice transcription factors, there are 374 transcription factors to contain EAR motif (DLNxxP or LXLXL).In order to study the function of these EAR genes, according to the fine Rice Genome Sequence information of Japan (http://rice.plantbiology.msu.edu/) and gene annotation information, obtain possible OsEAR1 coding region sequence, design amplification OsEAR1 gene regions encoding sequence special primer is as follows:
Upstream primer: 5 '-ATGACGAACGGGGCGGCGGG-3 ';
Downstream primer: 5 '-TCAGGAGGGATCCGCACGAG-3 '.
Get a monthly age rice leaf 0.2g, liquid nitrogen grinding, TRIzol method extracts total serum IgE.Get 2 μ g total serum IgE SuperScript IIRT ThermoScript II and carry out reverse transcription, synthesis cDNA first chain, as template, carries out PCR reaction with above-mentioned special primer.PCR primer, after electrophoretic separation reclaims, is cloned into pEASY-T(Beijing Quanshijin Biotechnology Co., Ltd), called after pEASY-T-OsEAR1ORF, checks order.
Sequencing result shows, the nucleotide sequence of this fragment as shown in SEQIDNO:2, coding the protein shown in SEQIDNO:1.
embodiment 2: paddy ricethe silence of OsEAR1
One, the structure of OsEAR1 silent carrier
The present invention takes OsEAR1 reticent with the artificial tiny RNA method of OsEAR1cDNA complementary, and concrete grammar is as follows:
1, with plasmid pNW55 for masterplate, adopt KODFXDNA polysaccharase and carry out 3 pcr amplifications with following 3 pairs of Auele Specific Primers.Its PCR response procedures is (1) 95 ° of C 5 minutes denaturations, (2) 95 ° of C 10 seconds, (3) 55 ° of C30 seconds, (4) 68 ° of C30 seconds, (5) by (2)-(4) circulation 35 times, (6) 68 ° of C10 minute.
Reaction 1: upstream primer: 5 '-CTGCAAGGCGATTAAGTTGGGTAAC-3 ';
Downstream primer: 5 '-tgGAGTCGCTAGTATTACAAAGActgctgctgctacagcc-3 '.
Reaction 2: upstream primer: 5 '-agTCTTTGTAATACTAGCGACTCcaggagattcagtttga-3 ';
Downstream primer: 5 '-aaTCTTTGTAATAGTAGGGACTCagagaggcaaaagtgaa-3 '.
Reaction 3: upstream primer: 5 '-ctGAGTCCCTACTATTACAAAGAttcctgctgctaggctg-3 ';
Downstream primer: 5 '-GCGGATAACAATTTCACACAGGAAACAG-3 '.
After PCR primer electrophoretic separation, cut respectively glue reclaim 256,87,259bpDNA fragment.
2. above-mentioned 3 different lengths DNA fragmentations are mixed as template, adopt KODFXDNA polysaccharase and primer pair 5 '-CTGCAAGGCGATTAAGTTGGGTAAC-3 '; 5 '-GCGGATAACAATTTCACACAGGAAACAG-3 ' pcr amplification, this PCR response procedures is (1) 95 ° of C 5 minutes denaturations, (2) 95 ° of C 10 seconds, (3) 55 ° of C30 seconds, (4) 68 ° of C40 seconds, (5) by (2)-(4) circulation 35 times, (6) 68 ° of C10 minute.PCR primer, after electrophoretic separation, is cut glue and is reclaimed 554bpDNA fragment.
3. the 2nd step is obtained DNA fragmentation restriction enzyme BamHI and KpnI to digest, after electrophoretic separation, cut glue and reclaim 255bpDNA fragment.
4, cut pC5300 (Ubiquitin promotor) (PLoSONE2008,3 (3): e1829) with restriction enzyme BamHI and KpnI enzyme, reclaim skeleton.
5, the fragment that fragment step 3 obtained and step 4 obtain is connected, transformation of E. coli DH5 α, and order-checking confirms correct, obtains pC-OsEAR1.
Two, the acquisition of transgenic plant
1, utilize electric shocking method that recombinant expression vector pC-OsEAR1 is imported Agrobacterium AGL0 (ATCC BAA-100, www.atcc.org).
5, the Agrobacterium AGL0 containing pC-OsEAR1 is infected the embryonic type callus that Japanese fine wild-type induction produces, then screening resistant calli in MS substratum (containing 30mg/L Totomycin), per 15 days generations, amounted to for 3 generations, then resistant calli is induced into whole plant, rice transplanting is in land for growing field crops, and the T1 of results transgenic plant is for seed.
Three, the Molecular Detection of transgenic plant
CTAB method extracts leaf DNA, detect with pC-OsEAR1 Auele Specific Primer 5 '-TCGCCAAGCCCTTGCTCTTC-3 ' and 5 '-TCATCCGGCGCACCATCAAC-3 ' PCR, result shows there is specific amplification band in transfer-gen plant, and wild-type DNA is without specific amplified band (Fig. 1), this shows that pC-OSIR1 carrier segments imports transfer-gen plant.
TRIzol method extraction wild-type in 2 week age and OsEAR1 transfer-gen plant (Ri-1, Ri-2Ri-1) blade total serum IgE, get 2 μ g total serum IgE, with 2uRQ1RNase-freeDNase (Promega) 37 ° of C process 30min, after adding termination reaction liquid, take polyA as primer, utilize M-MLV ThermoScript II 42 ° of C1 hour synthesis cDNA first chains, then be template with cDNA, with Ubiquitin (primer 5 '-CCATCCTCAAGCTGCTTACC-3 ' and 5 '-GACTGGCAAGACCATTACCC-3 ') for internal reference, PCR method detects OsEAR1 gene (primer 5 '-TCATCTGCTGGTCCCTCATC-3 ' and 5 '-CATTGCTGCTGCTCCCAAAG-3 ') and expresses, result as shown in Figure 2.Relative to Wild type control plants, the expression of OsEAR1 gene is reduced to 0.31 and 0.28 times of wild-type in pC-OsEAR1 transfer-gen plant (Ri-1, Ri-2).This shows that the expression of OsEAR1 in transfer-gen plant is reticent by part.
embodiment 3:OsEAR1 transgenic rice plant salt tolerance detects
One, water planting rice plant salt tolerance detects
Wild-type and the 42 ° of C process of OsEAR1 transgenic paddy rice seed are after 3 days, and Yu Shuizhong soaks seed 24 hours, 37 ° of C vernalization, and choose the consistent seed of rudiment in following nutrient solution, 28 ° of C cultivate 4 days, then in containing the nutrient solution of 100mMNaCl, process 4 days.As in Figure 3-5, in untreated control, wild-type and OsEAR1 transgenic rice plant do not have significant difference to result.After 100mMNaCl process, wild-type and the transfer-gen plant speed of growth in treating processes slows down, wilting gradually, death, and show physical signs statistics, WT lines survival rate is 37%, plant height 13.8cm; And the survival rate 48% and 51% of OsEAR1 transgenic line Ri-1 and Ri-2; Ri-1 and Ri-2 plant height is respectively 16.9 and 17.3cm.This shows that, in the process of water planting salt stress, OsEAR1 transgenic rice plant salt tolerance is significantly higher than wild type control.
Nutrient solution is filled a prescription: four water-calcium nitrate 945mg/L, saltpetre 506mg/L, ammonium nitrate 80mg/L, potassium primary phosphate 136mg/L, magnesium sulfate 493mg/L, iron salt solutions 2.5ml/L, micro-mother liquor 5ml/L, pH=6.0.
Iron salt solutions: iron vitriol 2.78g, disodium ethylene diamine tetraacetate (EDTA.Na) 3.73g, distilled water 500ml, pH=5.5.
Trace element mother liquor: potassiumiodide 0.83mg/l, boric acid 6.2mg/L, manganous sulfate 22.3mg/L, zinc sulfate 8.6mg/L, Sodium orthomolybdate 0.25mg/L, copper sulfate 0.025mg/L, cobalt chloride 0.025mg/L.
Two, earth culture rice plant salt tolerance detects
Wild-type and the 42 ° of C process of OsEAR1 transgenic paddy rice seed are after 3 days, and Yu Shuizhong soaks seed 24 hours, 37 ° of C vernalization, choose the consistent seed of rudiment in the little basin that Nutrition Soil is housed, cover the moisturizing of one deck preservative film, after coming up, remove preservative film, after 2 weeks, the water put into by the little basin of rice cultivation seedling containing 100mMNaCl soaks 1 week, is then poured out by salt solution, changes a tap water every day, take a picture after 1 week, statistics physiological phenotype.As Figure 6-9, in the control experiment not having salt stress process, OsEAR1 transgenic paddy rice strain Ri-1 and Ri-2 growth does not have notable difference, through 100mMNaCl process 1 week then rehydration, the survival rate of Wild type control plants only has 42%, and the survival rate of OsEAR1 transgenic paddy rice strain Ri-1 and Ri-2 is respectively 55% and 62%, be significantly higher than wild type control.Measure plant height and fresh weight result as shown in FIG. 8 and 9, the plant height of OsEAR1 transgenic paddy rice strain Ri-1 and Ri-2 is 27.3 and 27.8cm, is significantly higher than the 25.3cm of Wild type control plants; The single-strain fresh weight of OsEAR1 transgenic paddy rice strain Ri-1 and Ri-2 is 161 and 172mg, is also significantly higher than wild type control single-strain fresh weight 108mg.Above result shows, in earth culture experiment, compared with non-transgenic wild type control, the salt tolerance of OsEAR1 transgenic paddy rice strain significantly improves.
<110> Biological Technology institute, Chinese Academy of Agricultural Sciences
<120> plant salt stress inducible gene OsEAR1 and proteins encoded thereof and application
<130>1
<160>2
<210>1
<211>355
<212>PRT
<213>Oryzasativa
<400>1
MetThrAsnGlyAlaAlaGlyGlyGlyGlyGlyAlaGlyLeuGlyGly
ThrArgValProThrTrpArgGluArgGluAsnAsnArgArgArgGlu
ArgArgArgArgAlaIleAlaAlaLysIleTyrAlaGlyLeuArgAla
TyrGlyAsnTyrAsnLeuProLysHisCysAspAsnAsnGluValLeu
LysAlaLeuCysAsnGluAlaGlyTrpThrValGluProAspGlyThr
ThrTyrArgLysGlyCysLysProProGlnAlaGluArgProAspPro
IleGlyArgSerAlaSerProSerProCysSerSerTyrGlnProSer
ProArgAlaSerTyrAsnProSerProAlaSerSerSerPheProSer
SerGlySerSerSerHisIleThrIleGlyGlyAsnSerLeuIleGly
GlyValGluGlySerSerLeuIleProTrpLeuLysThrLeuProLeu
SerSerSerTyrAlaSerSerSerLysPheProGlnLeuHisHisLeu
TyrPheAsnGlyGlySerIleSerAlaProValThrProProSerSer
TyrProThrArgThrProArgLeuArgThrAspTrpGluAsnAlaSer
ValGlnProProTrpAlaSerAlaAsnTyrThrSerLeuProAsnSer
ThrProProSerProGlyHisLysIleAlaProAspProAlaTrpLeu
SerGlyPheGlnIleSerSerAlaGlyProSerSerProThrTyrAsn
LeuValSerProAsnProPheGlyIlePheLysGluAlaIleAlaSer
ThrSerArgValCysThrProGlyGlnSerGlyThrCysSerProVal
MetGlyGlyMetProAlaHisHisAspValGlnMetValAspGlyAla
ProAspAspPheAlaPheGlySerSerSerAsnGlyAsnAsnGluSer
ProGlyLeuValLysAlaTrpAspGlyGluArgIleHisGluGluCys
ValSerAspGluLeuGluLeuThrLeuGlySerSerLysThrArgAla
AspProSer
<210>2
<211>1068
<212>DNA
<213>Oryzasativa
<400>2
atgacgaacggggcggcgggaggaggaggaggagcgggattggggggcacgagggtgccg60
acgtggagggagcgggagaacaaccggcggagggagcggcggcggcgggcgatcgcggcc120
aagatctacgccgggctgcgcgcctacggcaactacaacctccccaagcactgcgacaac180
aacgaggtgctcaaggcgctctgcaacgaggccggctggaccgtcgagcccgacggcacc240
acctaccgcaagggatgtaaacctcctcaagcagagcgtcctgatccaattggaagatcg300
gcttcgccaagcccttgctcttcatatcaaccaagtccgcgggcttcatacaacccaagt360
cctgcatcgtcctcctttccaagctctggatcctcctcgcatatcactattggtggaaac420
agcttgattggtggtgtcgagggaagctccctcattccatggctgaagacacttccgttg480
agttcatcatatgcctcctcctccaagttcccacagcttcaccatttatatttcaatgga540
ggttccattagtgcaccagtgactcctccatccagctaccctactcgcacacctcgctta600
aggactgattgggagaacgcaagtgttcagccaccatgggctagtgcaaattatacatct660
cttcccaactctacaccaccgagcccaggccacaagattgcaccagacccagcatggctc720
tcaggatttcaaatatcatctgctggtccctcatcgccaacatacaatcttgtttcgccg780
aatccatttgggattttcaaagaagctattgccagcacttccagggtgtgcacccctggt840
cagagcggaacatgttccccggtaatgggtggcatgccggctcatcatgatgttcagatg900
gttgatggtgcgccggatgattttgcctttgggagcagcagcaatggcaacaatgaatca960
cctggactggtgaaggcatgggacggggagcggatacatgaagaatgcgtctccgatgag1020
ctggagctcactcttgggagctcaaagactcgtgcggatccctcctga1068
Claims (10)
1. a paddy rice EAR transcription factor gene, its proteins encoded aminoacid sequence is as shown in SEQIDNO:1.
2. gene as claimed in claim 1, its nucleotide sequence is as shown in SEQIDNO:2, or its degenerate sequence.
3. the protein of genes encoding as claimed in claim 1.
4. the protein that a paddy rice EAR transcription factor is derivative, it is characterized in that, its such as aminoacid sequence shown in SEQIDNO:1 N-terminal or C-terminal connect following label: Poly-Arg, Poly-His, FLAG, Strep-tagII, c-myc.
5. the encoding gene of coding derived protein according to claim 4.
6. the recombinant expression vector containing gene described in claim 1,2 or 5.
7. expression vector as claimed in claim 6, it is characterized in that, it is plant expression vector, is preferably double base agrobacterium vector, can be used for the carrier of plant micropellet bombardment.
8. the application of gene in the transgenic plant cultivating salt tolerance raising as described in claim 1,2 or 5.
9. apply as claimed in claim 8, it imports in object plant by the recombinant expression vector containing described gene, and screening obtains the salt tolerance of transgenic plant higher than described recipient plant, and preferred plant is paddy rice.
10. obtain the method for rice varieties that salt tolerance improves, it is characterized in that, by paddy rice
osEAR1gene carries out silence, screening obtain salt tolerance improve rice plant, described gene if nucleotide sequence is as shown in SEQIDNO:2, preferably by the described gene of artificial tiny RNA method silence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510809678.9A CN105420245B (en) | 2015-11-19 | 2015-11-19 | Plant salt stress inducible gene OsEAR1 and its coding albumen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510809678.9A CN105420245B (en) | 2015-11-19 | 2015-11-19 | Plant salt stress inducible gene OsEAR1 and its coding albumen and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105420245A true CN105420245A (en) | 2016-03-23 |
| CN105420245B CN105420245B (en) | 2019-03-29 |
Family
ID=55498786
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510809678.9A Expired - Fee Related CN105420245B (en) | 2015-11-19 | 2015-11-19 | Plant salt stress inducible gene OsEAR1 and its coding albumen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105420245B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663233A (en) * | 2017-11-16 | 2018-02-06 | 中国农业科学院生物技术研究所 | Plant transcription factor STF1 and its encoding proteins and application |
| CN108148845A (en) * | 2018-02-08 | 2018-06-12 | 黄淮学院 | A kind of corn ZmKNOLLE genes, albumen and purposes for enhancing plant salt endurance |
| CN113025626A (en) * | 2021-04-26 | 2021-06-25 | 长江师范学院 | Application of tumorous stem mustard BjuEAR1 gene in regulation of plant stress resistance |
| CN114672511A (en) * | 2022-03-18 | 2022-06-28 | 四川农业大学 | Application of corn ZmBES1/BZR1-3 gene in increasing plant seed yield |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021054741A1 (en) * | 2019-09-20 | 2021-03-25 | 기초과학연구원 | Method for promoting de novo root regeneration of ultradian rhythm-based plants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844143A (en) * | 2006-05-12 | 2006-10-11 | 北京生命科学研究所 | Plant salt-tolerance associated protein and genes encoding same and use thereof |
-
2015
- 2015-11-19 CN CN201510809678.9A patent/CN105420245B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844143A (en) * | 2006-05-12 | 2006-10-11 | 北京生命科学研究所 | Plant salt-tolerance associated protein and genes encoding same and use thereof |
Non-Patent Citations (3)
| Title |
|---|
| 《DEVELOPMENTAL CELL》 * |
| 《GENBANK》 * |
| 《中国农业科技导报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107663233A (en) * | 2017-11-16 | 2018-02-06 | 中国农业科学院生物技术研究所 | Plant transcription factor STF1 and its encoding proteins and application |
| CN108148845A (en) * | 2018-02-08 | 2018-06-12 | 黄淮学院 | A kind of corn ZmKNOLLE genes, albumen and purposes for enhancing plant salt endurance |
| CN113025626A (en) * | 2021-04-26 | 2021-06-25 | 长江师范学院 | Application of tumorous stem mustard BjuEAR1 gene in regulation of plant stress resistance |
| CN113025626B (en) * | 2021-04-26 | 2022-06-14 | 长江师范学院 | Application of tumorous stem mustard BjuEAR1 gene in regulation of plant stress resistance |
| CN114672511A (en) * | 2022-03-18 | 2022-06-28 | 四川农业大学 | Application of corn ZmBES1/BZR1-3 gene in increasing plant seed yield |
| CN114672511B (en) * | 2022-03-18 | 2023-04-25 | 四川农业大学 | Application of corn ZmBES1/BZR1-3 gene in increasing plant seed yield |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105420245B (en) | 2019-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104480119B (en) | Plant salt stress inducible gene OsSIR1 and its encoding proteins and application | |
| CN1314944A (en) | Stress tolerance and delayed senesence in plants | |
| CN105420245A (en) | Salt-stress induced gene OsEAR1 of plants and encoding protein and application thereof | |
| CN101798341B (en) | Heat shock factor protein relevant to resistance of plants as well as coding gene and application thereof | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN111235165B (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| CN101775398A (en) | Stress tolerance genetic engineering application of NAC protein gene DlNAC of chrysanthemum | |
| CN108840915A (en) | Moso bamboo PeDi19-4 albumen and its encoding gene and application | |
| CN104480120B (en) | Plant salt tolerance related gene PpSIG2 and its encoding proteins and application | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN106554964B (en) | Application of cotton GbABR1 gene in verticillium wilt resistance | |
| CN102719451A (en) | Poncirus trifoliata basic helix-loop-helix (PtrbHLH) and application in improving cold resistance of plant | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance | |
| CN106831967A (en) | Reduce IAA10 albumen and its encoding gene expression is improving plant to the application in fractilinea oryzae resistance | |
| CN104561036A (en) | Plant salt-tolerance related gene PpSIG1 as well as encoding protein and application of gene | |
| CN107663233B (en) | Plant transcription factor STF1, and coding protein and application thereof | |
| CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application | |
| CN102336826A (en) | Transcription factor ERF related to soybean stress, coding gene thereof and application of coding gene | |
| CN105254730A (en) | Protein capable of improving salt tolerance and drought tolerance of plants as well as coding gene and application of protein | |
| CN106916213A (en) | A kind of albumin A sT and its encoding gene and the application in plant stress tolerance | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN105132456A (en) | Application of wheat calreticulin gene TaCRT1 in plant drought tolerance | |
| CN106336453B (en) | A kind of verticillium wilt resistance of cotton by same GAP-associated protein GAP GaRPL18 and its encoding gene and application | |
| CN106282200B (en) | Application of the sea island cotton GbNAC1 in resisting verticillium | |
| CN117904178B (en) | Application of GhBRXL4.3 gene in regulation and control of salt tolerance and/or low temperature resistance of upland cotton |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190329 Termination date: 20191119 |