CN106831967A - Reduce IAA10 albumen and its encoding gene expression is improving plant to the application in fractilinea oryzae resistance - Google Patents
Reduce IAA10 albumen and its encoding gene expression is improving plant to the application in fractilinea oryzae resistance Download PDFInfo
- Publication number
- CN106831967A CN106831967A CN201510882608.6A CN201510882608A CN106831967A CN 106831967 A CN106831967 A CN 106831967A CN 201510882608 A CN201510882608 A CN 201510882608A CN 106831967 A CN106831967 A CN 106831967A
- Authority
- CN
- China
- Prior art keywords
- iaa10
- albumen
- gene
- plant
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
Abstract
Application of the recombinant vector the invention provides protein I AA10 or its encoding gene or containing the encoding gene in Genes For Plant Tolerance rice dwarf virus disease is regulated and controled；The amino acid sequence of the protein I AA10 is the sequence 1 in sequence table.The experiment proves that, present invention discover that RDV coat protein P2 can be with I in Rice AA10 protein-interactings, so that IAA10 stability enhancings in plant, the paddy rice of IAA10 albumen excess accumulations is easily susceptible, and passes through gene silencing approach and turn resistance enhancing of the base paddy rice to RDV by what IAA10 expression quantity was lowered.
Description
Technical field
The present invention relates to biological technical field, more particularly to IAA10 albumen and its encoding gene expression are reduced in raising plant
Thing is to the application in fractilinea oryzae resistance.
Background technology
Auxin plays a role at many aspects of growth and development of plants, such as the division and differentiation of cell, the development of embryo,
The formation of apical dominance, the elongation of stem, development of lateral root etc..Auxin can within a very short time change it and be regulated and controled
Gene expression.Have 3 genoids can apply auxin after by rapid induced expression, they are respectively：
Aux/IAA (AUXIN/INDOLE-3-ACETIC ACID) family, GH3 (GRETCHENHAGEN-3) families and
SAUR (small auxin up RNA) family.Aux/IAA family genes encode a class half-life period very short Transcription inhibition.
When auxin concentration is very low, their transcriptional level is also very low, and after the rising of auxin level, they are lured rapidly
Expression is led, therefore this genoid plays a crucial role in the quick transient response of auxin.
Aux/IAA family proteins are very huge, the family member at least 31, arabidopsis being had been found that in paddy rice
In then have 29.Although the amino acid sequence differences of IAA family proteins are very big, their structure but has very high
Similitude, for example they all have nuclear localization signal, most of member all have 4 conservative domain (Domain
I, Domain II, Domain III and Domain IV).Doman I contain conservative LxLxL sequences, have
Transcriptional repression activity, it can not only suppress the transcriptional activation activity of the albumen for merging therewith, and can suppress and it
The transcriptional activation activity of the albumen of interaction.Domain II include one section of highly conserved sequence, can be by the albumen
E3 identifications during ubiquitination, the degraded to IAA albumen is related.Domain III and Domain IV are mediating proteins
The region of-protein-interacting, can make same IAA albumen or IAA albumen not of the same race form dimer, moreover it is possible to
IAA albumen is set to form dimer with ARF (auxin response factor) albumen.Therefore IAA family proteins are a classes
The half-life period very short protein factor with transcriptional repression activity.
IAA albumen is the very crucial factor in auxin paths.Under normal circumstances, IAA albumen and transcription factor ARF
Family member interacts, and forms heterodimer, suppresses the expression of the downstream gene of ARF regulation and control.In auxin water
It is flat it is elevated in the case of, IAA albumen and F-box Transport Inhibitor Response/Auxin Signaling F-box
(TIR1/AFB) as the coreceptor of auxin, the Interaction enhanced between them.TIR1 is ubiquitin E3 ligases
SCFTIR1A part for complex, wherein TIR1 are the F-box of complex, are responsible for bound substrates, then with complex
In other compositions coordinate, ubiquitin ubiquitin is added on substrate, the substrate for adding ubiquitin string can be by 26S protease
Body identification, degraded.Be bound tightly together for TIR1 and Aux/IAA albumen as glue by Auxin so that
Aux/IAA albumen is by SCFTIR1Complex ubiquitination, is degraded, by 26S enzyme bodies approach so as to relieve it to ARF
Inhibitory action, start it is a series of to grow and disease-resistant related gene expression.
Fractilinea oryzae (Rice Dwarf Virus, RDV) is that Reoviridae (Reoviridae) plant exhales intestines
The member of lonely Tobamovirus (Phytoreovirus).RDV is the cause of disease for causing rice dwarf virus disease, can infect paddy rice,
Cause Severe Reduction of Rice.The propagation of RDV need to be by means of insect amboceptor leafhopper.RDV is diplornavirus, its
Genome is 12 double-stranded RNAs.According to this migration of 12 double-stranded RNAs in polyacrylamide gel electrophoresis
Rate from slow to fast, is respectively designated as S1 to S12.At least seven kinds structural proteins of RDV genome encodings, including P1,
P2、P3、P5、P7、P8、P9；Five kinds of non-structural proteins, including Pns4, Pns6, Pns10, Pns11, Pns12.
P2 is the coat protein of RDV, is encoded by S2, and it can be with paddy rice Nei Gen-ent-kaurene oxidase and its class
Like protein-interacting, cause the reduction of rice gibberellin content, be one of the reason for causing rice dwarf symptom (Zhu
et al.,2005.The Rice Dwarf Virus P2Proteininteracts with ent-Kaurene Oxidases in vivo,
leading to reduced biosynthesis of Gibberellins andrice dwarf symptoms.Plant Physiology.
139:1935-1945.).In addition, P2 can cause the fusion of cell membrane in the insect amboceptor leafhopper cell of RDV,
Illustrate that the albumen plays a role (Zhou et al., 2007, The P2capsidprotein of during RDV infects leafhopper
the nonenveloped rice dwarf phytoreovirus induces membrane fusion in insect host cells.
Proceedings of the National Academy of Sciences of USA.104(49):19547-19552.)。
The content of the invention
It is an object of the present invention to provide one kind for regulate and control Genes For Plant Tolerance rice dwarf virus disease (or improve plant it is short to paddy rice
Contracting virus resistance) protein I AA10, the albumen is：
(A) there is the albumen of the amino acid sequence shown in the sequence 1 in sequence table；
(B) include thering is more than 95% with the amino acid sequence shown in sequence 1, preferably more than 98% homogeneity
Amino acid sequence and with the albumen to fractilinea oryzae resistance.
The albumen of above-mentioned (B) can be by one or more ammonia in displacement, substitution, additional or missing (A) sequence
Base acid is obtained.
It is a further object to provide for regulate and control Genes For Plant Tolerance rice dwarf virus disease (or improve plant to rice dwarf
Virus resistance) encoding proteins IAA10 gene, the gene is：
(A) there is the DNA molecular of the base sequence shown in the sequence 2 in sequence table；
(B) DNA molecular of albumen of the coding with the amino acid sequence shown in the sequence 1 in sequence table；
(C) DNA molecular of encoding proteins, the albumen is to include having with the amino acid sequence shown in sequence 1
More than 95%, the amino acid sequence of preferably more than 98% homogeneity and with the albumen to fractilinea oryzae resistance.
A further object of the present invention is to provide RNAi (RNA interference) carrier of said gene.RNAi carrier example
Such as contain the gene of the above-mentioned encoding proteins IAA10 of reverse complemental form (hairpin structure).
The carrier can use existing expression vector.Existing plant expression vector is included but is not limited to
PCambia2300, pCambia1300, pCambia1301, pCambia3301, pWM101 etc..Specific restructuring is carried
Body is the pCambia2300-actin-IAA10RNAi of preparation in the embodiment of the present application.
Method present invention also offers above-mentioned expression vector is built, the method includes：
1) DNA molecular shown in sequence 2 is obtained；
2) the DNA molecular design primer according to sequence 2, and restriction enzyme site and guarantor needed for primer two ends add
Shield base, primer sequence is IAA10-5'BamHI：5 '-GTGGATCCAAATGAGAGGAGGAGTAGCTGG-3 ',
IAA10-3'XhoI：5’-GCCTCGAGTCAGGATCTGCCTCTTGTTG-3’；
3) total serum IgE of 11 paddy rice is spent in being extracted with the TRIzol Reagent of Invitrogen companies, with the said firm
SuperScript II reverse transcriptases carry out reverse transcription, obtain cDNA；
4) with reverse transcription gained cDNA as template, with above-mentioned gene-specific primer IAA10-5'BamHI and
IAA10-3'XhoI enters performing PCR reaction, obtains the PCR primer of 861bp, and the PCR primer has sequence 2 in sequence table
Shown nucleotides；
5) digestion is carried out with restriction enzyme BamHI and XhoI after reclaiming PCR primer, 851bp is reclaimed and is carried
The PCR primer of cohesive end；By carrier pGADT7 restriction enzyme EcoRI and Sal I double digestions, reclaim
7987bp carrier frameworks；By PCR primers of the above-mentioned 851bp with cohesive end and 7987bp carrier frameworks T4
Ligase is connected, and converts coli strain DH5 α, obtains transformant, and the plasmid for extracting transformant sends to sequencing,
The plasmid is by BamHI the and XhoI enzymes of the gene IAA10 insertion vectors pGADT7 shown in sequence in sequence table 2
The carrier obtained between enzyme site, pGAD-IAA10, as recombinant vector are named as by the plasmid；
6) with pGAD-IAA10 as masterplate, (sequence is IAA10-5'SpeI：5’-
(sequence is for GTACTAGTATGAGAGGAGGAGTAGCTGG-3 ' and IAA10-3'BglII：
5 '-GCAGATCTTCAGGATCTGCCTCTTGTTG-3 ') enter performing PCR amplification, the PCR for obtaining 859bp is produced
Thing, by the PCR primer SpeI and BglII double digestions, is connected into XbalI and BamHI that (and SpeI and BglII are same
Tail enzyme) digestion intermediate carrier pUCCRNAi on, by sequencing, recombinant plasmid pUCC-IAA10 is by IAA10
The carrier obtained between XbalI the and BamHI restriction enzyme sites for inserting pUCCRNAi plasmids, then the double enzymes of SpeI and BglII will be used
The PCR primer cut is connected into be crossed in pUCC-IAA10 plasmids with SpeI and BglII double digestions, is obtained
PUCC-IAA10RNAi carriers, by sequencing, recombinant plasmid pUCC-IAA10RNAi is with reverse mutual by IAA10
Obtained between XbalI the and BamHI restriction enzyme sites and SpeI and BglII restriction enzyme sites of benefit form insertion pUCCRNAi plasmids
Carrier；
7) by pUCC-IAA10RNAi carriers PstI single endonuclease digestions, Ago-Gel is reclaimed and obtains 1939bp digestions product
Thing, the pCambia2300-Actin1-ocs carrier bones into the 10379bp obtained with PstI single endonuclease digestions are connected by the product
On frame, recombinant vector pCambia2300-actin-IAA10RNAi is obtained.
Another object of the present invention provides above-mentioned protein I AA10 or its encoding gene or the encoding gene
RNAi (RNA interference) carriers improve plant to fractilinea oryzae resistance in (or regulation and control Genes For Plant Tolerance paddy rice it is short
Contracting disease in) application.
In above-mentioned application, the cause of disease of the rice dwarf virus disease is fractilinea oryzae (Rice dwarf virus).
In above-mentioned application, the plant is preferably monocotyledon or dicotyledon, and above-mentioned monocotyledon is paddy rice.
It is described to comprise the following steps it is a further object to provide a kind of method for cultivating genetically modified plants：Will
The encoding gene of above-mentioned protein I AA10 is imported in purpose plant, obtains genetically modified plants, the water of the genetically modified plants
Rice dwarf wilt resistance is less than the purpose plant；Or said gene is transferred in purpose plant in hairpin structure form,
The genetically modified plants of its RNAi are obtained, the rice dwarf virus disease resistance of the genetically modified plants is higher than the purpose plant.
In the above method, the nucleotides sequence of the encoding gene of the protein I AA10 is classified as the sequence 2 in sequence table, or
Person is the DNA molecular of albumen of the coding with the amino acid sequence shown in the sequence 1 in sequence table, or encodes egg
White DNA molecular, the albumen is to include thering is more than 95%, preferably 98% with the amino acid sequence shown in sequence 1
More than homogeneity amino acid sequence and with the albumen to fractilinea oryzae resistance.
In the above method, the pathogen of the rice dwarf virus disease is fractilinea oryzae (Rice Dwarf Virus).
In the above method, the encoding gene of the protein I AA10 imports purpose plant by recombinant vector.
The recombinant vector is that the encoding gene of the protein I AA10 is inserted the recombinant vector obtained in expression vector.
The recombinant vector for for example being prepared by approach described above.In the above method, the plant is monocotyledon or Shuangzi
Leaf plant, above-mentioned monocotyledon is paddy rice.
The rice dwarf virus disease resistance of the genetically modified plants is embodied in after meeting RDV higher than the purpose plant, institute
The plant number for stating the RDV viruses of the infection of genetically modified plants is less than the purpose plant；Whether can be contained by identification
There are the genes of interest (Partial Fragment of S2) of RDV viruses or the susceptible feature of plant to determine the RDV diseases of infection
The plant of poison.
Applications of the above-mentioned protein I AA10 in as albumen-ubiquitin ligase is also the scope of protection of the invention.
Wherein plant expression vector include but is not limited to pCambia2300, pCambia1300, pCambia1301,
PCambia3301, pWM101 etc.；Rice varieties spend 11, show water 11, day in being preferably the kind sensitive to RDV such as
This fine, military 3 etc.；Rice tissue or transformation method may be selected from agrobacterium-mediated transformation, particle bombardment, electric shocking method,
Pollen tube pathway, lipofection and other methods that plasmid can be arbitrarily imported.
Those skilled in the art understands, by one or more in displacement, substitution, additional or missing protein sequence
Amino acid, can be modified it without changing its function.Therefore, the present invention has been construed as including to sequence 1
The above-mentioned modification that shown (IAA10) albumen is carried out.
The base sequence of IAA10 genes is not limited in sequence table shown in sequence 2, also including with by IAA10 and carrying
The DNA sequences that the corresponding any codon of each amino acid residue is selected and combined in the IAA10 albumen of above-mentioned modification
Row.The selection of the codon can be conventionally, it is also possible to reference to the codon preference type of host.
The experiment proves that, present invention discover that RDV coat protein P2 can interact with IAA10, improve
The stability of IAA10, promotion virus infection, and the paddy rice that IAA10 expression quantity is reduced by way of RNAi, it is right
The resistance enhancing of RDV.
Brief description of the drawings
Fig. 1 is the result that P2 and IAA10 albumen interacts in yeast；
Fig. 2 is that co-immunoprecipitation experiment verifies the result that P2 and IAA10 interacts；
Fig. 3 is that external degradation experiment proves that the presence of RDV causes that IAA10 stability strengthens；
Fig. 4 is that external degradation experiment proves that the presence of P2 causes that IAA10 stability strengthens；
Fig. 5 is the Western identifications for turning IAA10 paddy rice；
Fig. 6 is the Real-time identifications for turning IAA10RNAi paddy rice；
Fig. 7 is the RDV virus dependency basis for turning IAA10 and IAA10RNAi paddy rice and wild rice after RDV infects
The RT-PCR detections of cause；
Fig. 8 is the different rice strain's symptom figures for infecting RDV.
Specific embodiment
Experimental technique used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
Below will with embodiment, the present invention is described in detail, but these embodiments not limitation of the present invention.
The acquisition of embodiment 1, IAA10 albumen and its encoding gene
First, the acquisition of IAA10 albumen and its encoding gene
The structure used kit in paddy rice library is HybriZAP-2.1Two-HybridPredigested
Vector/GigapackCloning Kit (Stratagene), library construction and screening technique are carried out according to specification.It is used
It is identical that bait clone pGBK-S2 announces clone with patent No. ZL200510114386.X.Used yeast bacterial strain is
AH109.Through sequencing and sequence analysis, determine the protein fragments of its coding has sequence table to the positive colony that screening is obtained
91-280 amino acid of the amino acid sequence shown in middle sequence 1, by the full length protein (i.e. the corresponding albumen of sequence 1) life
Entitled IAA10, its encoding gene is the nucleotides in sequence table shown in sequence 2, is named as IAA10.
2nd, the acquisition of the clone of IAA10 full length sequences and the recombinant vector containing the fragment
Primer, and restriction enzyme site and protection base needed for primer two ends add are designed according to sequence 2, primer sequence is
IAA10-5'BamHI：5 '-GTGGATCCAAATGAGAGGAGGAGTAGCTGG-3 ', IAA10-3'XhoI：
5’-GCCTCGAGTCAGGATCTGCCTCTTGTTG-3’。
According to specification, 11 paddy rice (Oryza sativa are spent in being extracted with the TRIzol Reagent of Invitrogen companies
L.japonica cv.Zhonghua 11, Xu Yu etc.《" in spend 11 " Rice Glutelin Gt1 gene clonings and waxy gene start
The structure of son guiding Gt1 expression vectors》, Shanghai Normal University's journal (natural science edition), April in 2010
The phase of volume 39 the 2nd, page 204, the public can obtain from Peking University) total serum IgE, the SuperScript II with the said firm are inverse
Transcriptase carries out reverse transcription, obtains cDNA.Reverse transcription the primer is 16 Oligod of nucleotides (T) primers.
With reverse transcription gained cDNA as template, with above-mentioned gene-specific primer IAA10-5'BamHI and
IAA10-3'XhoI enters performing PCR (Polymerase Chain Reaction) reaction, obtains the PCR primer of 861bp, should
PCR primer has the nucleotides shown in sequence 2 in sequence table.
Digestion is carried out with restriction enzyme BamHI and XhoI after reclaiming PCR primer, 851bp is reclaimed and is carried cohesive end
PCR primer；By carrier pGADT7 (Clontech companies, catalog number：630442) restriction enzyme is used
EcoRI and Sal I double digestions, reclaim 7987bp carrier frameworks；By above-mentioned 851bp with cohesive end PCR primer with
7987bp carrier frameworks T4Ligase is connected, and converts coli strain DH5 α, obtains transformant.Extract transformant
Plasmid send to sequencing, the plasmid is by the gene IAA10 insertion vectors pGADT7 shown in sequence in sequence table 2
The carrier obtained between BamHI and XhoI restriction enzyme sites, pGAD-IAA10, as recombinant vector are named as by the plasmid.
Embodiment 2, the external interaction for proving IAA10 albumen and RDV P2
First, yeast two-hybrid assay proves the interaction of IAA10 and RDV P2
(S2 is the coding base of RDV P2 albumen to the recombinant vector pGAD-IAA10 that embodiment 1 is obtained and pGBK-S2
Cause, the encoding gene of RDV P2 albumen imports what is obtained in pGBK.The non-patent literature of the carrier is recorded for Zhu et al.,
2005.The Rice Dwarf Virus P2Proteininteracts with ent-Kaurene Oxidases in vivo,leading
to reduced biosynthesis of Gibberellins andrice dwarf symptoms.Plant Physiology.
139:1935-1945；The public can obtain from Peking University) cotransformation yeast strain AH109 (Clontech companies are purchased from,
Catalog number is that 630444), yeast conversion method is using known PEG/LiAc methods；Yeast cells after conversion is applied
Cloth auxotroph flat board SD/-Trp-Leu, cultivates 2 days under the conditions of 30 DEG C.Transformant rule to
SD/-Trp-Leu-His-Ade auxotroph flat boards, 30 DEG C are cultivated 4 days, observe the growing state of transformant.The experiment
Simultaneously set negative control pGADT7 (catalog number as：630442) with pGBK-S2, pGAD-IAA10 and pGBK
(being 630443 purchased from Clontech Products catalog number (Cat.No.)).
Result (A as shown in Figure 1：PGAD-SV40T and pGBK-P53 (positive control)；B：pGAD-IAA10
And pGBK-S2；C：PGAD-IAA10 and pGBK；D：PGAD and pGBK-S2；E：PGAD-SV40T and
PGBK-Lam (negative control)).Result proves that IAA10 full-length proteins can interact with RDVP2 in yeast.
2nd, co-immunoprecipitation experiment proves the interaction of IAA10 and RDV P2
1) structure of pCambia1301-FLAGIAA10 and pCambia1301-HAS2 clones
The structure of pCambia1301-FlagIAA10 carriers：With pGAD-IAA10 as template, with primers F lagIAA10-5'SalI
(sequence is:
5’-CCGTCGACATGGACTACAAGGACGACGATGACAAGATGAGAGGAGGAGTAGC
TG-3 ') and IAA10-3 ' BamHI (sequence is：5’-GCGGATCCTCAGGATCTGCCTCTTGTTG-3’)
Enter performing PCR amplification, obtain the PCR primer of 883bp.By above-mentioned PCR primer SalI and BamHI double digestions, reclaim
Digestion products, connect with the carrier framework of the 3852bp by same digestion pRTL2 plasmids, obtain recombinant plasmid
PRTL2-FLAGIAA10, by sequencing, recombinant plasmid pRTL2-FLAGIAA10 is to insert FLAG-IAA10
The carrier obtained between SalI the and BamHI restriction enzyme sites of pRTL2 plasmids.
Then by pRTL2-FLAGIAA10 HindIII single endonuclease digestions, the digestion products of 1985bp are obtained, reclaim digestion products,
With with the pCambia1301 plasmids of same enzyme digestion (referring to Zhu et al., 2005.The Rice Dwarf Virus P2
Proteininteracts with ent-Kaurene Oxidases in vivo,leading to reduced biosynthesis of
Gibberellins andrice dwarf symptoms.Plant Physiology.139:The 1935-1945. public can be big from Beijing
Learn and obtain), the carrier framework connection of 11837bp is obtained, obtain recombinant vector pCambia1301-FlagIAA10 (HindIII
Single endonuclease digestion, it is the positive to obtain the digestion products of 1985bp).
(non-patent literature for recording the carrier is pCambia1301-HAS2：Zhu et al.,2005.The Rice Dwarf
Virus P2Proteininteracts with ent-Kaurene Oxidases in vivo,leading to reduced
biosynthesis of Gibberellins andrice dwarf symptoms.Plant Physiology.139:1935-1945；It is public
Crowd can obtain from Peking University), it is to be built into HAS2 (HAP2 be in P2 albumen upper bands HA labels)
pCambia1301。
PCambia1301-FLAGIAA10 and pCambia1301-HAS2 convert Agrobacterium EHA105 respectively, and method for transformation is
Known electric shock transformation method, obtain EHA105/pCambia1301-FLAGIAA10 and
EHA105/pCambia1301-HAS2。
2) expression of HAP2 and FLAGIAA10 in tobacco
Difference picking EHA105/pCambia1301-FLAGIAA10 and EHA105/pCambia1301-HAS2 single bacterium
Fall, access 2ml LB fluid nutrient mediums (containing Kanamycin 100mg/L, Rifampicin 50mg/L), 28 DEG C
Shaken cultivation 16hr (hr is writing a Chinese character in simplified form for hour hour).1:50 transfer (contains into 10ml LB fluid nutrient mediums
Kanamycin 100mg/L, Rifampicin50mg/L), continue to cultivate to OD600About 0.8.4000rpm(rpm
It is rotating speed per minute) centrifugation 5min (min is minute) receipts bacterium.AS buffer (10mM MES, 150 μM of AS,
10mM MgCl2) resuspended, adjust OD600To 1.0.
By two kinds of bacterium solutions with 1:1 (volume) mixes, and (recording should to inject tobacco N.benthamiana by pressure injection method
The non-patent literature of tobacco is Zhu et al., 2005.The Rice Dwarf Virus P2Proteininteracts with
ent-Kaurene Oxidases in vivo,leading to reduced biosynthesis of Gibberellins andrice dwarf
symptoms.Plant Physiology.139:The 1935-1945. public can obtain from Peking University) and individually take two kinds
Bacteria suspension is used as negative control by pressure injection method injection tobacco.After tobacco continued growth 3 days, the blade of injection is put
The grind into powder in liquid nitrogen.
3) co-immunoprecipitation experiment
Take during the above-mentioned blade powder of about 500mg adds 1.5ml centrifuge tubes, add 1ml IP Buffer (150mM NaCl,
50mM Tris-Cl (pH7.5), 0.1%NP-40,5mM DTT, 1 protease inhibitors (Protease is added per 50ml
Inhibitor Cocktail Tablets,EDTA-free；Roche), 4 DEG C after mixing, 12000rpm centrifugation 10min,
Supernatant is suctioned out and is transferred in new centrifuge tube.Above face pelleted by centrifugation 5min, supernatant sucking-off is transferred to new again
In centrifuge tube, prevent from being drawn onto precipitation, obtain tobacco protein extract.
Added in the tobacco protein extract obtained in above-mentioned steps 20 μ lprotein G beads (GE healthcare,
17-0618-06), while adding 0.2 μ l FLAG antibody (Sigma, F3165), 4 DEG C of incubation 1.5hr.4 DEG C, 1000rpm
Centrifugation 1min, sops up supernatant.Washed beads3 times with IP Buffer.Add 50 μ l 3 × protein sample buffer
(125mM Tris-Cl (pH6.8), 20% glycerine, 6%SDS, 0.004% bromophenol blue, 30mM DTT), 95 DEG C
Heating 5min, drawing supernatant carries out SDS-PAGE.
SDS-PAGE and Western Blot are carried out according to known method and product description.Antibody used is
Anti-FLAG-HRP (sigma) and anti-HA-Peroxidase (Roche).
Result is as shown in Fig. 2 show to be said by FLAGIAA10 and HAP2 while precipitate with FLAG antibody
The interphase interaction of bright both albumen.
Embodiment 3, P2 can weaken the degraded of IAA10
First, the expression of expression cloning structure and albumen
With pGAD-IAA10 plasmids as template, with IAA10-5'SalI, (sequence is：
(sequence is for 5 '-GTGTCGACATGAGAGGAGGAGTAGCTGG-3 ' and IAA10-3'HindIII：
5 '-GCAAGCTTTCAGGATCTGCCTCTTGTTG-3 ') enter performing PCR amplification, obtain the PCR primer of 859bp.By this 859bp
PCR primer with SalI and HindIII double digestions after, gel electrophoresis reclaim 853bp digestion products；By pMAL-p2x matter
Grain (New England Biolabs, E8000S, expression MBP albumen itself) SalI and HindIII double digestions, gel
Electrophoresis reclaims the carrier framework of 6703bp；The carrier framework of the digestion products of 853bp and 6713bp is connected with T4DNA
Enzyme is connected, and obtains recombinant vector pMAL-p2x-IAA10, and by sequencing, the recombinant vector is by sequence 2 in sequence table
The carrier obtained between SalI the and HindIII restriction enzyme sites of shown DNA molecular insertion pMAL-p2x, is named as
pMAL-p2x-IAA10。
PMAL-p2x-IAA10 and pMAL-p2x plasmids are converted into prokaryotic expression bacterial strain Rosetta (DE3) respectively：Take
0.5 μ l plasmids, add in 50 μ l competent cells, stand 30min after mixing on ice；42 DEG C of heat shock 90sec, add
1ml fresh LBs, 37 DEG C of shaken cultivation 1hr；3000rpm is centrifuged 2min collects thallines, and coating LB puts down
Plate (Ampicillin containing 100mg/L), (SalI and HindIII is double to obtain Rosetta (DE3)/pMAL-p2x-IAA10
Digestion identifies that the digestion products for obtaining 853bp are the positive) and Rosetta (DE3)/pMAL-p2x.
Rosetta (DE3)/pMAL-p2x-IAA10 is chosen respectively and Rosetta (DE3)/pMAL-p2x single bacterium colonies are connected to
In 5ml LB culture mediums (Ampicillin containing 100mg/L), 37 DEG C of incubated overnights.1:200 transfer in 300ml LB trainings
(Ampicillin containing 100mg/L) is cultivated to OD600 and is about 0.6 in foster base.IPTG is added to final concentration 1mM,
Induced expression 4hr, obtains Rosetta (DE3)/pMAL-p2x-IAA10 bacterium solutions and Rosetta (DE3)/pMAL-p2x
Bacterium solution.5000rpm is centrifuged 10min collects thallines.Add 5ml cross post buffer solution (20mM Tris-Cl pH7.5,
100mM NaCl, 0.1%NP-40,1mM DTT, 0.01M PMSF) suspension thalline, ultrasonication.4 DEG C,
12000rpm, is centrifuged 20min, takes supernatant and is added to and crosses the washed Amylose Resin of post buffer solution with 8 times of volumes
Column is pushed up, and it is slowly flowed through cylinder.Post buffer solution is crossed with 12 times of volumes to wash.With containing 10mM maltose
Cross the albumen of post buffer solution elution purifying.The concentration (Bio-Rad) of albumen, regulation to 4mg are determined with Bradford methods
/ml。
2nd, degradation experiments of the MBP-IAA10 in paddy rice total protein extract
The susceptible paddy rice of RDV and healthy paddy rice grind into powder in liquid nitrogen, add appropriate external degradation buffer solution (25mM
Tris-HCl, pH7.5,10mM NACl, 10mM MgCl2,4mM PMSF, 5mM DTT, 10mM
ATP) suspend.4 DEG C, supernatant is suctioned out and is placed in new centrifuge tube by 12000rpm centrifugation 10min.Centrifugation again is gone
Fall precipitation.Bradford methods determine protein concentration, regulation to same concentrations.In the 490 susceptible paddy rice of μ lRDV and healthy water
The MBP-IAA10 albumen or 10 μ lMBP albumen of 10 μ l purifying are separately added into rice protein extract.Incubation at room temperature.
In 0min, the separately sampled 40 μ l of 5min, 15min, 30min, 60min, 120min add 20 3 × protein of μ l
Samplebuffer, 100 DEG C of heating 5min, taking 10 μ l carries out SDS-PAGE.According to pre-dyed Marker pillar locations, will
Glue is divided into three parts, and molecular weight the best part (more than 95kDa) is used for Western blot and detects P2 albumen, middle
Partly (95kDa~72kDa) is used for Weestrn blot detection MBP-IAA10, the minimum part (72kDa of molecular weight
The amount of paddy rice total protein is detected with coomassie brilliant blue staining below).
After result is as shown in figure 3, incubate 60min, the MBP-IAA10 albumen in healthy paddy rice total protein extract is
Can't detect, and the MBP-IAA10 albumen incubated with the susceptible paddy rice total proteins of RDV is when 120min
Also a certain amount of residual.Show that stability of the MBP-IAA10 in the susceptible paddy rice total protein extracts of RDV is substantially high
In its stability in healthy paddy rice total protein extract in other words MBP-IAA10 in the susceptible paddy rice total proteins of RDV
Degradation speed in extract is substantially slower than in healthy paddy rice total protein extract.Experimental result from MBP groups can
Go out, MBP albumen is stable existence in the system, and its amount does not change with time and changes, explanation
The degraded property of MBP-IAA10 albumen is that IAA10 albumen therein is assigned, accordingly, it can be said that MBP-IAA10
Degraded represents the degraded of IAA10.
To sum up, RDV can weaken the degraded of P2.
3rd, degradation experiments of the MBP-IAA10 in tobacco total protein extract
According to 2, two, 2) in method, injected in tobacco leaf respectively by Agrobacterium injection and contained
The Agrobacterium of pCambai1301vector or pCambaia1301-HAS2, expresses corresponding albumen.By above-mentioned blade difference
The grind into powder in liquid nitrogen, adds appropriate external degradation buffer solution (25mM Tris-HCl, pH7.5,10mM
NACl, 10mM MgCl2,4mM PMSF, 5mM DTT, 10mM ATP) suspend.4 DEG C, 12000rpm
Centrifugation 10min, supernatant is suctioned out and is placed in new centrifuge tube.Precipitation is removed in centrifugation again.Bradford methods determine albumen
Concentration, regulation to same concentrations.10 μ l are separately added into 490 μ l contain HAP2's and control tobacco protein extract
The MBP-IAA10 albumen of purifying or 10 μ lMBP albumen.4 DEG C of incubations.In 0min, 20min, 40min, 80min,
The separately sampled 40 μ l of 180min, add 20 μ 3 × protein of l samplebuffer, 100 DEG C of heating 5min, and taking 10 μ l is carried out
SDS-PAGE.According to pre-dyed Marker pillar locations, glue is divided into three parts, molecular weight the best part (95kDa
More than) it is used for Western blot detection P2 albumen, center section (95kDa~72kDa) is detected for Weestrn blot
Paddy rice total protein is detected with coomassie brilliant blue staining in MBP-IAA10, the minimum part (below 72kDa) of molecular weight
Amount.
After result is as shown in figure 4, incubate 180min, the MBP-IAA10 albumen in control group tobacco total protein extract is
After testing less than, and with the MBP-IAA10 albumen that is incubated of tobacco total protein of expression P2 also have 60% it is residual
Stay.Show that stability of the MBP-IAA10 in the tobacco total protein extract containing HAP2 is being free of apparently higher than it
Stability in the tobacco total protein extract of HAP2 MBP-IAA10 degradation speeds in the presence of P2 in other words
Substantially than no P2 in the case of degradation speed it is slow.MBP albumen is can be seen that in the body from the experimental result of MBP groups
It is stable existence in system, its amount does not change with time and changes, illustrates the degraded property of MBP-IAA10 albumen
It is that IAA10 albumen therein is assigned, accordingly, it can be said that the degraded of MBP-IAA10 represents the degraded of IAA10.
To sum up, P2 can block the degraded of IAA10.
Embodiment 4, IAA10 overexpressions can improve sensitiveness of the paddy rice to RDV, and IAA10RNAi can improve paddy rice pair
The resistance of RDV
First, the structure of expression vector
1) pCambia1301-FLAGIAA10 build see embodiment 2, two, 1)
2) pCambia2300-actin-IAA10RNAi builds：With pGAD-IAA10 as masterplate, IAA10-5'SpeI
(sequence is：5 '-GTACTAGTATGAGAGGAGGAGTAGCTGG-3 ' and IAA10-3'BglII (sequences
It is classified as：5 '-GCAGATCTTCAGGATCTGCCTCTTGTTG-3 ') enter performing PCR amplification, obtain 859bp's
PCR primer.The PCR primer SpeI and BglII double digestions are connected into XbalI and BamHI (and SpeI and BglII
It is isocaudarner) (Wei Mingkaituo companies give, and the public can obtain from Peking University for the intermediate carrier pUCCRNAi of digestion
) on, by sequencing, recombinant plasmid pUCC-IAA10 be by IAA10 insertion pUCCRNAi plasmids XbalI and
The carrier obtained between BamHI restriction enzyme sites.To be connected into SpeI with the PCR primer of SpeI and BglII double digestions again and
BglII double digestions are crossed in pUCC-IAA10 plasmids, obtain pUCC-IAA10RNAi carriers.By sequencing, matter is recombinated
Grain pUCC-IAA10RNAi is the XbalI and BamHI that IAA10 is inserted pUCCRNAi plasmids in reverse complemental form
The carrier obtained between restriction enzyme site and SpeI and BglII restriction enzyme sites.
PUCC-IAA10RNAi carriers PstI single endonuclease digestions, Ago-Gel are reclaimed and obtain 1939bp digestion products,
The product is connected on the pCambia2300-Actin1-ocs carrier frameworks of the 10379bp obtained with PstI single endonuclease digestions, is obtained
To recombinant vector pCambia2300-actin-IAA10RNAi.
2nd, overexpression turns the acquisition of RING1 paddy rice
1) Fiber differentiation of callus
In spend 11 paddy rice (hereinafter also referred to wild rice) seed to shell, first with 70% ethanol soak 10min,
Again 30min is soaked with 0.1% mercuric chloride；Carry out surface degerming.The solution of the surface of the seed is washed away with a large amount of sterilized waters, with nothing
Bacterium filter paper sucks the moisture of the surface of the seed.Seed is placed on mature embryo calli induction media flat board, Parafilm is used
Membrane closure plate edge, in lucifuge culture in 26 DEG C of incubators.After about 15 days, the callus for growing carefully is removed,
It is transferred on mature embryo subculture medium, similarity condition proceeds culture.Need to carry out a squamous subculture every two weeks.
During for converting, squamous subculture 5 days or so need to be selected, in flaxen graininess callus.
2) culture of Agrobacterium
PCambia1301-FLAGIAA10 and pCambia2300-actin-IAA10RNAi electricity is transferred to Agrobacterium
In EHA105, obtain recombinant bacterium EHA105/pCambia1301-FLAGIAA10 and
EHA105/pCambia2300-actin-IAA10RNAi。
By EHA105/pCambia1301-FLAGIAA10 and EHA105/pCambia2300-actin-IAA10RNAi
In the flat lining outs of LB containing antibiotic (50mg/L Kanamycin, 50mg/L Rifampicin), 28 DEG C of cultures
2 days.Picking single bacterium colony is accessed in LB liquid medium, 28 DEG C of shaken cultivations to OD600About 0.5, add acetyl cloves
Ketone obtains the Agrobacterium suspension for rice transformation callus to final concentration 100mM.
3) co-cultivation of Rice Callus and Agrobacterium
Subcultured callus are put into sterilized conical flask, Agrobacterium suspension are poured into and is allowed to submerge callus.Room
Temperature places 20min, and gently rocking frequently makes callus be fully contacted with bacterium solution.Gently taken out with aseptic tweezers
Callus, is put on aseptic filter paper and sucks unnecessary bacterium solution, is transferred to the co-cultivation culture for being covered with one layer of aseptic filter paper
On base flat board.28 DEG C of light cultures 3 days, obtain the callus by co-culturing.
4) screening of resistant calli and differentiation
To be cleaned with appropriate amounts of sterilized water by the callus for co-culturing, remove the Agrobacterium of surface residual, be placed on screening
On culture medium, 26 DEG C of lucifuge cultures are screened, and are transferred to after two weeks on new screening and culturing medium and are continued to screen two weeks.
Select by the preferable callus of state after two-wheeled screening, be transferred on differential medium flat board, first lucifuge training
Support 3 days, (15hr/day) carries out illumination cultivation during illumination box is then gone to again.It is visible after one month to differentiate
Seedling.When differentiation seedling it is long to about 2cm when, be transferred on the root media in conical flask, continue train
Support two weeks or so.Selection growing way is preferable, the seedling of well developed root system, is transplanted into after the culture medium that root is washed away with running water
In soil, seed is collected, obtain T1In generation, turns FLAGIAA10 and IAA0RNAi rice paddy seeds, and sowing obtains T1Generation
Turn FLAGIAA10 and IAA0RNAi paddy rice.
T1By hygromycin or G418 preliminary screenings, (pCambia1301 carriers carry hygromycin resistance to the rice paddy seed in generation
Screening-gene, pCambia2300 carriers carry G418 resistance screenings gene), the seed of germination shows that carrier is transferred to
Paddy rice.During the seed kind of germination is buried, after growing 2 weeks, 0.1g blades are taken, clayed into power with liquid nitrogen.
Protein extract buffer (0.25M is added in the blade powder of the transgenic paddy rice strain of IAA10 overexpressions
Tris-Hcl, pH6.8,8%SDS, 8% beta -mercaptoethanol, 20% glycerine) 200 μ l, 10min, 100 DEG C are incubated on ice
10min is boiled, 4 DEG C, supernatant is taken after 12000rpm centrifugations 10min, carry out SDS-PAGE, Western is used after transferring film
Detection.SDS-PAGE and Western Blot are carried out according to known method and product description.Antibody used is
Anti-FLAG-HRP (sigma), detects paddy rice patio Actin albumen, as internal reference with antibody anti-Actin.Such as
Fig. 5, person is the positive at 41KDa to occur band, shows that gene is transferred to and protein expression, selects three strain #7,
#12 and #20 be used for after disease-resistant analysis experiment (in figure "-" be wild type in spend 11 paddy rice, as negative control；
"+" extracts albumen by pCambia1301-FlagIAA10 transient expression tobacco-containing materials, as positive control).
Trizol (Invitrogen) is added in the blade powder of the transgenic paddy rice strain of RNAi, it is described to specifications
Method extracts RNA.Afterwards, according to table 1 below, with RQ1Dnase (Promega, article No.：M610A) to RNA
In genomic DNA digested：
Table 1 is digestion system
Then taking the postdigestive RNA of 2ug carries out reverse transcription, and specific method is referring to invitrogen M-MLV Reverse
Transcriptase (article No.s：28025-021).The cDNA for obtaining will be inverted and dilute 10 times, taking 4 μ l carries out Quantitative
Real-time PCR react, and primer is qIAA10F:5 '-GGTTGCTGGATGGGTGAAGG-3 ' and
qIAA10R:5’-CCTGTCCTCGTAGGTGAGCTGG-3’.Reaction total system is 20 μ l, according to SYBR
Green Real-Time PCR Master Mix (TOYOBO) specification is prepared.
Using OsEF1a as internal reference, the primer of internal reference is R10：5’-CTTCCTCTGCGCTTGAGGTG-3’
And F12：5 '-ACATTGCCGTCAAGTTTGCTG-3 ' are (referring to Zhu et al., 2005.The Rice Dwarf
Virus P2Proteininteracts with ent-Kaurene Oxidases in vivo,leading to reduced
biosynthesis of Gibberellins andrice dwarf symptoms.Plant Physiology.139:1935-1945.)。
Part strain Real-time PCR qualification results are as shown in Figure 6.Most of IAA10RNAi (is saving in figure
Space, is abbreviated as Ii), the transcriptional level of IAA10 is lowered in transgenic line, is positive seedling.Selection
IAA10RNAi-1-2 (Ii-1-2), IAA10RNAi-5-1 (Ii-5-1) and three strains of IAA10RNAi-10 (Ii-10-1)
Carry out follow-up infecting experiment.
3rd, IAA10 overexpressions can improve sensitiveness of the paddy rice to RDV, and IAA10RNAi can improve paddy rice to RDV's
Resistance
1) expression of RDVS2 is identified by RT-PCR to identify infecting for RDV
With carrying RDV (referring to Zhu et al., 2005.The Rice Dwarf Virus P2Proteininteracts with
ent-Kaurene Oxidases in vivo,leading to reduced biosynthesis of Gibberellins andrice dwarf
symptoms.Plant Physiology.139:The 1935-1945. public can obtain from Peking University.) leafhopper (pathogen
It is fractilinea oryzae (Rice Dwarf Virus)) inoculation T1In generation, turns IAA10 overexpressions and RNAi transgenosis water
11 are spent in rice and wild rice, every kind of paddy rice is inoculated with 20 plants, and 30 degree of daytime, 22 degree of evening, humidity 60% is trained
Support, every plant connects 5 head lobe cicada, sting food and catch out leafhopper after three days, sting the paddy rice for eating and cultivated in sun glasshouse (certainly
Right light, temperature.Experiment is repeated 3 times, results averaged).
After connecing malicious 4 weeks, 20 plants of T are extracted1In generation, turns IAA10 overexpressions, 20 plants of RNAi transgenic paddy rices and 20
11 total serum IgEs are spent in strain wild rice, afterwards, according to table 1, with RQ1Dnase (Promega, article No.：M610A)
Genomic DNA in RNA is digested, then taking the postdigestive RNA of 2ug carries out reverse transcription and sxemiquantitative
PCR, specific method is referring to invitrogen M-MLV Reverse Transcriptase (article No.s：28025-021), expand
Volume increase thing is the coded sequence S2 of RDV P2 Partial Proteins；The primer for wherein using is：
RDVS2F1946:CTATACCACGATGAAGGCCT and RDVS2R2446:
TAATGGTACCGATGGTTACC.Obtain 500bp size strips is the infection RDV positives, and no is
Infection RDV is negative.
Using OsEF1a as internal reference, the primer of internal reference is R10：5’-CTTCCTCTGCGCTTGAGGTG-3’
And F12：5 '-ACATTGCCGTCAAGTTTGCTG-3 ' are (referring to Zhu et al., 2005.The Rice Dwarf
Virus P2Proteininteracts with ent-Kaurene Oxidases in vivo,leading to reduced
biosynthesis of Gibberellins andrice dwarf symptoms.Plant Physiology.139:1935-1945.)。
Result is as shown in Figure 7, it can be seen that 20 plants of IAA10 overexpressions T1 obtain 500bp's for there is 15 plants of amplifications in paddy rice
S2；There is S2 of 4 plants of amplifications to 500bp in 20 plants of IAA10RNAi transgenic paddy rices；Spent in 11 in 20 plants of wild rices
There are 10 plants to expand the S2 for obtaining 500bp；IAA10 overexpressions can improve sensitiveness of the paddy rice to RDV, IAA10
RNAi can improve resistance of the paddy rice to RDV.
2) RDV infection rates are determined by phenotype
After connecing malicious 4 weeks, 20 plants of T are observed1In generation, turns IAA10 overexpressions, 20 plants of RNAi transgenic paddy rices and 20
Spent in strain wild rice 11 symptom (wherein infect RDV viruses for plant stunts, leaf color is dark green, and blade is stiff
Firmly, occurs white dot on blade or leaf sheath and arranged in parallel with vein into dotted line shape, without infection RDV viruses
To occur without white dot on blade or leaf sheath), statistics has a symptom plant number, calculate the malicious rate of band=(have phenotype strain number/
Total strain number) * %.
Result statistics such as table 2 below：
Table 2 is the transgenic paddy rice malicious rate statistics of the band after virus infection
As can be seen that IAA10 overexpression paddy rice susceptible genes are higher, and IAA10RNAi paddy rice susceptible gene is relatively
It is low.In addition, we are taken pictures to the susceptible paddy rice of different strains, as shown in figure 8, being good for infect latter 4 weeks
The susceptible symptom figure of health, IAA10 overexpressions and IAA10RNAi transgenic paddy rices.As can be seen that IAA10 mistakes
The susceptible symptom of paddy rice for measuring expression is stronger, shows as that dwarf degree is stronger, and the amount of speckle of virus accumulation is represented on blade
It is more；And the susceptible symptom of the transgenic paddy rice of IAA10RNAi is then relatively weaker, dwarf degree is shown as relatively wild
Raw type is weaker, and Lesion number is less, and (Fig. 8, WT spends 11 paddy rice in representing wild type in figure, and IAA10oe is represented
IAA10 overexpression transgenic paddy rices, IAA10i represents the transgenic paddy rice of IAA10RNAi).With wild rice
Compare, IAA10 overexpression transgenic paddy rices are more susceptible, and IAA10RNAi transgenic paddy rices are more disease-resistant.
Claims (10)
1. it is used to regulate and control the protein I AA10 of Genes For Plant Tolerance rice dwarf virus disease, the albumen is：
(A) there is the albumen of the amino acid sequence shown in the sequence 1 in sequence table；
(B) include thering is more than 95% with the amino acid sequence shown in sequence 1, preferably more than 98% homogeneity
Amino acid sequence and with the albumen to fractilinea oryzae resistance.
2. the gene of the encoding proteins IAA10 for being used to regulating and controlling Genes For Plant Tolerance rice dwarf virus disease, the gene is：
(A) there is the DNA molecular of the base sequence shown in the sequence 2 in sequence table；
(B) DNA molecular of albumen of the coding with the amino acid sequence shown in the sequence 1 in sequence table；
(C) DNA molecular of encoding proteins, the albumen is to include having with the amino acid sequence shown in sequence 1
More than 95%, the amino acid sequence of preferably more than 98% homogeneity and with the albumen to fractilinea oryzae resistance.
3. the RNAi carrier of the gene described in claim 2.
4. RNAi carrier according to claim 3, described in its claim 2 for containing reverse complemental form
Gene.
5. gene described in the protein I AA10 or claim 2 described in claim 1 or the institute of claim 3 or 4
The RNAi carrier stated is improving plant to the application in fractilinea oryzae resistance.
6. application according to claim 5, wherein the plant is monocotyledon or dicotyledon, preferably
It is paddy rice.
7. a kind of method for cultivating genetically modified plants, comprises the following steps：By the channel genes mesh described in claim 2
Plant in, obtain genetically modified plants, the rice dwarf virus disease resistance of the genetically modified plants is less than the purpose plant；
Or the gene described in claim 2 is transferred in purpose plant in hairpin structure form, obtain its RNAi turns base
Because of plant, the rice dwarf virus disease resistance of the genetically modified plants is higher than the purpose plant.
8. method according to claim 7, it is characterised in that：The cause of disease of the rice dwarf virus disease is that paddy rice is short
Contracting is viral (Rice Dwarf Virus).
9. the method according to claim 7 or 8, it is characterised in that：The gene is imported by recombinant vector
Purpose plant or the genetically modified plants or other knockout genetically modified plants of the gene IAA10 gene silencings；
The recombinant vector is that the encoding gene of the protein I AA10 is inserted the recombinant vector obtained in expression vector；
The recombinant vector is to be obtained in hairpin structure form insertion expression vector by the encoding gene of the gene IAA10
RNAi carrier.
10. the method according to any one of claim 7-9, it is characterised in that：The plant is planted for unifacial leaf
Thing or dicotyledon, preferably paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510882608.6A CN106831967B (en) | 2015-12-03 | 2015-12-03 | Application of reducing IAA10 protein and coding gene expression thereof in improving resistance of plants to rice dwarf virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510882608.6A CN106831967B (en) | 2015-12-03 | 2015-12-03 | Application of reducing IAA10 protein and coding gene expression thereof in improving resistance of plants to rice dwarf virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106831967A true CN106831967A (en) | 2017-06-13 |
| CN106831967B CN106831967B (en) | 2020-08-04 |
Family
ID=59149731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510882608.6A Active CN106831967B (en) | 2015-12-03 | 2015-12-03 | Application of reducing IAA10 protein and coding gene expression thereof in improving resistance of plants to rice dwarf virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106831967B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111253480A (en) * | 2020-03-04 | 2020-06-09 | 宁波大学 | Rice transcription factor OsARF17 gene and application thereof in black-streaked dwarf virus resistant plant breeding |
| CN112390866A (en) * | 2019-08-14 | 2021-02-23 | 北京大学 | Application of OsARF12 gene in improving resistance of rice to rice dwarf virus |
| CN114958906A (en) * | 2022-06-22 | 2022-08-30 | 贵州省烟草公司毕节市公司 | Gene related to low potassium stress of tobacco, promoter and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102224247A (en) * | 2008-09-24 | 2011-10-19 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and a method for making the same |
| CN103194431A (en) * | 2013-04-17 | 2013-07-10 | 北京大学 | Application of RING1 protein for improving RDV (rice dwarf virus) resistance of plants |
-
2015
- 2015-12-03 CN CN201510882608.6A patent/CN106831967B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102224247A (en) * | 2008-09-24 | 2011-10-19 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and a method for making the same |
| CN103194431A (en) * | 2013-04-17 | 2013-07-10 | 北京大学 | Application of RING1 protein for improving RDV (rice dwarf virus) resistance of plants |
Non-Patent Citations (2)
| Title |
|---|
| LIANG YANG 等: "Transcriptome profiling confirmed correlations between symptoms and transcriptional changes in RDV infected rice and revealed nucleolus as a possible target of RDV manipulation", 《VIROLOGY JOURNAL》 * |
| 吴建国 等: "水稻矮缩病毒对3种内源激素含量及代谢相关基因转录水平的影响", 《植物病理学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112390866A (en) * | 2019-08-14 | 2021-02-23 | 北京大学 | Application of OsARF12 gene in improving resistance of rice to rice dwarf virus |
| CN111253480A (en) * | 2020-03-04 | 2020-06-09 | 宁波大学 | Rice transcription factor OsARF17 gene and application thereof in black-streaked dwarf virus resistant plant breeding |
| CN114958906A (en) * | 2022-06-22 | 2022-08-30 | 贵州省烟草公司毕节市公司 | Gene related to low potassium stress of tobacco, promoter and application thereof |
| CN114958906B (en) * | 2022-06-22 | 2023-08-08 | 贵州省烟草公司毕节市公司 | Gene and promoter related to low potassium stress of tobacco and application of gene and promoter |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106831967B (en) | 2020-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102485897B (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN104480119B (en) | Plant salt stress inducible gene OsSIR1 and its encoding proteins and application | |
| Bello et al. | Cloning of Gossypium hirsutum sucrose non-fermenting 1-related protein kinase 2 gene (GhSnRK2) and its overexpression in transgenic Arabidopsis escalates drought and low temperature tolerance | |
| CN110117320A (en) | Cotton GhCAL-D07 gene is promoting the application in flowering of plant | |
| Sun et al. | Sensitivity of translation initiation factor eIF1 as a molecular target of salt toxicity to sodic-alkaline stress in the halophytic grass Leymus chinensis | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN105420245A (en) | Salt-stress induced gene OsEAR1 of plants and encoding protein and application thereof | |
| CN106831967A (en) | Reduce IAA10 albumen and its encoding gene expression is improving plant to the application in fractilinea oryzae resistance | |
| CN110283829B (en) | Intermediate complex subunit OsMEDdicator 16 gene for regulating rice blast resistance | |
| CN102242136B (en) | Gene influencing root system development and yield of rice and application of gene | |
| CN103421813A (en) | Application of SN1 gene in controlling high temperature resistance and drought resistance of rice | |
| CN109182351A (en) | Barley HvALS1 gene and application thereof | |
| CN105755020A (en) | Radix notoginseng mitogen-activated protein kinase kinase gene PnMAPKK1 and application thereof | |
| CN103194431B (en) | Application of RING1 protein for improving RDV (rice dwarf virus) resistance of plants | |
| CN105349505B (en) | A kind of plant drought, protein related to salt tolerance AsSnRK and its encoding gene and application | |
| CN103421809A (en) | Application of OsHSF08 gene in controlling rice drought resistance | |
| CN104087605B (en) | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases | |
| CN103243108B (en) | Calcium ion binding protein derived from stem nodule as well as encoding gene and application thereof | |
| CN102533802A (en) | Tobacco drought response gene NtRHF1 and application of encoding protein thereof | |
| CN105524933A (en) | OsJMJ714 functions of influence on rice grain size and tolerance to salt stress and application of OsJMJ714 | |
| CN109456969A (en) | Brown Planthopper is caused harm inducible promoter and its application | |
| CN105254730B (en) | A kind of albumen improving plant salt tolerance drought tolerance and its encoding gene and application | |
| CN107904238A (en) | Thick boisiana high salt, drought-inducible promoter IpLEA PRO and its application | |
| CN104805093B (en) | Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants | |
| CN103014062A (en) | Rice OsICE1 (Inducer of CBF Expression) gene double-element vector and application method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |