CN102703466B - Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof - Google Patents
Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof Download PDFInfo
- Publication number
- CN102703466B CN102703466B CN 201210135564 CN201210135564A CN102703466B CN 102703466 B CN102703466 B CN 102703466B CN 201210135564 CN201210135564 CN 201210135564 CN 201210135564 A CN201210135564 A CN 201210135564A CN 102703466 B CN102703466 B CN 102703466B
- Authority
- CN
- China
- Prior art keywords
- gene
- tawrky80
- wheat
- salt
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and relates to the cloning of a wheat salt-tolerant and drought-resistant WRKY transcription factor gene TaWRKY80 and application thereof. The invention discloses a wheat salt-tolerant WRKY transcription factor gene TaWRKY80 and application thereof in cultivating salt-tolerant plants. Experiments prove that: the salt tolerance of the transgenic plants is improved. The gene provided by the invention plays an important role in cultivating salt-tolerant plants (especially crops).
Description
Technical field
The invention belongs to gene engineering technology field, relate to wheat salt tolerance, drought resisting WRKY transcription factor gene
TaWRKY80Clone and application thereof.
Background technology
The soil salinization and shortage of water resources are global problems of restriction agriculture production in recent years.Salt damage and arid not only have a strong impact on growth and development of plant, cause crop failure, and make ecotope go from bad to worse (Saibo et al., Annals of Botany, 2009,103 (4): 609-623).Therefore, the drought resisting of raising crop and/or salt resistance ability have become one of key issue of modern crop breeding work urgent need solution.The separating clone resistant gene of salt, cultivating the salt tolerant new variety has become one of global research focus.Wheat is important farm crop, clone's salt tolerant, anti-drought gene, and cultivation salt tolerant, drought resisting new variety of wheat have become when previous very urgent task.
The research that utilizes genetic engineering technique to carry out plant salt tolerance, drought resisting aspect has at present obtained bigger progress.Some experiments show, in gene transferred plant relevant with salt tolerant in plant itself and the other biological, saline-alkaline tolerance that can the render transgenic plant improve (Chinnusamy et al., Crop science, 2005,45:437-448.).
Transcription factor plays crucial regulating and controlling effect in genetic expression and environment-stress response.At present, found that some can significantly improve the transcription factor of plant salt tolerance ability.Studies show that, these gene transformation in plant, can obviously be improved the salt resistance ability (Nakashima K., Plant Physiology, 2009,149:88 – 95.) of plant.
WRKY is a transcription factor family, and the normal growth of its member's wide participation plant is grown and to the response process of various environment-stress.The transgenic research experiment showed expresses salt tolerant and the drought tolerance that some WRKY transcription factor genes can improve transfer-gen plant.Example is expressed soybean excessively
GmWRKY54But the salt tolerant of gene render transgenic Arabidopis thaliana and drought tolerance raising (Zhou et al., Plant Biotechnology Journal, 2008,6,486-503.).With barley
HvWRKY38Change herbage over to and can improve biomass and the drought tolerance (Xiong et al., Molecular Breeding, 2010,25:419 – 432.) of transgenosis herbage.
AtWRKY25, AtWRKY33Cross and express Arabidopis thaliana and also increased tolerance to salt stress.The at present relevant research of wheat WRKY transcription factor aspect salt tolerant is also very limited, and Niu et al studies show that expression
TaWRKY2With
TaWRKY19Can improve salt tolerant and the drought tolerance (Niu et al., Plant cell and environment, 2012) of transgenic arabidopsis.Further clone's wheat salt tolerance, non-irrigated genes involved, by genetically engineered cultivate wheat salt tolerance, drought-enduring new variety are extremely important.
Summary of the invention
The objective of the invention is to, provide the WRKY transcription factor gene of from wheat, isolating a salt tolerant, drought resisting first, called after
TaWRKY80This gene was connected on the expression vector pCAMBIA super 1300, utilizes During Agrobacterium method arabidopsis thaliana transformation, the biomass of the transgenic arabidopsis plant of acquisition, salt tolerance, drought-resistant ability are all than not transgenosis adjoining tree raising.
Technical scheme of the present invention is: the WRKY transcription factor gene of salt tolerant, drought resisting
TaWRKY80The cDNA sequence shown in SEQ ID No.1, aminoacid sequence is shown in SEQ ID No.2.
Wheat salt tolerance of the present invention, anti-drought gene
TaWRKY80The preparation method: at first select the WRKY transcription factor gene (probe) that in the wheat seedling root, is subjected to the remarkable up-regulated expression of salt stress according to the gene chip expression spectral-data of wheat, then according to probe sequence design gene-specific primer, further its full-length cDNA of clone from the full-length cDNA library of wheat root is transformed at last and carries out functional study in the Arabidopis thaliana.
1. design of primers
Downstream primer Wrky2:5 '-CTTAGGGAATTTTGCCACACTCTTTG-3 ' according to chip probe sequences Design gene specific, matching with 5 of library ' end anchor primer NT3:5 '-ACTAAAGggaACAAAAGCTGG AG-3 ', is the full-length cDNA of template amplification gene with the full-length cDNA library of wheat seedling root.
2.PCR reaction system (50 μ L) and program
2×GC bufferⅠ 25μl
Template cDNA library 1ul
dNTPs（10mM each） 1μl
Primer1 (10μM) 1μl
Primer2(10μM) 1μl
LA Taq(TaKaRa) 0.5ul
DdH
2O adds to final volume 50 μ l
94 ℃ of pre-sex change 3min; 94 ℃ of sex change 45sec, 58 ℃ of renaturation 1min, 72 ℃ are extended 2min, circulate 35 times; 72 ℃ are extended 5min.
3.1% agarose gel electrophoresis
Pcr amplification product detects the band (Fig. 1) that clauses and subclauses are found to have at the 1000bp place in the back with 1% agarose gel electrophoresis.
4. the recovery of amplified fragments, with the linking of T carrier
Adopt the agarose gel of Tiangen company to reclaim test kit to amplified band, the step by specification carries out.The PCR product is connected with pGEM-T (Promega) carrier, and linked system is:
The PCR product 7 μ l that reclaim
10 * T4 ligase enzyme damping fluid, 1 μ l
PGEM-T carrier (50ng/ μ l) 1 μ l
T4DNA ligase enzyme (3U/ μ l) is 1 μ l (Takara)
Spend the night in 4 ℃ of refrigerators connections.
5. reclaim clone and the order-checking of fragment
Use CaCl
2Legal system is equipped with escherichia coli DH5a (be epoch biotech firms available from the sky) competent cell, and 42 ℃ of water-bath heat shock methods transform.Cultivate and add X-gal and IPTG in the bacterium liquid of 1h to transforming the back, mixing evenly is coated onto it on flat board that contains penbritin with spreader, and 37 ℃ of constant temperature are inverted overnight incubation, when waiting to occur obvious single bacterium colony flat board is taken out.
According to T7 promotor and the SP6 promoter sequence design universal primer T7 at two ends, used pGEM-T carrier cloning site, the recombinant clone of SP6 carries out PCR to be identified.
PCR program: 94 ℃ of pre-sex change 10min; 94 ℃ of sex change 1min, 58 ℃ of renaturation 1min, 72 ℃ are extended 1min, circulate 35 times; 72 ℃ are extended 5min;
Pcr amplification product detects with 1% agarose electrophoresis, and the bacterium liquid of getting positive colony send company to check order.Sequencing result is seen SEQ ID No.1.
Wheat salt tolerance, anti-drought gene
TaWRKY80Application in cultivating salt tolerant, drought-resistant plant.Especially the application in common wheat, corn and rice plants.
The invention has the beneficial effects as follows: with wheat salt tolerance, anti-drought gene
TaWRKY80Be connected on the expression vector pCAMBIA super 1300, and utilized During Agrobacterium method arabidopsis thaliana transformation, the biomass of the transgenic arabidopsis plant of acquisition, salt tolerance, drought-resistant ability are all than not transgenosis adjoining tree raising.
Description of drawings
Fig. 1:
TaWRKY80The amplification of full length gene cDNA sequence.M:DNA molecular weight marker.
Fig. 2: under the different treatment condition
TaWRKY80Gene melts the RT-PCR expression analysis in No. 3 seedling roots and the leaf on the wheat mountain,
TaActinBe confidential reference items.
Fig. 3: the enzyme of the plant expression vector pCAMBIA-super1300/TaWRKY80 of structure is cut the checking result.
Fig. 4: the phenotypic evaluation of transgenic arabidopsis strain system,
4-A: the phenotype of contrast and transgenic arabidopsis strain system under the different treatment condition,
CK is the normal growth condition,
4-B to 4-G: the long statistics of contrast and transgenic line plant root under the different treatment condition,
Fig. 5: the mensuration of proline content in transgenic line and the contrast of the transgenosis not strain system under the normal growth condition.
Embodiment
1. design of primers
Downstream primer Wrky2:5 '-CTTAGGGAATTTTGCCACACTCTTTG-3 ' according to chip probe sequences Design gene specific, matching with 5 of library ' end anchor primer NT3:5 '-ACTAAAGggaACAAAAGCTGG AG-3 ', is the full-length cDNA of template amplification gene with the full-length cDNA library of wheat seedling root.
2.PCR reaction system (50 μ L) and program
2×GC bufferⅠ 25μl
Template cDNA library 1ul
dNTPs（10mM each） 1μl
Primer1 (10μM) 1μl
Primer2(10μM) 1μl
LA Taq(TaKaRa) 0.5ul
DdH
2O adds to final volume 50 μ l
94 ℃ of pre-sex change 3min; 94 ℃ of sex change 45sec, 58 ℃ of renaturation 1min, 72 ℃ are extended 2min, circulate 35 times; 72 ℃ are extended 5min.
3.1% agarose gel electrophoresis
Pcr amplification product detects the band (Fig. 1) that clauses and subclauses are found to have at the 1000bp place in the back with 1% agarose gel electrophoresis.
4. the recovery of amplified fragments, with the linking of T carrier
Adopt the agarose gel of Tiangen company to reclaim test kit to amplified band, the step by specification carries out.The PCR product is connected with pGEM-T (Promega) carrier, and linked system is:
The PCR product 7 μ l that reclaim
10 * T4 ligase enzyme damping fluid, 1 μ l
PGEM-T carrier (50ng/ μ l) 1 μ l
T4DNA ligase enzyme (3U/ μ l) is 1 μ l (Takara)
Spend the night in 4 ℃ of refrigerators connections.
5. reclaim clone and the order-checking of fragment
Use CaCl
2Legal system is equipped with escherichia coli DH5a (be epoch biotech firms available from the sky) competent cell, and 42 ℃ of water-bath heat shock methods transform.Cultivate and add X-gal and IPTG in the bacterium liquid of 1h to transforming the back, mixing evenly is coated onto it on flat board that contains penbritin with spreader, and 37 ℃ of constant temperature are inverted overnight incubation, when waiting to occur obvious single bacterium colony flat board is taken out.
According to T7 promotor and the SP6 promoter sequence design universal primer T7 at two ends, used pGEM-T carrier cloning site, the recombinant clone of SP6 carries out PCR to be identified.
PCR program: 94 ℃ of pre-sex change 10min; 94 ℃ of sex change 1min, 58 ℃ of renaturation 1min, 72 ℃ are extended 1min, circulate 35 times; 72 ℃ are extended 5min;
Pcr amplification product detects with 1% agarose electrophoresis, and the bacterium liquid of getting positive colony send company to check order.Sequencing result is seen SEQ ID No.1.
Under embodiment 2, the different treatment condition
TaWRKY80Expression of gene is analyzed
1. material processing
No. 3 seed room temperature sprouting is melted on the wheat mountain, removes endosperm after 1 week, continues to cultivate with the Hangload liquid nutrient medium and 1 week coerces processing.
Salt stress: in the Hangload liquid nutrient medium, add NaCl to final concentration be 200mM;
ABA handles: add in the substratum ABA to final concentration be 100 μ M;
Handle blade and the root system of getting seedling after 0,0.5,3,12,24,48 hour respectively under the different condition, extract total RNA of various materials.
2. the total RNA of wheat extracts
The Trizol method is extracted RNA.The RNA quality that the 1%Agrose detected through gel electrophoresis is extracted, the RNA concentration that UV spectrophotometer measuring is extracted.
3. the first chain cDNA's is synthetic
Adopt PrimeScript
TMRT-PCR Kit, reactions steps is undertaken by operational manual.
4.RT-PCR reaction and electrophoresis
1. be template with cDNA, carry out the PCR reaction.Primer is as follows
TaAct-S: 5′- GTTCCAATCTATGAGGGATACACGC -3′
TaAct-A: 5′- GAACCTCCACTGAGAACAACATTACC -3′
WRT1:5′-CTGACGAGGGACCCCAGCTTCAAG-3′,
W2 5′-CTTAGGGAATTTTGCCACACTCTTTG-3′
2.PCR system
ddH
2O 4.7μl
10× buffer 2μl
Primer1（2μM） 1μl
Primer2（2μM） 1μl
dNTP（10mM each） 0.2μl
rTaq polymerase（5U/μl） 0.1μl
Reverse transcription cDNA template 1 μ l
Total Volume 10μl
3.PCR program
94 ℃ of 5min; According to the gene expression amount difference 25～30 cycles are set, 94 ℃ of 20s, 57 ℃ of 60s, 72 ℃ of 45s; 72 ℃ of 5min.
4.1% agarose gel electrophoresis.The results are shown in Figure 2.
Plant expression vector pCAMBIA-super1300 is the binary vector that contains 35S promotor and NPT II gene, contains restriction enzyme in its multiple clone site
XbaThe I site.According to gene
TaWRKY80The cDNA sequence, gene-specific primer W2ORF-1:5 '-TCTAGAATGGATCCATGGGTCAGCAGC-3 ' that design comprises complete ORF (xbaI), W2ORF-2:5 '-GAGCTCCCTACCTAACTTGATCAAACTTGC-3 ' is (SacI).With this to primer amplification
TaWRKY80The cDNA sequence.Use restriction enzyme then
XbaI, SacI enzyme are cut the goal gene of carrier pCAMBIA-super1300 and amplification
TaWRKY80Sequence.The carrier of complete degestion reclaims after 1% agarose gel electrophoresis separates with goal gene, links transformed into escherichia coli DH5 α, PCR detects positive colony, extract the plasmid of positive colony, enzyme is cut checking, makes up to obtain plant expression vector pCAMBIA-super1300/TaWRKY80.Step is as follows:
(1) plasmid pCAMBIA-super1300 empty carrier and goal gene segment
XbaThe I single endonuclease digestion
It is as follows that enzyme is cut system:
SacI 2 μl
XbaI 2 μl
The pCAMBIA-super1300 carrier
(or target gene fragment) 10 μ l
10×Buffer M 2 μl
ddH
2O To 40 μl
Cut more than 3 hours in 37 ℃ of thermostat water bath enzymes.
(2) enzyme is cut electrophoresis and the recovery of product
After enzyme cuts into, be electrophoretic buffer with 1 * TAE, enzyme cut product carry out 1% agarose gel electrophoresis.Downcut the big fragment of pCAMBIA-super1300 carrier and the target gene fragment of cutting through enzyme with clean blade under ultraviolet transilluminator, sepharose reclaims test kit and reclaims the purpose band.
(3) connect
The pCAMBIA-super1300 carrier segments of cutting through enzyme and target gene fragment are carried out 4 ℃ with the ratio of mol ratio 1:4 and are connected and spend the night.
(4) transform
Connect product heat shock method transformed into escherichia coli DH5 α competent cell, transformed bacteria on the LB solid plate that contains Kan 50 μ g/ml 37 ℃ cultivated about 16 hours.
(5) evaluation of recon
PCR detects positive colony, extracts the positive colony plasmid, and plasmid is carried out
XbaVector construction (Fig. 3) is finished in I and the checking of SacI double digestion.The carrier pCAMBIA-super1300/TaWRKY80 that builds is transformed agrobacterium strains GV3101, and arabidopsis thaliana transformation carries out gene function analysis.
The functional analysis of embodiment 4, gene---Arabidopis thaliana conversion, screening and phenotype analytical
(1) plantation of Arabidopis thaliana
Wild-type Arabidopis thaliana seed with 7.5% chlorine bleach liquor (comprising 7.5% clorox and 0.01% Triton-X 100) sterilization 15 minutes, is used rinsed with sterile water 5-6 time then, and point was sowed on the MS flat board, in 4 ° of C vernalization 2-3 days.Be transplanted to then (nutrition soil mixes by equal proportion with vermiculite) in the nutrition pot, 23 ° of C cultivate 16/8 h photoperiod, light intensity 30-40 μ molm-2 s-1; After treating plant blossom, cut off its major branch top, promote the side shoot development.In 4-6 after beta pruning days, carry out Agrobacterium-mediated Transformation.
(2) Arabidopis thaliana transforms
200 ml bacterium liquid are poured in the tray.With pruning good Arabidopis thaliana back-off and all inflorescences being immersed in the suspension bacteria liquid, stir to be stained with gently and spend 30 sec-1 min.Take out flowerpot and be sidelong in pallet, wrap up preserving moisture with freshness protection package.Pallet is put the dark place cultivate 24 h.Take out nutrition pot and upright the placement then, recover illumination, continue to cultivate plant to ripe.
(3) after the screening of positive plant: T0 sterilized with 7.5% chlorine bleach liquor (comprising 7.5% clorox and 0.01% Triton-X100) for seed, program request was selected on the culture plate (30 mg/L Totomycin) at MS.In 4 ℃ of following vernalization 2-3 days.Move in the culturing room and cultivate.About about 10 days, select hygromycin resistance plant (it is right to grow true leaf 1-2, and root is stretched in the substratum) and be transplanted in the nutrition pot.Cultivation is until seed maturity.T1 obtains T2 for plant for seed with the quadrat method screening.And select resistance in for plant at T2 and insert independent strain system than the single copy for 3:1, and the T3 that obtains to isozygoty carries out Molecular Detection and the phenotypic evaluation of transgenic arabidopsis for strain system.
(4) phenotypic evaluation of transgenic arabidopsis
1. the plantation of Arabidopis thaliana
T3 sterilized 15 minutes with 7.5% chlorine bleach liquor (comprising 7.5% clorox and 0.01% Triton-X 100) for single seed that copies the Arabidopis thaliana strain system of isozygotying, use rinsed with sterile water 5-6 time then, point is sowed on the MS flat board, in 4 ° of C vernalization 2-3 days, be transplanted to then (nutrition soil mixes by equal proportion with vermiculite) in the nutrition pot, 23 ° of C cultivate 16/8 h photoperiod, light intensity 30-40 μ molm-2 s-1.
2. coerce processing
The Arabidopis thaliana seedling (contrast and transgenic line) that sprouted 5 days carefully is transplanted in the nutrition soil, or transfer to and contain respectively on 100mM NaCl, 150mM N.F,USP MANNITOL, 10mM LiCl, 5 μ M ABA and the contrast MS culture medium flat plate, vertically cultivate a week and observe phenotype.The result shows: under the normal culture condition
TaWRKY80Transgenic arabidopsis ratio not transgenosis contrast has growth potential preferably, and biomass increases (Fig. 4 A).Under the different treatment condition, change
TaWRKY80The root system of the Arabidopis thaliana plant of gene obviously is longer than not transgenosis contrast strain system (Fig. 4-B to 4-G).
(5) mensuration of proline content
The drafting of 1 typical curve
(1) accurately take by weighing the 25mg proline(Pro) on analytical balance, pour in the small beaker, use a small amount of dissolved in distilled water, pour into then in the 250ml volumetric flask, adding distil water is settled to scale, and every ml contains proline(Pro) 100 μ g in this reference liquid.
(2) preparation of serial concentration of proline: get 6 clean tube, add 0,0.1,0.25,0.5,0.75 respectively, the 100ug/ml standard proline(Pro) solution of 1.0ml adds 10,9.9,9.75,9.5,9.25 then respectively, 9.0ml distilled water, mixing can be made into 0,1.0,2.5,5.0,7.5,10ug/ml series gradient proline(Pro) solution.Get each concentration standard proline(Pro) solution 2ml respectively, add 2ml3% sulphosalicylic acid, 2ml glacial acetic acid and 4ml2.5% ninhydrin solution, put and react 60min in the boiling water bath, after the cooling, each adds 4ml toluene extraction red material.After leaving standstill, getting toluene and measure absorbance under 520nm, is X-coordinate with the concentration of proline, and absorbancy is ordinate zou, the drawing standard curve.
The extraction of proline(Pro) in 2 plant tissues
Choose the plant function blade 1g under the different drought condition, grind to form pulpous state with 4ml3% sulphosalicylic acid solution, homogenate changes in the centrifuge tube, extracts 10min in boiling water bath.After the cooling.The centrifugal 10min of 3000g, getting supernatant liquor, to be settled to 5ml standby.
The mensuration of proline content in 3 samples
Get 2ml proline(Pro) extracting solution, add 2ml distilled water, add 2ml glacial acetic acid and 4ml2.5% ninhydrin solution again, react 60min in the boiling water, respectively add 4ml toluene extraction red material after the cooling.After leaving standstill, get toluene and under 520nm, measure absorbance
4 results calculate and to go out (or find from typical curve) 2ml according to regression equation calculation and measure the content (X μ g/2ml) of proline(Pro) the liquid, the percentage ratio of proline content in the calculation sample then.Calculation formula is as follows: proline content (μ g/g)=X * V/M
X: the content of proline(Pro) from the mensuration liquid that typical curve is found
V: proline(Pro) extracting solution cumulative volume
M: vegetable material quality
The result shows under the normal growth condition that the content of proline(Pro) is higher than not transgenosis contrast strain system (Fig. 5) in the transgenic line.
Sequence table
SQ ID No.1
＜110〉University Of Ji'nan
＜120〉wheat salt tolerance, anti-drought gene
TaWRKY80And use
<141>2012-5-18
<160> 1
<210> 1
<211>1053
<212>cDNA
＜213〉wheat
＜221〉wheat salt tolerance, anti-drought gene
TaWRKY80Gene
<222>（1）…（1053）
<400>1
1 ATGGATCCAT GGGTCAGCAG CCAGCCTTCG CTGAGCCTCG ATCTGCACGT CGGCCTCCCG
61 CCGATGGGGC ACCACCAGGC GGCGCCGATG GTGGCGCTGG CCAAGCCCAA GGTCCTCGTC
121 GAGGAGAACT TCATGCAGCT CAAGAAGGAC CCTGAGGTTG CGGTTCTTGA GTCGGAGCTA
181 CAGCGTGTGA GCGAGGAGAA CCGCCGCCTG GGCGAGATGC TCAGGGAGGT GGCCTCCAAG
241 TACGAGGCCC TGCAGGGCCA GTTCACCGAC ATGGTCACGG CCGGCGCCCA CGCCGGCGGC
301 AACAACAGCC ACTACAACAA CCAGCCGTCC TCCGCGTCGG AGGGCGGGTC GGTGTCGCCG
361 TCGAGGAAGC GCAAGAGCGA GGAGAGCCTC GGCACGCCGC CGCGGCCGTC GCAGCACCAG
421 CAGCAGCACT ACGCCGGCGG CCTCGCGTAC GCGGCGGCGC CGGACCAGGC GGAGTGCACG
481 TCGGGCGAGC CGTGCAAGCG CATCCGGGAG GAGTGCAAGC CCGTCGTCTC CAAGCGCTAC
541 GTCCACGCCG ACCCCTCCGA CCTCAGCCTG GTGGTGAAGG ACGGGTACCA ATGGCGCAAG
601 TACGGGCAGA AGGTGACCAA GGACAACCCC TGCCCCCGAG CCTACTTCCG CTGCTCCTTC
661 GCCCCCGGCT GCCCCGTCAA GAAGAAAGTG CAGAGGAGCG CCGAGGACAA GACCATACTG
721 GTGGCGACGT ACGAGGGCGA GCACAACCAC ACCCAGCCCC CGCCGTCGCA GCCGCAGCAG
781 CAGAACGACG GCTCCGGCGC GGGCAAGAAC GCTGGGAAGC CGCCCCAGGC GCCGACTGCC
841 ACGCCTCACC ACCCGCAGCA GCAGCACAAG CAGGAAGCGG CAGCGGCCGC CGTCAGCGGC
901 GAGTCGGCCG TGGCGGCGTC CGAGCTGATC CGGCGCAACC TGGCGGAGCA GATGGCCATG
961 ACGCTGACGA GGGACCCCAG CTTCAAGGCG GCGCTCGTCT CCGCGCTCTC CGGCCGGATC
1021 CTCGAGCTAT CGCCGACCAG GGACATCAAT TAA
SQ ID No.2
＜110〉University Of Ji'nan
＜120〉wheat salt tolerance, anti-drought gene TaWRKY80 and application thereof
<141>2012-5-18
<160> 1
<210> 1
<211>350
<212>AA
＜213〉wheat
＜221〉wheat salt tolerance, anti-drought gene TaWRKY80 gene
<222>（1）…（350）
<400>1
1 MDPWVSSQPS LSLDLHVGLP
21 PMGHHQAAPM VALAKPKVLV
41 EENFMQLKKD PEVAVLESEL
61 QRVSEENRRL GEMLREVASK
81 YEALQGQFTD MVTAGAHAGG
101 NNSHYNNQPS SASEGGSVSP
121 SRKRKSEESL GTPPRPSQHQ
141 QQHYAGGLAY AAAPDQAECT
161 SGEPCKRIRE ECKPVVSKRY
181 VHADPSDLSL VVKDGYQWRK
201 YGQKVTKDNP CPRAYFRCSF
221 APGCPVKKKV QRSAEDKTIL
241 VATYEGEHNH TQPPPSQPQQ
261 QNDGSGAGKN AGKPPQAPTA
281 TPHHPQQQHK QEAAAAAVSG
301 ESAVAASELI RRNLAEQMAM
321 TLTRDPSFKA ALVSALSGRI
341 LELSPTRDIN *
Claims (2)
1. a wheat salt tolerance, anti-drought gene
TaWRKY80, it is characterized in that: the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.
2. a kind of wheat salt tolerance as claimed in claim 1, anti-drought gene
TaWRKY80, it is characterized in that: its aminoacid sequence is shown in the SEQ ID No.2.
3, a kind of wheat salt tolerance, anti-drought gene according to claim 1
TaWRKY80Application in cultivating salt-tolerant plant, described plant is Arabidopis thaliana or common wheat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210135564 CN102703466B (en) | 2012-05-04 | 2012-05-04 | Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210135564 CN102703466B (en) | 2012-05-04 | 2012-05-04 | Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102703466A CN102703466A (en) | 2012-10-03 |
| CN102703466B true CN102703466B (en) | 2013-07-03 |
Family
ID=46896515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210135564 Expired - Fee Related CN102703466B (en) | 2012-05-04 | 2012-05-04 | Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102703466B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520780A (en) * | 2016-11-01 | 2017-03-22 | 石家庄市农林科学研究院 | Gene for improving draught resistance ability of plants and application of gene |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667315A (en) * | 2013-12-11 | 2014-03-26 | 济南大学 | Salt-tolerant and drought-resistant gene TaDHN1 of wheat, recombinant plasmid and application |
| CN108315335B (en) * | 2018-04-13 | 2020-07-07 | 南京农业大学 | Pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102234653A (en) * | 2011-06-29 | 2011-11-09 | 济南大学 | Salt-tolerant and drought-resistant gene TaMYB33 of wheat and coding protein as well as application thereof |
-
2012
- 2012-05-04 CN CN 201210135564 patent/CN102703466B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102234653A (en) * | 2011-06-29 | 2011-11-09 | 济南大学 | Salt-tolerant and drought-resistant gene TaMYB33 of wheat and coding protein as well as application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Ligang Chen et al.The role of WRKY transcription factors in plant abiotic stresses.《Biochimica et Biophysica Acta》.2011, |
| Os WRKY80基因参与调控水稻抗病反应研究;李南羿等;《上海农业学报》;20091231;第25卷(第3期);第14-18页 * |
| The role of WRKY transcription factors in plant abiotic stresses;Ligang Chen et al;《Biochimica et Biophysica Acta》;20111231;第1-9页 * |
| 李南羿等.Os WRKY80基因参与调控水稻抗病反应研究.《上海农业学报》.2009,第25卷(第3期), |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106520780A (en) * | 2016-11-01 | 2017-03-22 | 石家庄市农林科学研究院 | Gene for improving draught resistance ability of plants and application of gene |
| CN106520780B (en) * | 2016-11-01 | 2019-05-07 | 石家庄市农林科学研究院 | It is a kind of improve plant drought ability gene and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102703466A (en) | 2012-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Postaire et al. | A PIP1 aquaporin contributes to hydrostatic pressure-induced water transport in both the root and rosette of Arabidopsis | |
| CN102234653B (en) | Salt-tolerant and drought-resistant gene TaMYB33 of wheat and coding protein as well as application thereof | |
| CN110256544B (en) | Application of NsNHX1 protein and related biological material thereof in cultivation of stress-tolerant poplar | |
| CN102329805B (en) | Coding sequence for OsMYB gene in rice and applications | |
| CN110845590B (en) | Wild grape VyPPR gene and application of encoding protein thereof in drought stress | |
| CN115725615B (en) | Upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton | |
| CN102703465A (en) | Salt-tolerant drought-tolerant wheat gene TaWRKY79 and application thereof | |
| CN113337526A (en) | Corn methionine sulfoxide reductase gene ZmMSRB3 and application thereof | |
| CN102703466B (en) | Wheat salt-tolerant and drought-resistant gene TaWRKY80 and application thereof | |
| CN103451192A (en) | Populus deltoidesx populus nigra PdMYB2 gene and application thereof | |
| CN117904181A (en) | Application of upland cotton GhANN gene in drought resistance and salt tolerance of upland cotton | |
| CN116179564B (en) | Upland cotton GhABC1K12-A07 gene and application thereof | |
| CN104498514B (en) | A kind of Nitraria tangutorum NtCIPK9 gene and its expressing protein and application | |
| CN105063062A (en) | Wheat salt-resistant drought-resistant gene TaDHN3, and expression vector and applications thereof | |
| CN106674337A (en) | Plant phosphorus transport protein ZmPHT1;7, and encoding gene and application thereof | |
| CN103667315A (en) | Salt-tolerant and drought-resistant gene TaDHN1 of wheat, recombinant plasmid and application | |
| Liu et al. | AgDHAR2, a chloroplast-located dehydroascorbate reductase, modulates the ascorbate accumulation and drought stress response in celery | |
| Sun et al. | Phosphate transporter MdPHT1; 7 enhances phosphorus accumulation and improves low phosphorus and drought tolerance | |
| CN104762305A (en) | Gene TaUreG related to wheat drought resisting and application thereof | |
| KR101582047B1 (en) | Method for improving the resistance to the drought stress using CaAIP1 in plants | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| CN110699362B (en) | AFP5 gene and application thereof | |
| CN113604475B (en) | Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance | |
| CN116716316B (en) | Key gene GhPIF7 for regulating and controlling cotton flowering in upland field in response to environmental temperature | |
| CN116286869B (en) | Application of feather needle grass sugar transport protein gene SpSWEET14 in improving cold resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130703 Termination date: 20150504 |
|
| EXPY | Termination of patent right or utility model |