CN108315335B

CN108315335B - Pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants

Info

Publication number: CN108315335B
Application number: CN201810331451.1A
Authority: CN
Inventors: 黄小三; 刘月; 顾冰洁; 林泽崑; 邢才华; 张绍铃; 李凌; 胡轼; 赵梁怡; 董慧珍; 高俊芝
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2018-04-13
Filing date: 2018-04-13
Publication date: 2020-07-07
Anticipated expiration: 2038-04-13
Also published as: CN108315335A

Abstract

The invention provides a pear drought-induced transcription factor PbrWRKY53 and application thereof in improving the drought resistance of plants, belonging to the technical field of plant genetic engineering; the nucleotide sequence of the pear drought-induced transcription factor PbrWRKY53 is shown as SEQ ID No.1, the amino acid sequence of the encoded protein is shown as SEQ ID No.2, and the pear drought-induced transcription factor PbrWRKY53 is overexpressed, so that the active oxygen scavenging capacity of transgenic plants can be effectively enhanced, and the drought resistance of the plants is improved. According to the records in the embodiment section, the drought resistance of the transgenic overexpression strains of the tobacco and the autumn pears is greatly improved compared with that of the control wild type.

Description

Pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a pear drought-induced transcription factor PbrWRKY53 and application thereof in improving the drought resistance of plants.

Background

Pear is one of the economic fruit tree species mainly cultivated in the world at present. China is one of the important origins of pears and is the first major country where the pear yield is in the world. The layout and the planning of the pear dominant producing areas in China greatly promote the rapid development of the pear industry, and because the pear producing areas are widely distributed in China, the growth and the development of pear trees are easily influenced by factors such as geographical and climatic conditions, such as drought, freezing damage, salt and alkali. Therefore, the cultivation of new stress-resistant varieties with strong stress resistance and good comprehensive characters becomes a crucial factor for the development of the pear industry in China. However, the pear has the problems of high genetic heterozygosity, long generation period, majority of self-incompatibility, uncertainty of breeding target and the like in the breeding aspect, so that the pear breeding progress is slow, and the conventional breeding method cannot meet the requirements of modern pear industry cultivation on varieties.

According to statistics, 50% of the annual crop yield loss in the world is related to abiotic stress, and 20% of the annual crop yield loss is related to biotic stress such as plant diseases and insect pests. For example, when plants are subjected to drought stress, various adverse reactions occur in the plants, such as the accumulation of intracellular reactive oxygen species and osmotic pressure changes. Drought stress can typically trigger response activities such as increased or decreased gene expression, increased or decreased metabolites, specific protein synthesis in plants. Under the condition of drought stress, the plants can resist the drought stress, and permeable organic small molecular substances such as betaine, proline, trehalose, mannitol and the like can be synthesized in cells in large quantity so as to increase the osmotic potential of the cells and reduce the osmotic potential difference with the surrounding environment, so that the plants can avoid the excessive dehydration and death of the cells caused by high osmotic potential difference. Plants can respond to drought stress by accumulating polyamines such as putrescine, spermidine, spermine. The drought resistance of the plant is improved mainly by accumulating polyamine compounds, eliminating active oxygen in cells and regulating osmotic pressure in the cells. Therefore, the research on the regulation and control way and the action mechanism of the related genes under the drought stress has very important significance for cultivating new drought-resistant varieties. At present, no pear drought-resistant related gene research report exists.

Disclosure of Invention

In view of the above, the invention aims to provide a pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants.

In order to achieve the above object, the present invention provides the following technical solutions: the pear drought-induced transcription factor PbrWRKY53 has a nucleotide sequence shown in SEQ ID No.1, and the nucleotide sequence of the pear drought-induced transcription factor PbrWRKY53 is shown in SEQ ID No. 1.

The invention also provides a protein coded by the pear drought-induced transcription factor PbrWRKY53, and the amino acid sequence of the protein is shown in SEQ ID No. 2.

The invention provides application of the pear drought-induced transcription factor PbrWRKY53 or the protein in improving the drought resistance of plants.

Preferably, the plant comprises tobacco or pear.

Preferably, when the plant is tobacco, the method comprises the following steps:

1) providing the pear drought-induced transcription factor PbrWRKY 53;

2) connecting the pear drought-induced transcription factor PbrWRKY53 with a vector to obtain a recombinant vector;

3) transferring the recombinant vector into agrobacterium tumefaciens to obtain recombinant agrobacterium tumefaciens;

4) infecting the recombinant agrobacterium tumefaciens on tobacco to obtain the tobacco over-expressing pear drought-induced transcription factor PbrWRKY 53.

Preferably, step 1) is: performing PCR amplification by taking the pear leaf cDNA as a template to obtain a pear drought-induced transcription factor PbrWRKY 53; the primer pair for amplification comprises a forward primer F1 and a reverse primer R1; the sequence of the forward primer F1 is shown as SEQ ID No. 3; the sequence of the reverse primer R1 is shown as SEQ ID No. 4.

Preferably, the pear is a autumn pear.

Preferably, when the plant is a autumn pear, the pear drought-induced transcription factor PbrWRKY53 is transferred into the autumn pear by using a transient transformation method.

The invention has the beneficial effects that: biological function verification shows that the pear drought-induced transcription factor PbrWRKY53 has the function of improving the drought resistance of plants, and overexpression of the pear drought-induced transcription factor PbrWRKY53 can effectively enhance the active oxygen scavenging capacity of transgenic plants, so that the drought resistance of the plants is improved. The pear drought-induced transcription factor PbrWRKY53 provides new gene resources for molecular design breeding of plant abiotic stress resistance, provides new genetic resources for implementing green agriculture and water-saving agriculture, and is beneficial to reducing agricultural production cost and realizing environmental friendliness by development and utilization of the genetic resources; the pear drought-induced transcription factor PbrWRKY53 can be applied to cultivation of drought-resistant plant varieties, according to the records in the embodiment, the drought-resistant capability of transgenic over-expression strains of tobacco and autumn pears is greatly improved compared with that of a control wild type, and hydrogen peroxide (H) in the transgenic over-expression strains of tobacco₂O₂) And the content of Malondialdehyde (MDA) is lower than that of a wild type, the active oxygen residue in a plant body is lower, and the cell damage is smaller.

Drawings

FIG. 1 is a schematic flow chart of cloning, separation and functional verification of a pear drought-induced transcription factor PbrWRKY 53;

FIG. 2 is a schematic diagram of the expression of the pear drought-induced transcription factor PbrWRKY53 under dehydration, low temperature of 4 ℃ and abscisic acid stress in example 2;

FIG. 3 is the subcellular localization map of the pear drought-induced transcription factor PbrWRKY53 of the present invention in example 3;

FIG. 4 is a construction scheme and a vector structural diagram of a recombinant expression vector in example 4, wherein FIG. 4A is a construction scheme of a recombinant expression vector, and FIG. 4B is a structural diagram of a pMV vector;

FIG. 5 is a schematic diagram of the process of transformation of tobacco with PbrWRKY53 and plant regeneration in example 4;

FIG. 6 is the measurement chart of the phenotypic and physiological indexes before and after drought treatment of the transgenic strain PbrWRKY53 and Wild Type (WT) in example 4;

FIG. 7 is a graph showing the measurement of phenotypic and physiological indicators after the transient transformation of PbrWRKY53 gene into autumn pear strains (OE1 and OE2) and the dry drought treatment of wild type plants (WT) for 14 days at room temperature in example 5;

FIG. 8 is a graph showing the results of measuring the hydrogen peroxide content, the superoxide anion radical content and the malondialdehyde content in the tissues of the untransformed plants and transformed plants after drought treatment at room temperature for the tobacco plants of example 4 and the autumn pear plants of example 5.

Detailed Description

The invention provides a pear drought-induced transcription factor PbrWRKY53, wherein the nucleotide sequence of the pear drought-induced transcription factor PbrWRKY53 is shown as SEQ ID No. 1. In the invention, the pear drought-induced transcription factor PbrWRKY53 is preferably derived from Pyrus betulaefolia (Pyrus bretschneeri), and the pear drought-induced transcription factor PbrWRKY53 comprises a 1044bp open reading frame.

The pear drought-induced transcription factor PbrWRKY53 is obtained by the following method: extracting RNA of the pyrus betulaefolia from the pyrus betulaefolia leaves; reverse transcribing the RNA to obtain cDNA; and (3) amplifying by using the cDNA as a template and using a forward primer F1 and a reverse primer R1 to obtain the pear drought-induced transcription factor PbrWRKY 53. In the invention, the sequence of the forward primer F1 is shown as SEQ ID No.3, specifically 5'-ggtgagcttaggagagggccatggactc-3'; the sequence of the reverse primer R1 is shown as SEQ ID No.4, and is specifically 5'-cgctgctcgtgtcgattcggagatgccgg-3'.

In the invention, the leaves of the strong birch pear seedlings are preferably selected, the RNA of the birch pear is extracted by a conventional plant tissue RNA extraction method in the field without other special limitations, a CTAB method is adopted in the specific implementation process of the invention, and the steps and the method for extracting the RNA by the CTAB method are conventional in the field.

In the invention, after the RNA of the pyrus betulaefolia is obtained, the cDNA is obtained by reverse transcription; in the present invention, the reverse transcription is performed by a method conventional in the art, preferably by using a TOYOBO reverse transcription kit, and the specific steps are described in the specification of the kit.

After the cNDA is obtained, the obtained cDNA is used as a template, the pear drought-induced transcription factor PbrWRKY53 is obtained by amplification with a forward primer F1 and a reverse primer R1, the sequence of the forward primer F1 is shown as SEQ ID No.3, and the sequence of the reverse primer R1 is shown as SEQ ID No. 4. in the specific implementation process of the invention, the amplification system is preferably a 50 μ l system, the amplification system comprises 100ng of template DNA, 5 × Q5Reaction Buffer (Q5Reaction Buffer), 10mM dNTPs, 1U Q5High fidelity polymerase (Q5High-Fidelity DNA polymerase), 1.0 μ M of forward primer and 1.0 μ M of reverse primer, the 5 × Q5 Buffer and Q5High fidelity polymerase are preferably purchased from New England polymerase, the amplification Reaction program is preferably 94 ℃ pre-denaturation polymerase, 94 ℃ for 3min, 90 ℃ for 90 ℃ and 90 ℃ for annealing at 90 ℃ after the cycle of annealing at 90 ℃ and 90 ℃ for 10 dBs.

After the pear drought-induced transcription factor PbrWRKY53 is obtained through amplification, the nucleotide sequence of the pear transporter gene PbrALMT9 is obtained through agarose gel electrophoresis and sequencing verification after recovery of products obtained through amplification.

The invention also provides a protein coded by the pear drought-induced transcription factor PbrWRKY53, and the amino acid sequence of the protein is shown in SEQ ID No. 2. The protein coded by PbrWRKY53 comprises 347 amino acids, the isoelectric point is 5.80, and the calculated molecular weight is 38.76 KDa. The subcellular localization of the protein of the invention is in the nucleus, belonging to the nucleoprotein; can effectively enhance the active oxygen scavenging capability of the plants, thereby improving the drought resistance of the plants.

In the present invention, the plant preferably comprises tobacco. When the plant is tobacco, the method comprises the following steps: 1) providing the pear drought-induced transcription factor PbrWRKY 53; 2) connecting the pear drought-induced transcription factor PbrWRKY53 with a vector to obtain a recombinant vector; 3) transferring the recombinant vector into agrobacterium tumefaciens to obtain recombinant agrobacterium tumefaciens; 4) infecting the recombinant agrobacterium tumefaciens on tobacco to obtain the tobacco over-expressing pear drought-induced transcription factor PbrWRKY 53.

In the present invention, step 1) is preferably: performing PCR amplification by taking the pear leaf cDNA as a template to obtain a pear drought-induced transcription factor PbrWRKY 53; the specific method and steps for obtaining the pear drought-induced transcription factor PbrWRKY53 by PCR amplification in the invention are referred to the method for obtaining the pear drought-induced transcription factor PbrWRKY53, and are not described herein again.

In the invention, a pear drought-induced transcription factor PbrWRKY53 is obtained, and the pear drought-induced transcription factor PbrWRKY53 is connected with a vector to obtain a recombinant vector, wherein the vector is preferably a pMV vector, and the construction method of the recombinant vector specifically comprises the following steps:

carrying out double enzyme digestion on the obtained pear drought-induced transcription factor PbrWRKY53 and a carrier respectively to obtain an enzyme digestion fragment and an enzyme digestion carrier; and then connecting the enzyme digestion fragment with the enzyme digestion vector to obtain the recombinant vector.

In the invention, the temperature of double enzyme digestion of the pear drought induced transcription factor PbrWRKY53 is preferably 36-38 ℃, more preferably 37 ℃, the time of double enzyme digestion is preferably 10-14 h, more preferably 12h, the total volume of a double enzyme digestion system for enzyme digestion of the pear drought induced transcription factor PbrWRKY53 is preferably 20 μ l, the purified product of PCR comprising the pear drought induced transcription factor PbrWRKY53 is 10 μ l, 10 × G buffer solution is 2 μ l, KpnI and SalI are 1 μ l respectively, and double distilled water is 6 μ l.

In the invention, the molar ratio of the enzyme digestion fragment to the enzyme digestion vector is preferably (2-4): 1, more preferably 3:1, in the invention, the total volume of the ligation reaction is preferably 10 mu l, comprising 10 × buffer 1 mu l and T4DNA ligase 1 mu l, the enzyme digestion fragment is recovered by double digestion, the enzyme digestion vector is recovered by double digestion, and the double distilled water is 2 mu l, in the invention, the temperature of the ligation reaction is preferably 14-18 ℃, more preferably 16 ℃, the time of the ligation reaction is preferably 14-16h, and the product of the ligation reaction is collected after the ligation reaction is finished to obtain the recombinant vector.

After the recombinant vector is obtained, the recombinant vector is preferably transformed into an escherichia coli strain DH5 α, colony PCR sequencing is carried out to verify whether the recombinant expression vector is successfully constructed, and the colony PCR sequencing verification method adopts a colony PCR sequencing verification method which is conventional in the field.

After obtaining a recombinant vector, the recombinant vector is transferred into agrobacterium tumefaciens to obtain recombinant agrobacterium tumefaciens; in the present invention, the method for transferring the recombinant vector into Agrobacterium tumefaciens is preferably a freeze-thaw method, and the method steps of the freeze-thaw method are specifically described in the present invention (refer to Sambruk, Huangpetang, third edition of molecular cloning, A laboratory Manual, scientific Press, 2002).

The invention is inAnd after the recombinant agrobacterium tumefaciens is obtained, infecting tobacco with the recombinant agrobacterium tumefaciens to obtain the tobacco over-expressing the pear drought-induced transcription factor PbrWRKY 53. In the invention, the method for infecting tobacco by the recombinant agrobacterium tumefaciens comprises the following steps: and (3) soaking and infecting tobacco leaves with the recombinant agrobacterium tumefaciens bacterial solution, then carrying out co-culture, and screening to obtain the tobacco over-expressing the pear drought-induced transcription factor PbrWRKY 53. The recombinant agrobacterium tumefaciens is subjected to liquid amplification culture to obtain a bacterial liquid, and the OD of the bacterial liquid₆₀₀Preferably 0.4 to 0.6, more preferably 0.5. In the invention, the soaking and infecting time is preferably 8-10min, and the soaking and infecting process is accompanied by shaking; the rotating speed of the oscillation is preferably 200-300 rpm, and more preferably 250 rpm. The amount of the bacterial liquid during soaking infection in the invention is preferably that the tobacco leaves can be completely soaked.

In the present invention, the co-culture medium is preferably MS medium supplemented with 6-BA and NAA; the addition amount of 6-BA in the co-culture medium is preferably 1.5-2.5 mg/L, more preferably 2.0mg/L, and the addition amount of NAA is preferably 0.25-0.35 mg/L, more preferably 3.0 mg/L. In the invention, the co-culture time is preferably 1-3 d, the co-culture temperature is 24-26 ℃, and the co-culture is preferably dark culture.

According to the invention, after the co-culture is finished, the tobacco screening of the over-expression pear drought-induced transcription factor PbrWRKY53 is preferably carried out. In the invention, the screening is preferably carried out by using a screening culture medium added with kanamycin and cefamycin, and the tobacco capable of growing in the screening culture medium added with kanamycin and cefamycin is the tobacco over-expressing pear drought-induced transcription factor PbrWRKY 53.

After the tobacco over-expressing the pear drought-induced transcription factor PbrWRKY53 is obtained, rooting culture and transplantation of the over-expressing pear transporter gene PbrALMT9 tobacco are preferably carried out to obtain a transgenic tobacco strain. The rooting culture and transplanting are carried out by adopting a method which is conventional in the field.

After the transgenic tobacco strain is obtained, the detection and verification of the transgenic positive plant are preferably carried out. In the invention, the detection is preferably performed by PCR amplification detection by using a specific primer of a pear drought-induced transcription factor PbrWRKY 53. The reaction procedures and systems for PCR amplification detection described in the present invention are shown in tables 3 and 4, respectively. In the obtained tobacco strain, the fragment with the expected size can be amplified, and the tobacco strain is indicated as a positive transgenic strain.

In the present invention, when the plant is a pear, a autumn pear is preferable. When the plant is autumn pear, the pear drought induction transcription factor PbrWRKY53 is transferred into the autumn pear by using a transient transformation method. The transient transformation method in the present invention specifically includes the steps of: injecting the recombinant agrobacterium tumefaciens onto a autumn pear leaf to infect a autumn pear plant, and then continuously culturing the infected autumn pear plant to obtain the instantaneously transformed autumn pear. OD of recombinant Agrobacterium tumefaciens described in the present invention₆₀₀The value is preferably 1.2 to 1.8, more preferably 1.5; the infected autumn pears are preferably artificially cultured autumn pear plants of 4-6 weeks, and the artificially cultured equipment is preferably an artificial climate incubator. Before infecting the autumn pear leaves, the recombinant agrobacterium tumefaciens is preferably suspended by an acetosyringone solution, and the concentration of the acetosyringone in the acetosyringone solution is preferably 150-250 mu m; the acetosyringone solution preferably further comprises 8-12 mM MES (pH 5.6) and 8-12 mM MgCl₂。

The pear drought-induced transcription factor pbrrwrky 53 and the application thereof in improving the drought resistance of plants provided by the invention are described in detail below with reference to the examples, but the description should not be construed as limiting the scope of the invention.

Example 1

Cloning of pear PbrWRKY53 gene full-length cDNA

A drought-induced transcription factor PbrWRKY53 is screened by screening a pear full-length cNDA library, a Primer is designed according to the sequence of a PbrWRKY53 gene and a Primer premier 5.0, and the full length of the pear is amplified from the pear by an RT-PCR method. The detailed steps are as follows:

research material birch pear is planted in the national pear engineering center of Nanjing agriculture university, and the seedling age is 65 days. Selecting strong birch pear seedlings, randomly weighing 0.3g of samples, and immediately quickly freezing by using liquid nitrogen. RNA is extracted by adopting a CTAB method, and the specific method is as follows:

preparation before experiment: various tips, 1.5mL centrifuge tubes, 2mL centrifuge tubes, 50mL cryopreservation tubes, mortar and pestle required for the experiment were treated with 10% DEPC water. The required experimental articles are all processed for more than 12 hours in advance, sterilized at high temperature and high pressure and dried for later use.

(1) Weighing 0.2g of pyrus betulaefolia leaves, quickly pouring liquid nitrogen into a mortar, quickly grinding a sample into powder, sufficiently grinding, pouring a proper amount of liquid nitrogen, grinding for 3 to 4 times, wherein the times are not too many to prevent the sample from repeatedly freezing and thawing to damage an RNA structure, adding 1mL of CTAB extracting solution (containing β -mercaptoethanol 20-40ul/mL), unfreezing at room temperature, transferring into a 2mL centrifuge tube, and finally balancing with the CTAB extracting solution;

(2) placing the sample in a floating plate, performing water bath at 65 deg.C for 30min, shaking up by inversion every 5-10min, centrifuging at 4 deg.C and 12000rpm for 20 min; after centrifugation, transferring the supernatant into a new 2mL centrifuge tube which is precooled in advance by using a pipette gun, and finally leveling by using CTAB extracting solution;

(3) an equal volume of chloroform was added to the fume hood with a pipette: isoamyl alcohol (24:1), shaking vigorously on a vortex apparatus for 5min, then centrifuging at 12000rpm at 4 ℃ for 20 min; using a pipette gun to suck the supernatant into another new 2mL centrifuge tube which is pre-cooled (the supernatant is not sucked into a protein layer when being sucked, so that protein pollution is prevented); in a fume hood, chloroform was added in equal volume thereto: isoamyl alcohol (24:1), shaking vigorously for 5min, centrifuging at 12000rpm at 4 deg.C for 20 min;

(4) using a pipette to suck the supernatant into another new 1.5mL centrifuge tube which is precooled in advance; adding 2/3 volumes of lithium chloride into the mixture, and reversing the mixture by using a vortex instrument to mix the mixture evenly; reacting for 6-10h in a refrigerator at the temperature of-20 ℃;

(5) centrifuging at 12000rpm at 4 deg.C for 30 min; adding 1mL of 75% anhydrous ethanol pre-cooled, washing the precipitate, mixing well, washing at 4 deg.C and 12000rpm for 1-2min, centrifuging for 2-3min, and removing supernatant; washing for 3-4 times, and removing supernatant; centrifuging at 12000rpm at 4 deg.C for 2-3min, and sucking out the excessive liquid from each tube with a pipette; then opening the cover of the centrifugal tube, and placing the centrifugal tube in an ultra-clean workbench to dry the centrifugal tube by sterile wind;

adding appropriate amount of DEPC water into each tube for dissolving (centrifugal dissolving at 4 deg.C, 12000rpm, centrifuging for 2-4min), standing at 4 deg.C for 5-10min, and immediately storing in-80 deg.C ultra-low temperature refrigerator for use. Taking 1-2uL agarose gel for electrophoresis, detecting by using a Nano-drop instrument, and detecting the concentration to be 350 ng/uL.

Grinding 0.5g Du pear sample with liquid nitrogen, sucking 1ml TRIZON reagent to extract RNA, then treating 1 μ g total RNA sample with 1U DNase I at 37 ℃ for 30min, immediately placing on ice, adding 1 μ l 50mM EDTA65 ℃ for 10min, immediately placing on ice, synthesizing cDNA first strand according to the operation manual of TOYOBO reverse transcription kit, using the obtained first strand cDNA for amplification of PbrWRKY53 gene, completing PCR according to the following procedures of pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 90s, extension at 72 ℃ for 90s, 35 cycles, extension at 72 ℃ for 10min, generating single-banded PCR product, performing agarose gel electrophoresis at 1% and using gel recovery kit according to the instruction extraction procedure, recovering the specific-targeted band, recovering the purified solution, connecting with pMD19-T vector, wherein the molar ratio of gene to vector in the connecting system is 3:1, the ligation reaction is performed by using primer for 5 μ l PCR, and performing PCR reaction on 5 α μ l hot-transfected DNA (PCR) with 5 μ l primer, and performing overnight PCR at 5 α. mu.5 μ l for verifying that the gene amplification by using the above-targeted PCR method.

Example 2

qRT-PCR analysis of pear drought-induced transcription factor PbrWRKY53 gene under different stress conditions

In order to analyze the response pattern of PbrWRKY53 gene to dehydration (FIG. 2A), low temperature (FIG. 2B) and abscisic acid (FIG. 2C) in Du pear, the expression pattern of PbrWRKY53 gene was analyzed by Real-time PCR technique, RNA was extracted by CTAB method, and the synthesis of cDNA first strand was performed with reference to the manual of TOYOBO reverse transcription kit, in 20. mu.l reaction system, 10. mu.l of 2 × Mix, 0.1. mu.l of cDNA, 5. mu.l of primer (using ubiqutin as internal reference primer, length 208), 4.9. mu.l of water. quantitative PCR was performed as follows:

TABLE 1 quantitative PCR procedure

When the plants were dehydrated, as shown in fig. 2A, the transcription level of pbrrwrky 53 gene gradually increased after the plants were dehydrated, reaching the highest at 6h, which was more than 4 times higher than that of untreated plants, indicating that pbrrwrky 53 gene responded strongly to dehydration. When the plants were treated at 4 ℃ low temperature, as shown in FIG. 2B, the transcription level of PbrWRKY53 gene decreased slowly for 1h and then gradually increased to 6h, and no significant change occurred from 6h to 72h, which is more than 1 time of that of untreated plants, indicating that the PbrWRKY53 gene did not respond significantly to 4 ℃ low temperature. When plants were treated with ABA, as shown in FIG. 2C, the transcription level of PbrWRKY53 gene gradually increased after plants were treated with ABA, reached the highest level at 120h, which was more than 2 times higher than that of untreated plants, indicating that PbrWRKY53 gene ABA had strong response.

Example 3

Subcellular localization of pear drought-induced transcription factor PbrWRKY53 gene

According to the nucleotide sequence of PbrWRKY53 gene and pJIT166-GFP vector map, NCOI and BSTPI enzyme cutting sites are added before and after the gene sequence. The sequence of the cleavage site is shown below:

NCOI：CCATGG

BSTPI：GGTGACC

extracting plasmid of target gene with correct sequencing result as template, and amplifying by primer added with enzyme cutting site, wherein the PCR program is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 1min, extension at 72 ℃ for 1min for 30s, and 35 cycles; extension at 72 ℃ for 10 min. The primer sequences of the cleavage sites are shown below:

D-F1：GGCCATGGCTCAGCTTACCCTTCTCACAAATCTG(SEQ ID No.5)

D-R1：TTGGTGACCCCTCACCTTCTGTGTTGTGGGAGCC(SEQ ID No.6)

the method comprises the steps of removing a termination codon TAG from a gene 3' and aiming at fusing the gene with GFP, carrying out 1% agarose gel electrophoresis on a PCR product, recovering a target strip by using a gel kit, cloning a purified amplification fragment into a pMD19-T vector, transforming into escherichia coli competent DH5 α, detecting the transformed bacterial liquid by using PCR, carrying out sequencing on the bacterial liquid identified to be positive by using PCR, extracting a bacterial liquid with a correct sequencing result and a plasmid of a pJIT166-GFP vector, carrying out double enzyme digestion on the bacterial liquid and the plasmid of the pJIT166-GFP vector by using SalI and BamHI, respectively purifying and recovering a product PbrWRKY53 gene after enzyme digestion and a pJIT166-GFP vector, connecting the two products by using T4-DNA ligase, transforming the escherichia coli competent DH5 α at 16 ℃ overnight, and naming the obtained recombinant vector as pJIT 166-PbrWRKY 53.

Reagents and methods for transformation using protoplasts, the reagents used: arabidopsis protoplast enzymatic hydrolysate (prepared one day and night in advance and stored at 4 ℃): 0.4M mannitol; 1% cellulase; 0.1% of an eductase; 5mM MES; 0.1% pectinase.

The method comprises the following steps: heating in 55 deg.C water bath for 10min to inactivate various proteases and enhance solubility of cellulase etc., cooling to room temperature, and adding the following two reagents: 0.15% BSA and 8mM CaCl; and (3) MaMg solution: 0.4M mannitol; 0.1% MgCl; 4mM MES; w5 solution (ready for use, attention was paid to the addition of the carboxymethyl antibiotic during culture): 154mM NaCl; 125mM CaCl; 5mM KCl; 2mM MES; PEG solution (40%, v/v): 4g PEG 4000(sigma-Fluka, #81240) was dissolved in 4mL water; 0.72868g mannitol was added to 3mL water and 1mL 1M CaCl was added to dissolve, if not dissolve, to aid dissolution at 65 ℃. Mixing the two, after completely mixing, fixing the volume to 10mL, and finally adjusting the pH value to 7.5-8.0 by using KOH.

The location of PbrWRKY53 protein location is determined by transforming plasmids of PbrWRKY53-GFP and control no-load 35S-GFP into protoplasts of Arabidopsis thaliana and detecting the position of GFP fluorescence in the protoplasts, and the result is shown in FIG. 3, wherein FIG. 3A is the location of control no-load vector, and green fluorescence is distributed in the whole cells; FIG. 3B is the transient expression of PbrWRKY53-GFP in Arabidopsis protoplasts with green fluorescence distributed over the nucleus, but not found elsewhere. The result shows that the PbrWRKY53 gene is located in the nucleus and is a nucleoprotein.

Example 4

Application of pear drought-induced transcription factor PbrWRKY53 in improving drought resistance of tobacco

1. Construction of plant transformation vectors

According to the multiple cloning site of pMV vector (in the plant binary transformation vector pBI121 with GUS gene cut off) and coding region sequence of PbrWRKY53 gene, using Primer 5.0 software to design upstream and downstream PCR primers of whole coding region of amplified gene (said Primer pair is the Primer pair for amplifying PbrWRKY53 gene cDNA sequence), using clone of PbrWRKY53 gene as template to make PCR amplification, annealing temp. of PCR amplification is 58 deg.C, PCR reaction system and amplification program are identical to that of PbrWRKY53 gene clone, after amplification making double digestion, its total volume is 20. mu.l, in which the PCR purified product is 10. mu.l, 10 × G buffer solution 2. mu.l, KpnI and SalI are respectively 1. mu.l, double distilled water 6. mu.l, enzyme digestion is implemented in 37 deg.C, after making gel purification and recovery, pMV vector is 20. mu.l, in which the PCR purified product is inserted into pMV vector containing pBrV 5. mu.8, the PCR amplification gene is inoculated into pBrWRKY plasmid containing 5. mu.8. mu.L plasmid, then transferred into PCR amplification medium, and cultured in the PCR amplification medium, then transferred into the PCR amplification medium containing plasmid containing 5. mu.8. mu.1. mu.L plasmid containing plasmid of pBrWRrWR plasmid, the PCR amplification medium containing plasmid, the plasmid of pBrWRKY DNA, the plasmid containing plasmid of pBrWRKY plasmid, the plasmid of pBrWRKY plasmid, the PCR amplification is recovered, the plasmid of pBrWRKY plasmid of the plasmid of pBrWRKY plasmid of the PCR amplification, the plasmid of the PCR amplification, the plasmid of the PCR amplification is added into the plasmid of the PCR amplification, the plasmid of PbrWRKY plasmid of the PCR amplification, the plasmid of the plasmid.

2. The agrobacterium-mediated tobacco genetic transformation procedure was as follows:

(1) and (3) agrobacterium culture: taking the agrobacterium tumefaciens liquid stored in an ultra-low temperature refrigerator at (-80 ℃), streaking on a plate culture medium added with LB (lysogeny broth) with 50mg/L kanamycin, scraping streaked bacterial plaque, adding the bacterial plaque into a liquid MS basic culture medium, carrying out shaking culture at 28 ℃ and 500 rpm, and carrying out dip dyeing when the bacterial liquid concentration reaches 0.6-0.8.

(2) And (3) dip dyeing, namely taking non-transgenic tobacco leaves, cutting the tobacco leaves into the size of 0.5 × 0.5.5 cm, then putting the tobacco leaves into the prepared agrobacterium tumefaciens bacterial liquid, and soaking for 8-10min while continuously oscillating.

(3) Co-culturing: taking the impregnated tobacco leaves, sucking the bacterial liquid on the tobacco leaves by sterile filter paper, then inoculating the tobacco leaves on a co-culture medium (the back of the leaves faces upwards), and culturing the tobacco leaves in dark at 25 ℃ for 2 days.

(4) Screening and culturing: after 2 days of co-culture, the tobacco leaves are washed once by using a 500mg/L cefuroxime axetil solution, washed 5-6 times by using sterile water and then transferred into a screening culture medium added with 100mg/L kanamycin and 500mg/L cefuroxime axetil.

(5) Rooting culture: when the adventitious bud on the screened culture medium grows to about 1-2cm, cutting off and transferring to a rooting culture medium added with 100mg/L Km and 500mg/L Cef.

(6) Transferring the tobacco seedlings into soil culture: after the transformed seedling grows to full of culture bottles after rooting, taking out the transformed seedling from the rooting culture medium, washing the culture medium on the transformed seedling by using tap water, and planting the transformed seedling in sterilized nutrient soil. The culture medium used for tobacco transformed shoots is shown in Table 2.

TABLE 2 culture Medium formulation for tobacco transformation seedlings

3. Screening for transgenic Positive seedlings

Obtaining the tobacco with the PbrWRKY53 gene according to the method, extracting DNA from each tobacco strain, designing a primer, and carrying out PCR amplification to identify positive seedlings.

3.1 tobacco leaf DNA extraction

(1) Putting 0.2g of young tobacco leaves into a 1.5mL centrifuge tube, adding liquid nitrogen, and fully grinding into powder by using a grinding rod; then 600 mul of DNA extraction buffer cetyl triethyl ammonium bromide (CTAB for short) preheated at 65 ℃ is added, and the formula is as follows: adding 1% polyvinylpyrrolidone into 100mM Tris-HCl (pH8.0), 1.5M NaCl and 50mM EDTA (pH8.0) solution, fully dissolving in 2% (volume) CTAB in 65 ℃ water bath for later use, preheating in 65 ℃ water bath before use, adding 1-4% (volume) mercaptoethanol, and mixing uniformly;

(2) bathing at 65 deg.C for 60-90min, taking out at 15min interval, slightly turning upside down, and mixing; centrifuging at room temperature of 10000g for 10 min; taking 500. mu.l of supernatant, adding equal volume of chloroform isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), reversing, mixing uniformly and extracting for 5 min;

(3) centrifuging at 10000g for 10 min; taking 450 μ l of supernatant (taking care not to suck protein layer, causing protein contamination), adding 900 μ l-20 deg.C precooled absolute ethanol, 34 μ l 5M NaCl, mixing by inversion, and freezing at-20 deg.C for 30 min.

(4)10000g, centrifuging for 10 min; discarding the supernatant, washing with 1mL 70% ethanol for 3 times, centrifuging for three minutes in an empty tube, blowing for half an hour on an ultraclean workbench until the DNA is colorless and transparent, adding a proper amount of double distilled water, dissolving in an oven at 65 ℃ for 15min, and performing gel detection.

3.2 Positive transgenic plant detection

PCR amplification is carried out by using primer gene specific primers. The reaction procedures and systems are shown in tables 3 and 4, respectively. PCR is carried out by using a 35S + gene right-side inner primer, and the selected transgenic strains can amplify fragments with expected sizes, so that the transgenic strains are positive transgenic strains.

TABLE 3PCR reaction procedure

TABLE 4PCR reaction System

4. Detection of drought resistance function of PbrWRKY53 transgenic positive plant

Extracting RNA of the 5 transplanted and survived transgenic positive seedlings, detecting the complete structure of the seedlings by glue running, adjusting the total amount of the RNA to 3ug after the concentration of the RNA is determined by using Nanodrop (the concentration is all 600ng/ul at 200-. The nucleotide sequence of the Ubiqutin primer is as follows:

ubiqutin forward primer: 5'-AGCTACATGACGCCATTTCC-3' (SEQ ID No.7) Ubiqutin reverse primer: 5'-CCCTGTAAAGCAGCACCTTC-3' (SEQ ID No.8)

The brightness of the bands amplified by Ubiqutin is consistent, which indicates that the concentration of the reverse transcription cDNA is the same, then the target band is amplified by using the PbrWRKY53 specific primer as a template, and the nucleotide sequence of the PbrWRKY53 primer is as follows:

PbrWRKY53 forward primer: 5'-CCAAGGTTGCAGCAGAAGAT-3' (SEQ ID No.9)

PbrWRKY53 reverse primer: 5'-TGTCACCACAATGGAAAGGA-3' (SEQ ID No.10)

According to the brightness of a target band amplified by the PbrWRKY53 specific primer, the expression quantity of the PbrWRKY53 gene in positive transgenic tobacco can be judged, 2 and 3 with high brightness are selected, namely two over-expression strains named TG2 and TG3 with high expression quantity are used as independent transgenic strains and then are respectively used as female parent plants for seed collection.

In order to identify whether the PbrWRKY53 transgenic tobacco is related to drought stress, the control line and the transgenic line are subjected to short-term drought stress and long-term drought stress treatment. Sterilizing tobacco seeds and Wild Type (WT) seeds of a PbrWRKY53 transgenic line (TG2, TG3) received in the same batch, sowing the seeds on an MS screening culture medium and a commonly used MS nonreactive culture medium respectively, taking seedlings with green leaves and transplanting the seedlings into a nutrition pot (vermiculite: nutrient soil: 1) when the seedlings grow to 2-3 cotyledons, and culturing the seedlings in a greenhouse at the culture temperature of 22 ℃. After the whole 45-day-old pot seedlings of each line are put in drought treatment at room temperature for 14 days, the phenotype of the seedlings is observed, and the hydrogen peroxide content, the superoxide anion content and the malondialdehyde content in the tissues are respectively measured, so that the residual quantity of active oxygen in the cells is analyzed. The results show that during the treatment, plants of 2 transgenic lines (TG2, TG3) appeared significantly more drought-resistant than Wild Type (WT) (fig. 6).

4. In transgenic tobacco lines, lower conductivity and high survival indicate that they may have greater ROS resistance than WT. It is necessary to identify the amount of ROS accumulated in the plant. After the material is subjected to drought treatment at room temperature, the phenotype of the material is observed, a sample is taken, and the hydrogen peroxide content, the superoxide anion content and the malondialdehyde content in the tissue are respectively measured, so that the residual quantity of active oxygen in the cell is analyzed. As shown in FIG. 8(A-C), after the tobacco is subjected to drought stress for 14 days, the hydrogen peroxide content, the superoxide anion content and the malondialdehyde content of the tissues of the tobacco are determined, the hydrogen peroxide content and the malondialdehyde content of the wild strain type are both obviously higher than those of 2 transgenic strains, and the superoxide anion free radical content of the tissues of the two transgenic strains is higher than that of the control strain. These evidence suggests that transgenic tobacco lines accumulate less residual reactive oxygen species and are less cell damaging than control lines after drought stress. Further shows that the over-expressed PbrWRKY53 gene can effectively enhance the active oxygen scavenging ability of transgenic plants, thereby improving the drought resistance of the plants.

Example 5

Application of pear drought-induced transcription factor PbrWRKY53 in improvement of drought resistance of autumn pears

The preparation method of the autumn pear strain of the transient transformation pear drought-induced transcription factor PbrWRKY53 comprises the following steps:

1. autumn pears (Pyrus ussuriensis) grown in a climatic chamber for about 5 weeks were selected for Agrobacterium infestation.

2. GV3101 Agrobacterium harboring the plasmid of interest was streaked in LB medium (containing 50mg/L kanamycin +100mg/L rifampicin +50mg/L gentamycin), and Agrobacterium clones were picked and cultured overnight at 28 ℃ in 5mL LB medium.

3. Determination of Agrobacterium liquid OD₆₀₀After the value, the mixture was centrifuged at 3000rpm for 10min to collect the bacterial liquid, and the supernatant was discarded. With acetosyringone solution [10mM MES (pH 5.6) +10mM MgCl₂+200uM acetosyringone]Suspending, adjusting to OD₆₀₀About 1.5, and standing at room temperature for 3 h.

4. The agrobacterium containing the plasmid of interest is used for injection of autumn pear leaves.

5. The injected leaves were marked by injecting them into the back of the pear leaves with a 1mL syringe (needle removed).

6. The injected pear plants are put back to the artificial climate chamber for culturing for 6-7 days, and the result of the transient transformation can be observed.

2. Drought resistance analysis of transient transformation PbrWRKY53 gene autumn pear

In order to identify whether the autumn pears of the instantaneously transformed PbrWRKY53 gene are related to drought stress, a control line and an instantaneous transformation line are subjected to drought treatment, wherein the drought treatment adopts a natural drying control method, materials required by the experiment are placed in a 26 ℃ daylight lamp culture room, the illumination intensity is 20500lx, the air temperature is 44.0%, the materials are subjected to natural drought water control, and when the autumn pears appear phenotypes, the autumn pears are photographed and sampled. The phenotype and physiological indexes of the autumn pear strains (OE1 and OE2) and wild plants (WT) which are transiently transformed by the PbrWRKY53 gene after being subjected to drought treatment for 14 days at room temperature are measured. Wherein: figure 7A is the phenotype after drought treatment at room temperature for 14 days. Fig. 7B is a conductivity measurement after a 14 day dry drought treatment at room temperature. FIG. 7, C-D are chlorophyll determination (FIG. 7C) and chlorophyll extraction (FIG. 7D) after dry drought treatment at room temperature for 14 days. The results show that during the treatment, plants of 2 transient transformed lines (OE1 and OE2) appeared significantly more drought-resistant than Wild Type (WT) (fig. 7).

3. Determination and analysis of residual amount of active oxygen in tissue

5. In the transgenic lines (tobacco/autumn pears), the lower conductivity and high survival rate indicate that they may have a stronger ability to resist ROS than WT. It is necessary to identify the amount of ROS accumulated in the plant. After the material is subjected to drought treatment at room temperature, the phenotype of the material is observed, a sample is taken, and the hydrogen peroxide content, the superoxide anion content and the malondialdehyde content in the tissue are respectively measured, so that the residual quantity of active oxygen in the cell is analyzed. As shown in FIG. 8(D-F), after 14 days of drought stress of autumn pear, the hydrogen peroxide content, the superoxide anion content and the malondialdehyde content in the tissues were determined, the hydrogen peroxide content and the malondialdehyde content of the wild strain type were significantly higher than those of 2 transgenic strains, and the superoxide anion free radical content in the tissues of the two transgenic strains was higher than that of the control strain. The evidence shows that the residual quantity of active oxygen accumulated in vivo after the transgenic line is subjected to drought stress is less than that of a control line, and further shows that the over-expressed PbrWRKY53 gene can effectively enhance the active oxygen scavenging capacity of the transgenic plant, so that the drought resistance of the plant is improved.

According to the embodiments, the pear drought-induced transcription factor PbrWRKY53 provided by the invention has the function of improving the drought resistance of plants through biological function verification, and the active oxygen scavenging capability of transgenic plants can be effectively enhanced by over-expressing the pear drought-induced transcription factor PbrWRKY53, so that the drought resistance of the plants is improved. The drought resistance of the transgenic overexpression strains of the tobacco and the autumn pears is greatly improved compared with that of the control wild type, and hydrogen peroxide (H) in the transgenic overexpression strains of the tobacco₂O₂) And the content of Malondialdehyde (MDA) is lower than that of a wild type, the active oxygen residue in a plant body is lower, and the cell damage is smaller.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Nanjing university of agriculture

<120> pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>1044

<212>DNA

<213>Pyrus bretschneideri

<400>1

atggagaact gcaatataca ttgggagcaa aagagtcttg tagatgagct agcacaaggg 60

agggagctgg ctaggcagct acagatccat ctcaacgttc catcttcctc ttatggaacc 120

cgggaattgc tggttcaaaa gatcatactt tcgtacgaaa aagcgctttc catgctgaac 180

tctagcagct cagcctcagg aggtgagcaa caacagccca caggtcatgt tgcaattcga 240

atggttgagt ctccaccgca ttcgctaaat gaaagtcccc ggagtgaaga ctccgaccgc 300

gaattcaagg accatgacaa caaagattcc tctaggaaga ggaaaaatct cccacggtgg 360

acacaacaaa taagagttac atctggtatg gggcttgagg ggcctcttga tgatggattt 420

agttggagga agtatggcca gaaggacata cttggagcca aatatccaag aggctactac 480

cgctgcactc accgaaacgt ccaaggctgc ttggccacaa agcaagtcca acgttccgat 540

gaagacccga cgatctttga aattacttac agaggaaagc acacatgtac acaagcctcc 600

gccggcacaa gtactcctcc ttcaccgtca ccgttgcagc ccgaaaggac ggaacggcag 660

aacaacctag tggatcctca acaaaaccag caacaatcac aacaacacac gctcttaaac 720

ctcccggaag gcctcagagt cattactgaa ggattagaca ctcgtgagga actgttcccc 780

tccttcaaca gtccctcacc attgaacaac agttatgtgg gaagttttta tcctccattt 840

gcgggaccta caacttcagg aacaaactat ttctcaatgc ctcagcggga ttttggagtt 900

gaccaaaatt ttcagagtgg agagataatc tcagctccaa cttcagctac caactctcca 960

agtgttggtt tggatatccc atttggtcag gctgatcagt tgtttcccaa cttctcattt 1020

gacggtccag gattcttttc ctaa 1044

<210>11

<211>347

<212>PRT

<213>Pyrus bretschneideri

<400>11

Met Glu Asn Cys Asn Ile His Trp Glu Gln Lys Ser Leu Val Asp Glu

1 5 10 15

Leu Ala Gln Gly Arg Glu Leu Ala Arg Gln Leu Gln Ile His Leu Asn

20 25 30

Val Pro Ser Ser Ser Tyr Gly Thr Arg Glu Leu Leu Val Gln Lys Ile

35 40 45

Ile Leu Ser Tyr Glu Lys Ala Leu Ser Met Leu Asn Ser Ser Ser Ser

50 55 60

Ala Ser Gly Gly Glu Gln Gln Gln Pro Thr Gly His Val Ala Ile Arg

65 70 75 80

Met Val Glu Ser Pro Pro His Ser Leu Asn Glu Ser Pro Arg Ser Glu

85 90 95

Asp Ser Asp Arg Glu Phe Lys Asp His Asp Asn Lys Asp Ser Ser Arg

100 105 110

Lys Arg Lys Asn Leu Pro Arg Trp Thr Gln Gln Ile Arg Val Thr Ser

115 120 125

Gly Met Gly Leu Glu Gly Pro Leu Asp Asp Gly Phe Ser Trp Arg Lys

130 135 140

Tyr Gly Gln Lys Asp Ile Leu Gly Ala Lys Tyr Pro Arg Gly Tyr Tyr

145 150 155 160

Arg Cys Thr His Arg Asn Val Gln Gly Cys Leu Ala Thr Lys Gln Val

165 170 175

Gln Arg Ser Asp Glu Asp Pro Thr Ile Phe Glu Ile Thr Tyr Arg Gly

180 185 190

Lys His Thr Cys Thr Gln Ala Ser Ala Gly Thr Ser Thr Pro Pro Ser

195 200 205

Pro Ser Pro Leu Gln Pro Glu Arg Thr Glu Arg Gln Asn Asn Leu Val

210 215 220

Asp Pro Gln Gln Asn Gln Gln Gln Ser Gln Gln His Thr Leu Leu Asn

225 230 235 240

Leu Pro Glu Gly Leu Arg Val Ile Thr Glu Gly Leu Asp Thr Arg Glu

245 250 255

Glu Leu Phe Pro Ser Phe Asn Ser Pro Ser Pro Leu Asn Asn Ser Tyr

260 265 270

Val Gly Ser Phe Tyr Pro Pro Phe Ala Gly Pro Thr Thr Ser Gly Thr

275 280 285

Asn Tyr Phe Ser Met Pro Gln Arg Asp Phe Gly Val Asp Gln Asn Phe

290 295 300

Gln Ser Gly Glu Ile Ile Ser Ala Pro Thr Ser Ala Thr Asn Ser Pro

305 310 315 320

Ser Val Gly Leu Asp Ile Pro Phe Gly Gln Ala Asp Gln Leu Phe Pro

325 330 335

Asn Phe Ser Phe Asp Gly Pro Gly Phe Phe Ser

340 345

<210>3

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggtgagctta ggagagggcc atggactc 28

<210>4

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgctgctcgt gtcgattcgg agatgccgg 29

<210>5

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggccatggct cagcttaccc ttctcacaaa tctg 34

<210>6

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ttggtgaccc ctcaccttct gtgttgtggg agcc 34

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

agctacatga cgccatttcc 20

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccctgtaaag cagcaccttc 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccaaggttgc agcagaagat 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tgtcaccaca atggaaagga 20

Claims

1. The application of the pear drought-induced transcription factor PbrWRKY53 or the protein coded by the same in improving the drought resistance of plants;

the nucleotide sequence of the pear drought-induced transcription factor PbrWRKY53 is shown in SEQ ID No. 1;

the amino acid sequence of the protein is shown as SEQ ID No. 2;

the plant comprises tobacco or autumn pear.

2. Use according to claim 1, wherein the plant is tobacco, comprising the following steps:

1) providing the pear drought-induced transcription factor PbrWRKY53 of claim 1;

3. Use according to claim 2, characterized in that step 1) is: performing PCR amplification by taking the pear leaf cDNA as a template to obtain a pear drought-induced transcription factor PbrWRKY 53; the primer pair for amplification comprises a forward primer F1 and a reverse primer R1; the sequence of the forward primer F1 is shown as SEQ ID No. 3; the sequence of the reverse primer R1 is shown as SEQ ID No. 4.

4. The use of claim 1, wherein the plant is a autumn pear, and the use is to transfer the pear drought-induced transcription factor PbrWRKY53 into a autumn pear by using a transient transformation method.