CN110408628B

CN110408628B - Stress resistance related protein and coding gene and application thereof

Info

Publication number: CN110408628B
Application number: CN201910756659.2A
Authority: CN
Inventors: 刘志鹏; 罗栋; 刘洁; 闫龙凤; 洪军; 刘芳; 吴昱果; 王彦荣
Original assignee: Lanzhou University
Current assignee: Lanzhou University
Priority date: 2019-08-16
Filing date: 2019-08-16
Publication date: 2021-01-15
Anticipated expiration: 2039-08-16
Also published as: CN110408628A

Abstract

The invention mainly relates to the field of biotechnology. The invention provides a stress resistance related protein and a coding gene thereof, an improved stress resistance related protein and a coding gene thereof, and application of the stress resistance related protein and the coding gene thereof in cultivating plant stress-resistant seeds. The protein expressed by the MsNTF2 gene and the recombinant MsNTF2 gene under the induction of salt, mannitol and ABA is positioned on a cell nucleus, an endoplasmic reticulum and a cell membrane, so that the drought resistance and the salt tolerance of a plant can be improved; compared with the original protein and the coding gene sequence thereof, the recombinant DNA sequence of the stress resistance related protein and the coded protein thereof are enhanced in stress resistance (especially drought resistance and saline-alkali resistance), provide a theoretical basis for manually controlling the expression of the stress resistance related gene, and are beneficial to cultivating plant varieties with stronger stress resistance or modifying the stress resistance of other plants.

Description

Stress resistance related protein and coding gene and application thereof

Technical Field

The invention mainly relates to the technical field of biology, in particular to stress resistance related protein and a coding gene and application thereof.

Background

Alfalfa (Medicago sativa L.) is called alfalfa, etc., and perennial herb plants of the genus Medicago of the family leguminosae, which are produced in xiaozia, iran, and caucasian wildrye, are cultivated in china, are cultivated in all countries of the world at present, are excellent forage plants, can be used as green manure, and can also be used as medicine. Alfalfa is the most widely cultivated legume grass in the world. The alfalfa is rich in high-quality dietary fiber, edible protein, multiple vitamins (including vitamin B, vitamin C, vitamin E, etc.), multiple beneficial minerals, and bioactive components such as saponin, flavonoids, carotenoid, phenolic aldehyde acid, etc. The alfalfa is wide in adaptability, prefers warm and semi-humid climatic conditions, is not suitable for being planted in strong acid and strong alkaline soil, prefers neutral or alkaline soil, and has the pH value of 7-8, the salt content of less than 0.3 percent and the underground water level of less than 1 m. Nodules cannot form when the pH of the soil is below 6, and can not grow due to calcium deficiency when the pH is below 5. The soluble salt content is higher than 0.3%, the chloride ion content is more than 0.03%, and the seedling growth is damaged by salt.

The alfalfa has the characteristics of high yield, rich nutrition, strong adaptability and the like. In China, the pasture is mainly planted in the northwest, the north China, the northeast and other areas, the planting area is about 133.33 ten thousand hm2, and the pasture becomes an important pasture supporting the development of the animal husbandry in China (Yanqingchuan and sun-shine tablets, 2011; national alfalfa industry development planning, 2017). However, in the above-mentioned areas, the growing conditions of drought and salinization of the land have made growing areas of alfalfa smaller and smaller, which poses a serious threat to the yield thereof (borecodes et al, 2011).

The stress (environmental stress) is also called environmental stress, and is a general term for various environmental factors that are unfavorable for the survival and growth of plants. The stress which has important influence on plants mainly comprises physical and chemical stresses such as water deficit (drought), low temperature, high salt, alkali, environmental pollution and the like, and biological stresses such as insect pests, weeds and the like.

Drought refers to a region with no rain or little rain at high temperature for a long time, which causes lack of water in the air and soil. While drought occurs primarily in connection with sporadic or periodic reductions in precipitation. Drought has the characteristics of high occurrence frequency, long duration, wide spread range and the like. The frequent occurrence and long-term persistence of drought can bring huge loss to agricultural production, and can also cause a plurality of ecological and environmental adverse effects such as water resource shortage, aggravation of desertification, frequent occurrence of sand storm and the like.

Too much soil salinity can reduce the water potential of the soil solution, which leads to serious physiological drought of plants, and the substances can not be absorbed, synthesized and transported in time. Meanwhile, high-concentration sodium ions can replace calcium ions combined on cell membranes, the membrane functions are changed, and substances inside and outside the cells can not selectively enter and exit. Excessive salt is often accumulated in plants growing on high-salinity soil, the metabolic process of the plants is affected, for example, excessive chloride ions can block the synthesis of protein and promote the accumulation of toxic substances and the decomposition of chloroplasts; potassium ions with certain concentration inhibit the generation of the dry weight and net photosynthetic rate of organic matters and the ATP enzyme activity of a root plasma membrane; high concentrations of sodium ions inhibit most enzyme activities, and excessive sodium and chloride ion levels also inhibit plant uptake of potassium, calcium, and the like. Under the salt stress, the starch formation process in stomatal guard cells is hindered, stomata cannot be closed, and plants quickly die due to water shortage. Salt stress also results in the production of reactive oxygen species such as free radicals, hydroxyl radicals, hydrogen peroxide and singlet oxygen, which can cause many biofunctional molecules to become non-functional.

Under the stress of adversity, plants generate a series of physiological and biochemical responses in order to respond to the adversity. Plants respond to drought and salt at the level of physiological, biochemical and metabolic pathways, with the vast majority of responses being attributable to changes in gene expression levels. The plant response to the stress is quite complex, and the plant responses step by step through a plurality of branched, parallel and mutually associated network modes. In short, after sensing and recognizing the stress signal, the plant transmits a cell surface stimulation signal to the inside of the cell to activate the transcription factor, thereby regulating the transcription expression of the downstream stress response gene. From a gene function perspective, these responses can be classified as regulating ion balance and ion compartmentalization, osmoregulation, antioxidant enzymes, calcium-related proteins, heat shock proteins, and the like.

Alfalfa currently has only a genome draft, and genetic experiments are difficult to develop. The animal husbandry is more and more important to the life of people, and it is impossible to plant the alfalfa according to the planting scale of the grains in the actual production, so that the existing problem is overcome by researching and improving the stress resistance of the alfalfa in combination with the requirement of the development of the animal husbandry on the alfalfa and the current situation of planting the alfalfa in the actual production.

On the same reason, other plants except the alfalfa, such as other types of forage grass, medicinal plants, ornamental plants and the like, also grow in the northwest, the north China, the northeast China and other areas, and the plants face the same survival problem as the alfalfa in the face of increasingly severe drought and land salinization.

Disclosure of Invention

The invention aims to provide a stress resistance related protein, a coding gene and application thereof.

The invention also aims to provide an improved stress resistance related protein, a coding gene and application thereof.

The invention is realized by the following technical scheme:

a DNA sequence coding for an anti-stress related protein, which comprises a DNA sequence which has at least 90 percent of homology with any one of the following DNA sequences a1) -a3) and codes for the anti-stress related protein:

a1) the coding region comprises a DNA sequence of the DNA sequence shown in SEQ ID NO.2 and codes for the stress resistance related protein;

a2) the coding region comprises a recombinant DNA sequence and a DNA sequence which codes for an anti-stress related protein; the recombinant DNA sequence is a sequence edited by at least one of the following editing modes of the DNA sequence shown by SEQ ID NO. 2:

a21) codons deleted for one or several amino acid residues;

a22) performing a mutation of one or several base pairs;

a23) codons for one or more amino acid residues are increased;

a3) DNA sequence which can hybridize with the DNA sequence of a1) or a2) and codes for an anti-stress related protein.

Further, the DNA sequence encoding the stress resistance related protein includes, but is not limited to, a DNA sequence whose coding region comprises the sequence represented by SEQ ID NO.16, SEQ ID NO.17 or SEQ ID NO. 18.

Further, the conditions of the hybridization operation referred to in the above a3) are: in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and then washed once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The application of the DNA sequence in the field of bioengineering comprises the preparation of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the DNA sequence and the like.

The application of the DNA sequence for coding the stress resistance related protein in obtaining transgenic plants with enhanced stress resistance.

An anti-stress related protein, which comprises the protein coded by the DNA sequence and obtained by artificial synthesis and/or biological expression.

Further, the protein includes, but is not limited to, a protein comprising an amino acid sequence shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5.

Further, the stress resistance comprises drought resistance and salt tolerance; the drought resistance refers to the ability to combat drought stress; the salt tolerance refers to the tolerance to salt stress.

Further, the salt stress specifically comprises the adversity or equivalent adversity with the final concentration of sodium ions of 150 mmol/L-200 mmol/L.

Further, the drought stress specifically comprises an adversity the same as or equal to a simulated adversity with a final concentration of Mannitol (Mannitol) of 300mmol/L to 500 mmol/L.

The invention also provides a primer for amplifying any segment in the DNA sequence, wherein the primer comprises a primer sequence shown in any one of SEQ ID NO.6 to SEQ ID NO. 15.

A method for obtaining a transgenic plant with enhanced stress resistance comprising the steps of:

introducing any one of the coding genes or the CDS region thereof into a target plant to obtain a transgenic plant seed; the transgenic plant seeds are artificially cultured or naturally grown into plants. The transgenic plants have increased stress resistance compared to the target plants.

Further, in the method for preparing the transgenic plant, the coding gene is introduced by a recombinant expression vector; the recombinant expression vector is obtained by inserting the coding gene into a recombination site of a Gateway system vector pEarleyGate 100.

Further, in any of the methods described above, the plant is a dicot or a monocot; preferably, the dicotyledonous plant is specifically Arabidopsis thaliana.

A transgenic plant with enhanced stress resistance is obtained.

The plant stress resistance related protein and the coding gene thereof are applied to enhancing the plant stress resistance, such as tobacco, arabidopsis thaliana, alfalfa and the like.

The invention has the beneficial effects that:

firstly, experiments prove that the gene encoding MsNTF2 is obtained by cloning from alfalfa, the expression is increased under the induction of drought, salt and ABA, and the encoded protein is positioned on cell nucleus, endoplasmic reticulum and cell membrane; the DNA sequence of the invention can improve the drought resistance and salt tolerance of plants, provides a foundation for artificially controlling the expression of stress resistance related genes, and plays an important role in the breeding work of cultivating plants with enhanced stress resistance.

Compared with the original protein and the coding gene sequence thereof, the DNA sequence of the recombinant stress resistance related protein and the coded protein thereof are obviously enhanced in stress resistance (especially drought resistance and saline-alkali resistance), and are favorable for cultivating plant varieties with stronger stress resistance or modifying the stress resistance of other plants.

Drawings

To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, and it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope of the present invention.

Figure 1 homology alignment of MsNTF2 with the amino acid sequences of 14 species.

FIG. 2 shows Real-time PCR (Real-time fluorescence quantification) analysis of stress-induced expression of MsNTF2 gene; wherein (A) is a graph showing MsNTF2 expression when stressed with 500mmol/L mannitol; (B) the chart shows the expression of MsNTF2 under 150mmol/L sodium ion stress; (C) the graph shows MsNTF2 expression when stressed with 80. mu. MABA.

FIG. 3 subcellular localization of MsNTF2 in tobacco lamina; wherein 3-1 is a GFP fluorescence image; 3-2 is a fluorescence image of marker; 3-3 are bright field images; 3-4 are coincident images.

FIG. 4 shows the molecular detection of a gene of interest in transgenic Arabidopsis thaliana.

FIG. 5 is a graph showing the results of comparison between drought resistance of transgenic Arabidopsis and wild type; wherein 5A is the comparison of the germination conditions of the wild type strain and the transgenic strain in different culture media; 5B is the germination rate of the wild type and the transgenic strain in different culture media; 5C is the comparison of the root length of the wild type strain and the transgenic strain in different culture media respectively; 5D is the root length (left) and fresh weight (right) of the wild type and the transgenic line in different culture media respectively; 5E is the comparison of the growth conditions of the wild type and the transgenic line before dehydration treatment, after dehydration treatment and after water supply recovery; 5F is a comparison of survival rates of wild type and transgenic lines after drought stress.

FIG. 6 is a graph showing the results of comparison between the salt tolerance of transgenic Arabidopsis and the wild type; wherein 6A is the comparison of the germination conditions of wild type and transgenic lines in different culture media; 6B is the germination rate of the wild type and the transgenic line respectively in different culture media; 6C is the comparison of the root length of the wild type strain and the root length of the transgenic strain in different culture media respectively; 6D is the root length (left) and fresh weight (right) of the wild type and the transgenic line respectively in different culture media; 6E is a comparison of the growth of wild type and transgenic lines before and after salt treatment, respectively.

Detailed Description

In the present document, the parts or percentages are by mass unless otherwise indicated.

The invention provides a DNA sequence for coding an anti-stress related protein, which comprises a DNA sequence which has at least 90 percent of homology with any one of the following DNA sequences a1) -a3) and codes the anti-stress related protein:

a1) the coding region comprises a DNA sequence shown in SEQ ID NO.2 and codes a DNA sequence of the stress resistance related protein;

a2) the coding region comprises a recombinant DNA sequence and a DNA sequence which codes for an anti-stress related protein; the recombinant DNA sequence is a sequence edited by a DNA sequence shown by SEQ ID NO.2 in at least one editing mode as follows:

a21) codons deleted for one or several amino acid residues;

a22) performing a mutation of one or several base pairs;

a23) codons for one or more amino acid residues are increased;

In some embodiments, the DNA sequence encoding an anti-stress related protein includes, but is not limited to, a DNA sequence whose coding region comprises the sequence represented by SEQ ID No.16, SEQ ID No.17 or SEQ ID No. 18.

In some embodiments, the hybridization conditions of a3) above are: in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and then washed once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The invention also provides application of the DNA sequence in the field of bioengineering, and the application comprises preparation of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the DNA sequence and the like.

Wherein the recombinant vector is obtained by inserting the DNA sequence into an expression vector to express the protein. The recombinant vector can be used for constructing a recombinant vector containing the gene by using an existing plant expression vector. The plant expression vector type can be a recombinant vector of a Gateway system or a traditional enzyme cutting vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like.

The invention also provides the application of the DNA sequence for coding the stress resistance related protein in obtaining transgenic plants with enhanced stress resistance.

The invention also provides a protein related to stress resistance, which comprises the protein coded by the DNA sequence and obtained by artificial synthesis and/or biological expression.

In some embodiments, the stress resistance-associated protein comprises: the protein comprises an amino acid sequence shown by SEQ ID NO.1(MsNTF2, the DNA sequence is SEQ ID NO.2), SEQ ID NO.3 (23 amino acid sequences are inserted before the first amino acid of the MsNTF2 protein, namely the 1 st to 23 th amino acid sequences of the SEQ ID NO.3 sequence; the DNA sequence is SEQ ID NO.16), SEQ ID NO.4 (amino acid T sequence amino acid S sequence substitution of the 38 th position of the MsNTF2 protein; the DNA sequence is SEQ ID NO.17), SEQ ID NO.5 (two 14 th to 15 th amino acids of the MsNTF2 protein are deleted, the specific deletion sequence is DS; and the DNA sequence is SEQ ID NO. 18). The coding regions of the above-exemplified mutant DNA sequences have at least 90% homology with the DNA sequence shown in SEQ ID NO.2, are highly homologous sequences of the gene encoding the MsNTF2 protein, and the proteins encoded by the sequences have highly similar stress resistance to the MsNTF2 protein.

In some embodiments, the stress resistance is specifically drought resistance and salt tolerance; the drought resistance refers to the ability to combat drought stress; the salt tolerance refers to the tolerance to salt stress.

In some embodiments, the salt stress specifically comprises an adversity or equivalent adversity with a final sodium ion concentration of 150mmol/L to 200 mmol/L; specifically, the method includes, but is not limited to, stress with a final sodium ion concentration of 150mmol/L, 165mmol/L or 200 mmol/L.

In some embodiments, the drought stress specifically comprises an adversity the same or equivalent to a simulated adversity having a final Mannitol concentration of 300mmol/L to 500 mmol/L; specifically, the stress is the same as or equivalent to 300mmol/L mannitol, 400mmol/L mannitol, 500mmol/L mannitol or natural dehydration.

The invention also provides a primer for amplifying any one DNA sequence of a1) -a3) or any partial fragment thereof, including but not limited to a primer sequence shown as any one of sequences SEQ ID NO. 6-SEQ ID NO. 15.

The invention also provides a method for obtaining the transgenic plant with enhanced stress resistance, which comprises the following steps:

introducing any one of the coding genes into a target plant genome to obtain a transgenic plant seed; the transgenic plant seeds are artificially cultured or naturally grown into plants. The transgenic plants have increased stress resistance compared to the target plants.

In some embodiments, in the method for producing a transgenic plant, the introduction of the coding gene is achieved by introduction of a recombinant expression vector; the recombinant expression vector is obtained by inserting the coding gene into a recombination site of a Gateway system vector pEarleyGate 100.

In some embodiments, in the above method for obtaining a transgenic plant with enhanced stress resistance, the plant is arabidopsis thaliana.

The invention also provides a transgenic plant with enhanced stress resistance, which comprises any one of the DNA sequences a1) -a 3).

The invention also discloses the application of the plant stress resistance related protein and the coding gene thereof in enhancing the plant stress resistance. For example, it is used for tobacco, Arabidopsis thaliana and other plants to enhance their stress resistance.

Embodiments of the present invention will be described in detail below with reference to specific examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The protein related to stress resistance in the embodiment of the invention is named as MsNTF2, is a protein of NUCLEAR TRANSPORT FACTOR (NUCLEAR TRANSPORT FACTOR 2) containing NTF2-like conserved functional domain, is derived from Medicago sativa L (Medicago sativa L.) of the Leguminosae family, is composed of 177 amino acid residues, and has unknown function.

Example 1: cloning and sequencing the MsNTF2 Gene

The method comprises the following steps:

the experimental material adopted in the example is alfalfa No. 1. Selecting 10 healthy and plump seeds, germinating at 25 ℃ for 5 days by adopting a double-layer filter paper germination method until cotyledons are unfolded, transferring to 1/2MS water culture nutrient solution, and changing the nutrient solution every two days. After 7 days, 1/2MS nutrient solution is added with sodium chloride until the final concentration of sodium chloride is 150mmol/L, treated for 24 hours, rapidly sampled on the ground and underground respectively, and then quickly frozen by liquid nitrogen and stored at-80 ℃ for later use.

The RNA of the sample is extracted by a Trizol method, and the RNA is reversely transcribed into cDNA by a cDNA synthesis reverse transcription kit. The total volume of the PCR amplification system is 50 mul, which comprises 10 mul of 5 XPPhusion HF Buffer and 4 mul of 2.5mmol/L dNTP; primer (SEQ ID NO.6) MsNTF2-F (5 '-3'): atggatgctggaaaagagactag 1 μ l; (SEQ ID NO.7) MsNTF2-R (5 '-3'): tcaaacagttggatccttccc 1 μ l, ddH₂O32.5. mu.l, Phusion DNA polymerase0.5. mu.l and cDNA 1. mu.l; the amplification conditions were: (1) pre-denaturation at 98 ℃ for 30 s; (2) denaturation at 98 ℃ for 10 s; (3) annealing at 57 ℃ for 30 s; (4) extension at 72 ℃ for 15 s; (5)2-4, circulating the steps for 32 times; (6) extending for 5min at 72 ℃; (7) stop at 16 ℃. One round of PCR product was obtained.

The PCR product of one round was detected in 1% agarose, and a 534bp DNA fragment was recovered and subjected to A-addition reaction. The total volume of the reaction system was 50. mu.l, which included 25. mu.l of 2 XEcoTaq PCR Supermix and 25. mu.l of the recovered product. The amplification conditions were: (1) denaturation at 94 deg.C for 5 min; (2) denaturation at 72 deg.C for 30 min; (3) stop at 16 ℃. Two rounds of PCR products were obtained.

The two-round PCR products were purified and ligated into the pMD19-T vector before transformation into E.coli DH 5. alpha. competent cells. Escherichia coli containing pMD19-T-MsNTF2 plasmid is spread on LB culture medium containing Amp, IPTG and X-Gal, cultured overnight at 37 ℃, 3 positive clone bacterial plaques are picked, and cultured with shaking overnight at 37 ℃ in LB liquid culture medium containing Amp. After the detection, the bacterial liquid conforms to the size of the expected strip and is sent to Shanghai biological engineering Co. Sequencing results show that the amplified PCR product has a nucleotide sequence in SEQ ID NO.2 and is named as MsNTF2 gene, the protein coded by the gene is named as MsNTF2 protein, and the protein sequence is shown as SEQ ID NO. 1.

The MsNTF2 protein is aligned on GeneBank (figure 1), and has the highest XP _003591689.1 homology with medicago truncatula, but the functions of homologous genes of the medicago truncatula are not reported in other species at present.

Example 2: real-time fluorescent quantitative PCR analysis of MsNTF2 expression characteristics

The method comprises the following steps:

alfalfa seed germination and hydroponic methods were as in example 1. The 12-day-old seedling of alfalfa was treated as follows:

drought treatment: 1/2MS the water culture nutrient solution is added with mannitol to a final concentration of 500mmol/L and treated for 0, 1, 3, 6, 12 and 24 hours respectively. Sampling above ground and underground respectively, quick freezing with liquid nitrogen, and storing at-80 deg.C for use.

Salt treatment: 1/2MS the water culture nutrient solution is added with sodium chloride to a final concentration of 150mmol/L and treated for 0, 1, 3, 6, 12 and 24 hours respectively. Sampling above ground and underground respectively, quick freezing with liquid nitrogen, and storing at-80 deg.C for use.

ABA (phytohormone abscisic acid) treatment: 1/2MS ABA was added to the water culture broth to a final concentration of 80. mu. mol/L and treated for 0, 1, 3, 6, 12 and 24 hours, respectively. Sampling above ground and underground respectively, quick freezing with liquid nitrogen, and storing at-80 deg.C for use.

Sample RNA extraction and reverse transcription of cDNA was performed as in example 1. The cDNA was diluted to 50 ng/. mu.L. With (SEQ ID NO.8) qRTMsNTF2-F (5 '-3'): gaggactggtgggacaaaaaac and (SEQ ID NO.9) qRTMsNTF2-R (5 '-3'): ttggatccttcccgaacctc the expression level of the target gene was measured using MsACTIN-F (5 '-3') actggaatggtgaaggctgg and MsACTIN-R (5 '-3') tgacaataccgtgctcaatgg as internal references. The total volume of the PCR detection system is 20 μ l, which comprises 10 μ l of 2xSG Fast qPCR Master Mix, 0.5 μ l of primer qRTMsNTF2-F, 0.5 μ l of primer qRTMsNTF2-R, 2 μ l of DNF buffer, ddH₂O5. mu.l and cDNA 2. mu.l; the amplification conditions were: (1) pre-denaturation at 95 ℃ for 10 min; (2) denaturation at 95 ℃ for 15 s; (3) annealing at 60 deg.C for 1 min; (4) and (3) circulating the steps (2) - (3) for 40 times. The qRT-PCR reaction was performed on ABI7500 real-time fluorescent quantitative PCR with 3 technical replicates per sample set.

The relative expression amount is calculated by a 2-delta Ct method: Δ Δ Ct ═ C_{t. target Gene}-C_{t. reference gene})_{Time x}-(C_{t. target Gene}-C_{t. reference gene})_{Time 0}(ii) a Time x represents 1, 3, 6, 12 orAt any point in 24 hours, where X has a value of 1, 3, 6, 12, or 24. Time 0 indicates 0 hours of stress treatment (control). Mapping was performed using Origin 9 software.

The results are shown in fig. 2, MsNTF2 gene was induced only by Mannitol stress in the aerial part of alfalfa, but MsNTF2 gene was significantly induced by Mannitol, sodium chloride and ABA in the underground part of alfalfa. It was shown that MsNTF2 is stress-induced, but to a different extent in plants above and below ground, MsNTF2 is more sensitive to the stress environment in the underground part.

Example 3: MsNTF2 subcellular localization analysis

The method comprises the following steps:

1. material preparation

And (3) putting a proper amount of Nicotiana benthamiana seeds into a centrifugal tube, soaking the Nicotiana benthamiana seeds in distilled water for 2 hours, dibbling the Nicotiana benthamiana seeds in soil by using a pipette, and taking the plants as transformation receptors after 6 to 7 weeks.

2. Construction of subcellular vectors

Primers MsNTF2-GFP-F and MsNTF2-GFP-R are designed according to the sequence of the MsNTF2 gene, and XhoI and SaI I enzyme cutting sites are respectively introduced into the 5' end of the primers:

(SEQ ID NO.10)MsNTF2-GFP-F(5’-3’)：gcctcgagatggatgctggaaaagagactag

(SEQ ID NO.11)MsNTF2-GFP-R(5’-3’)：gcgtcgactcaaacagttggatccttccc

PCR was performed using the alfalfa cDNA of example 1 as a template, using MsNTF2-GFP-F and MsNTF 2-GFP-R. The total volume of the PCR amplification system is 50 μ L, wherein the total volume comprises 10 μ L of 5 XPPhusion HF Buffer and 1 μ L of 2.5mmol/L dNTP 4 μ L primer MsNTF 2-GFP-F; MsNTF 2-GFP-R1. mu.l, ddH2O 32.5.5. mu.l, Phusion DNA Polymerase 0.5. mu.l and cDNA 1. mu.l; the amplification conditions were: (1) pre-denaturation at 98 ℃ for 30 s; (2) denaturation at 98 ℃ for 10 s; (3) annealing at 57 ℃ for 30 s; (4) extension at 72 ℃ for 15 s; (5) the steps (2) - (4) are circulated for 32 times; (6) extending for 5min at 72 ℃; (7) stop at 16 ℃. PCR amplification products were obtained and detected on a 1.5% agarose gel, confirming that the product size was about 550 bp.

Recovering and purifying the PCR amplification product, performing enzyme digestion by using restriction enzymes XhoI and SaI I, and recovering the PCR product after enzyme digestion to obtain an enzyme digestion product with the size of 537 bp; at the same time, the PBI121-GFP expression vector was digested with restriction enzymes XhoI and SaI, and the vector backbone of about 1.4kb in size was recovered.

The enzyme-cleaved product of the target gene was ligated with the vector backbone of the PBI121-GFP expression vector overnight at 4 ℃ using DNA ligase (TaKaRa, cat # 6022). The ligation products were heat shock transformed into E.coli DH5 α, cultured overnight at 37 ℃, PCR-detected positive clones and sequenced.

Selecting a positive clone plasmid with a sequencing sequence completely consistent with the CDS sequence of MsNTF2, transforming agrobacterium tumefaciens EHA105 by the vector to obtain recombinant agrobacterium tumefaciens EHA105/pBI121-MsNTF2-GFP, mixing the recombinant agrobacterium tumefaciens EHA105/pBI121-MsNTF2-GFP with 50% glycerol according to the volume ratio of 1:1, quickly freezing by liquid nitrogen, and storing at-80 ℃ for later use.

3. Strain activation

The recombinant Agrobacterium EHA105/pBI121-MsNTF-GFP taken out at-80 ℃ was placed on ice, 10. mu.L of the resultant was pipetted and inoculated into 3mL of LB liquid medium containing 50mg/mL of rifampicin and 50mg/mL of kanamycin, and cultured at 28 ℃ and 200rpm for 24 hours.

Transferring 50 μ L of shake-down bacteria into 100mL LB (containing 50mg/mL rifampicin and 50mg/mL kanamycin) culture medium, culturing at 28 deg.C and 200rpm for 16-20 hr to OD₆₀₀＝0.5～1。

Centrifuging 4500g of jolt-eye bacteria solution at 4 deg.C for 15min, collecting thallus, and resuspending to OD with MS heavy suspension₆₀₀And (4) resuscitating at 120rpm for 2-3 h under the condition of 0.4-0.6, and then injecting the tobacco leaves.

4. Injection method for transforming tobacco leaf

Sufficient water is poured into the tobacco before injection, and the tobacco is cultured for 2-3 h under a fluorescent lamp. 1mL of the bacterial injection was aspirated and injected from the back of the tobacco leaf into the leaf. After injection, spraying water to the tobacco leaves, placing the tobacco leaves in an incubator at 25 ℃ for dark culture (sleeved with a black plastic bag) for 24h, and then normally culturing (16h light/8 h dark).

Observation of the expression of the target protein by fluorescence microscopy or confocal laser microscopy (direct observation)

2-3 days after injection, placing a small piece of the infected area on a glass slide, observing under a fluorescence microscope, photographing by using a confocal microscope if the infected area is expressed, and taking the tobacco of the ER-Maker (mCherry, RFP) as a reference.

As a result, as shown in FIG. 3, the MsNTF2 gene was localized in the nucleus, endoplasmic reticulum and cell membrane.

Example 4: application of MsNTF2 in improvement of stress resistance of arabidopsis thaliana

The method comprises the following steps:

one, transfer MsNTF2 Arabidopsis thaliana

1. Construction of recombinant vectors

1) TOPO cloning of MsNTF2 Gene

Using pENTR^TMDirectional

Cloning Kits (Invitrogen, Cat.: K2400-20) and Phusion Hi-Fi enzyme (Thermo Fisher Scientific, Cat.: F530-S) were used to clone the genes. Designing a primer pair (MsNTF2-GT-F and MsNTF2-GT-R) according to the sequence of the MsNTF2 gene, introducing a recognition site of a ' CACC ' PENTR/D-TOPO entry vector into the 5 ' end of the upstream primer:

(SEQ ID NO.12)MsNTF2-GT-F(5’-3’)：caccatggatgctggaaaagagactag

(SEQ ID NO.13)MsNTF2-GT-R(5’-3’)：tcaaacagttggatccttccc

the total volume of the PCR amplification system is 50 μ L, wherein the total volume comprises 10 μ L of 5 XPPhusion HF Buffer and 1 μ L of 2.5mmol/L dNTP 4 μ L primer MsNTF 2-GT-F; MsNTF 2-GT-R1. mu.l, ddH₂O32.5. mu.l, Phusion DNA Polymerase 0.5. mu.l and cDNA 1. mu.l; the amplification conditions were: (1) pre-denaturation at 98 ℃ for 30 s; (2) denaturation at 98 ℃ for 10 s; (3) annealing at 57 ℃ for 30 s; (4) extension at 72 ℃ for 15 s; (5)2-4, circulating the steps for 32 times; (6) extending for 5min at 72 ℃; (7) stop at 16 ℃. A PCR product of 534bp in size was obtained.

2) TOPO connection

The PCR product was purified and ligated with PENTR/D-TOPO entry vector. The ligation products were heat shock transformed into E.coli DH5 α, cultured overnight at 37 ℃, PCR-detected positive clones and sequenced.

3) LR connection

Selecting a sequencing sequence and a CDS sequence of the MsNTF2 geneThe positive clones that were completely identical were extracted as plasmids. Using LR

II Plus Enzyme Mix (Invitrogen, cat # 11791-020) an LR ligation reaction was performed on the entry vector plasmid with the pEarleyGate100 expression vector. The ligation product was transformed into E.coli DH5 alpha, 37 by heat shock^℃Culturing overnight, detecting positive clone by PCR and extracting plasmid.

4) Obtaining recombinant Agrobacterium

Transforming agrobacterium EHA105 with the recombinant pEarleyGate100-MsNTF2 vector to obtain recombinant agrobacterium EHA105/pEarleyGate100-MsNTF2, mixing with 50% glycerol in the volume ratio of 1:1, quick freezing with liquid nitrogen, and storing at-80 deg.C for later use.

2. Transgenic MsNTF2 Arabidopsis

The recombinant Agrobacterium EHA105/pEarleyGate100-MsNTF2 was removed from-80 ℃ and placed on ice, 10. mu.L of the resulting solution was pipetted and inoculated into 3mL of LB liquid medium (containing 50mg/mL rifampicin and 50mg/mL kanamycin), and cultured at 28 ℃ and 200rpm for 24 hours.

Transferring 2mL of the shake culture solution into 200mL of LB medium (containing 50mg/mL rifampicin and 50mg/mL kanamycin), culturing at 28 ℃ and 200rpm for 20-24 hours to OD₆₀₀＝1.2-2.0。

Centrifuging 4500g of jolt-eye bacteria liquid at 4 ℃ for 15min, collecting thallus, and resuspending to OD with 5% sucrose₆₀₀Flower soak buffer 0.8.

Soaking an arabidopsis thaliana (Col-0) inflorescence into the dye solution for 3-5 seconds;

after soaking, the flowerpot is taken out and covered with a black plastic bag, and after 24 hours, the flowerpot is taken down and continuously cultured in a greenhouse. Infestation 2 after 1 week.

Harvesting of T₁Seed generation, positive plants are selected by glufosinate ammonium (PPT, 10mg/mL) and passaged until T₃And obtaining homozygous lines by generations.

T2 represents the seeds from T1 generation selfing and the plants it grows into, and T3 represents the seeds from T2 generation selfing and the plants it grows into.

Whole plant of T3 generation regenerated plantThe DNA of the strain was used as a template, and the DNA of the strain was amplified using a primer set for the desired gene [ (SEQ ID NO.14)35sF (5 '-3'): gcacaatcccactatccttc and (SEQ ID NO.15) MsNTF2-R (5 '-3'): tcaaacagttggatccttccc]And Bar primer pair [ Bar-F (5 '-3'): tgcaccatcgtcaaccacta and Bar-R (5 '-3'): acagcgaccacgctgttgaa]PCR amplification was performed. The PCR detection system and the amplification condition of the target gene primer pair and the Bar primer pair are consistent. The total volume of the PCR detection system is 20 mul, which comprises 2 XEcoTaq PCR Supermix 10 mul, upstream primer 1 mul, downstream primer 1 mul, ddH₂O6. mu.l and plant DNA template, 50 ng/. mu.l, 2. mu.l; the amplification conditions were: (1) pre-denaturation at 94 ℃ for 3 min; (2) denaturation at 94 ℃ for 30 s; (3) annealing at 57 ℃ for 30 s; (4) extension at 72 ℃ for 30 s; (5)2-4, circulating the steps for 38 times; (6) extension at 72 ℃ for 7 min. As a result, as shown in FIG. 4 (A), 18 homozygote lines at the T3 generation amplified a single band at 534 bp.

RNA of the whole plant of the regenerated plant of the T3 generation is extracted and is reversely transcribed into cDNA as a template, and qRT-PCR amplification is carried out by using a target gene partial fragment primer pair qRTMsNTF2-F and qRTMsNTF2-R and using AtACTIN-F (5 '-3') tgtgccaatctacgagggttt and AtACTIN-R (5 '-3') tttcccgctctgctgttgt as internal references. The total volume of the PCR detection system is 20 mul, which comprises 10 mul of 2xSG Fast qPCR Master Mix, 0.5 mul of primer qRTMsNTF2-F, 0.5 mul of primer qRTMsNTF2-R, 2 mul of DNF buffer, 2 mul of ddH2O 5 mul and 2 mul of cDNA; the amplification conditions were: (1) pre-denaturation at 95 ℃ for 10 min; (2) denaturation at 95 ℃ for 15 s; (3) annealing at 60 deg.C for 1 min; (4) and (3) circulating the steps (2) - (3) for 40 times. As a result, as shown in FIG. 4 (B), MsNTF2 was not expressed in the wild type and was expressed to a different degree in the homozygous lines. 3 high-expression homozygous lines were selected for subsequent physiological analysis.

Second, evaluation of stress resistance of transgenic plants

1. Evaluation of drought resistance of transgenic plants

1) Effect of drought stress on germination Rate

After 49 seeds of 3 representative strains OE13, OE16 and OE17 of MsNTF2 Arabidopsis thaliana transformed by T3 generation and wild WT are sterilized, uniformly dotting the seeds on an MS culture medium and an MS culture medium containing 300mmol/L mannitol or 400mmol/L mannitol by using a 10-microliter tip, sealing by using a sealing film, carrying out low-temperature treatment at 4 ℃ for 3 days, then transferring the seeds into an incubator at 22 ℃, 16h illumination-8 h dark and 60% relative humidity for culturing for 7 days, counting the germination rate every day, setting three biological repetitions for each treatment, averaging the results and calculating the standard deviation.

The results are shown in FIGS. 5A and 5B, where the germination rates and germination rates of wild-type and transgenic lines were essentially identical on MS plates; on the 300mmol/L mannitol or 400mmol/L mannitol plate, the germination rate and the germination rate of the MsNTF2 transgenic Arabidopsis thaliana strain are obviously higher than those of the wild type.

2) Effect of drought stress on root length and fresh weight

49 seeds of 3 representative strains OE13, OE16 and OE17 of MsNTF2 Arabidopsis thaliana transformed by T3 are sterilized, uniformly paved on an MS culture medium by using a 1mL gun head, sealed by a sealing film, treated at a low temperature of 4 ℃ for 3 days, moved into an incubator with a relative humidity of 60 percent at a temperature of 22 ℃, 16h light and 8h dark for 7 days, moved onto the MS culture medium and an MS culture medium containing 300mmol/L mannitol or 400mmol/L mannitol, counted for root length after 12 days, three biological repetitions are set for each treatment, and the results are averaged and the standard deviation is calculated.

Results as shown in 5C and 5D in FIG. 5, the wild type and transgenic lines were essentially identical in root length and fresh weight on MS plates; on the 300mmol/L mannitol or 400mmol/L mannitol plate, the root length and fresh weight of the transgenic line are obviously larger than those of the wild type.

3) Effect of soil drought on survival

Sterilizing 49 seeds of 3 representative strains OE13, OE16 and OE17 of MsNTF2 Arabidopsis thaliana T3, uniformly spreading the seeds on an MS culture medium by using a 1mL gun head, sealing by using a sealing film, carrying out low-temperature treatment at 4 ℃ for 3 days, transferring the seeds into an incubator at 22 ℃, 16h light-8 h dark and 60% relative humidity for 14 days, transferring the seeds into small square pots with consistent soil weight, carrying out normal culture for 14 days, pouring water in the square pots until the square pots are saturated, then starting water-cut and drought treatment until the wild type wilts, then carrying out rehydration for one week, observing phenotype, counting survival rate and taking pictures.

The results are shown in FIG. 5E, before drought, the growth conditions of the transgenic lines and the wild type are substantially consistent; after drought, the growth condition of the transgenic line is obviously better than that of the wild type; after rehydration, the survival rate of the transgenic line was also higher than that of the wild type (5F in fig. 5).

2. Salt tolerance evaluation of transgenic plants

1) Effect of salt stress on Germination Rate

After 49 seeds of 3 representative strains OE13, OE16 and OE17 of MsNTF2 Arabidopsis thaliana transformed by T3 generation and wild WT are sterilized, uniformly dotting the seeds on an MS culture medium and an MS culture medium containing 150mmol/L sodium chloride or 200mmol/L sodium chloride by using a 10-microliter tip, sealing by using a sealing film, carrying out low-temperature treatment at 4 ℃ for 3 days, then transferring the seeds into an incubator with 22 ℃, 16h illumination-8 h darkness and 60% relative humidity for culturing for 7 days, counting the germination rate every day, setting three biological repetitions for each treatment, averaging the results and calculating the standard deviation.

The results are shown in FIGS. 6A and 6B, in which germination rates and germination rates of wild-type and transgenic lines were substantially identical on the MS plates; on the 150mmol/L sodium chloride or 200mmol/L sodium chloride plate, the germination rate and germination speed of the transgenic line are obviously higher than those of the wild type.

2) Effect of salt stress on root Length and fresh weight

49 seeds of 3 representative strains OE13, OE16 and OE17 of T3 MsNTF2 Arabidopsis thaliana and wild WT are sterilized, uniformly spread on an MS culture medium by using a 1mL gun head, sealed by a sealing film, treated at a low temperature of 4 ℃ for 3 days, moved into an incubator with a relative humidity of 60 percent at a temperature of 22 ℃, 16h light and 8h dark for 7 days, moved onto the MS culture medium and an MS culture medium containing 150mmol/L sodium chloride or 200mmol/L sodium chloride, counted for root length after 12 days, three biological repetitions are set for each treatment, and the results are averaged and the standard deviation is calculated.

The results are shown in FIGS. 6C and 6D, where the root length and fresh weight of wild type and transgenic lines were essentially identical on the MS plates; on the 150mmol/L sodium chloride or 200mmol/L sodium chloride plate, the root length and fresh weight of the transgenic line are obviously larger than those of the wild type.

3) Effect of soil salt stress on survival

3 representative strains OE13, OE16 and OE17 of MsNTF2 Arabidopsis thaliana of T3 generation and 49 seeds of wild WT are respectively sterilized, uniformly spread on an MS culture medium by using a 1mL gun head, sealed by a sealing film, treated at a low temperature of 4 ℃ for 3 days, transferred into an incubator with 22 ℃, 16h of illumination-8 h of darkness and 60% of relative humidity for culture for 14 days, and transferred into a small square pot with consistent soil weight. After normal culture for 14 days, salt treatment was started, and 100mL of 50mmol/L aqueous sodium chloride solution was poured into each square pot, and the sodium chloride concentration was increased by 50mmol/L every day until the final concentration was 200mmol/L, and the treatment was carried out at this concentration for 20 days, once every three days. Watch phenotype, count survival and take pictures.

The results are shown in FIG. 6E, before salt treatment, the growth conditions of the transgenic lines and the wild type are basically consistent; after salt treatment, the growth of the transgenic line is obviously better than that of the wild type.

The examples of the present invention only take MsNTF2 as an example for the confidence verification analysis, while for other exemplified mutant DNA sequences (such as SEQ ID NO.16, SEQ ID NO.17, and SEQ ID NO.18), since their coding regions all have at least 90% homology with the DNA sequence shown in SEQ ID NO.2, as the highly homologous sequence of MsNTF2, their encoded proteins all have highly similar stress resistance to the MsNTF2 protein, similar experimental results and identical experimental conclusions can be drawn according to the experimental design of the above examples 1 to 4.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Sequence listing

<110> Lanzhou university

<120> stress resistance related protein and coding gene and application thereof

<130> PA19027638

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 177

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Asp Ala Gly Lys Glu Thr Ser Tyr Lys Glu Ala Phe Asp Ser Thr

1 5 10 15

Ala Lys Lys Ser Ile Ala Asp Ala Ile Ile Pro His Ile Leu Arg Leu

20 25 30

Tyr Gly Ser Cys Ala Thr Ala Arg Asp Phe Glu Ile Tyr Ala Pro Asp

35 40 45

Ala Ser Phe Glu Asp Pro Leu Met Arg Ala Gln Gly Val Lys Gln Ile

50 55 60

Lys Ser Ala Phe Tyr Ser Leu Pro Lys Leu Phe Ser Glu Ser Lys Ile

65 70 75 80

Val Glu Tyr Ser Val Glu Glu Asn Ile Val Ser Pro Gly Lys Gly Glu

85 90 95

Ile Leu Ile Asp Asn Lys Gln His Tyr Lys Ile Leu Gly Lys Asp Ile

100 105 110

Asp Met Val Ser Leu Ile Lys Leu Ser Val Glu Glu Gly Lys Val Ile

115 120 125

Arg His Glu Asp Trp Trp Asp Lys Lys Pro Ile Ser Asn Arg Glu Thr

130 135 140

Val Lys Leu Pro Leu Leu Gly Arg Val Ala Glu Met Thr Arg Arg Gly

145 150 155 160

Ser Met Leu Ala Thr His Val Phe Met Arg Phe Gly Lys Asp Pro Thr

165 170 175

Val

<210> 2

<211> 534

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggatgctg gaaaagagac tagttacaaa gaagcatttg attccactgc caaaaagtct 60

attgctgatg ccatcattcc tcatattctt cgtctatatg gatcatgtgc cacggctcgc 120

gattttgaaa tctatgcccc agatgcttcc tttgaggatc cccttatgcg tgcacaaggg 180

gtgaagcaga tcaaatcagc attctactct ctccctaagc tgtttagtga gtcaaagatt 240

gtggaataca gtgttgaaga aaatatagtt tcaccaggaa aaggagagat attaattgac 300

aataaacaac actataaaat cttggggaag gatatagata tggtatcgct aatcaagttg 360

tctgttgagg agggtaaagt tattcgccat gaggactggt gggacaaaaa accaatttct 420

aatcgagaaa ccgtaaagct gccattgctt ggccgagttg cagaaatgac tcgcaggggt 480

tctatgctag caactcatgt gtttatgagg ttcgggaagg atccaactgt ttga 534

<210> 3

<211> 200

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Tyr His Val Thr Arg Phe Arg His Ile Thr Pro Ser Thr Ser Leu

1 5 10 15

Cys Leu Ser Arg Lys Phe Ala Met Asp Ala Gly Lys Glu Thr Ser Tyr

20 25 30

Lys Glu Ala Phe Asp Ser Thr Ala Lys Lys Ser Ile Ala Asp Ala Ile

35 40 45

Ile Pro His Ile Leu Arg Leu Tyr Gly Ser Cys Ala Thr Ala Arg Asp

50 55 60

Phe Glu Ile Tyr Ala Pro Asp Ala Ser Phe Glu Asp Pro Leu Met Arg

65 70 75 80

Ala Gln Gly Val Lys Gln Ile Lys Ser Ala Phe Tyr Ser Leu Pro Lys

85 90 95

Leu Phe Ser Glu Ser Lys Ile Val Glu Tyr Ser Val Glu Glu Asn Ile

100 105 110

Val Ser Pro Gly Lys Gly Glu Ile Leu Ile Asp Asn Lys Gln His Tyr

115 120 125

Lys Ile Leu Gly Lys Asp Ile Asp Met Val Ser Leu Ile Lys Leu Ser

130 135 140

Val Glu Glu Gly Lys Val Ile Arg His Glu Asp Trp Trp Asp Lys Lys

145 150 155 160

Pro Ile Ser Asn Arg Glu Thr Val Lys Leu Pro Leu Leu Gly Arg Val

165 170 175

Ala Glu Met Thr Arg Arg Gly Ser Met Leu Ala Thr His Val Phe Met

180 185 190

Arg Phe Gly Lys Asp Pro Thr Val

195 200

<210> 4

<211> 177

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Asp Ala Gly Lys Glu Thr Ser Tyr Lys Glu Ala Phe Asp Ser Thr

1 5 10 15

Ala Lys Lys Ser Ile Ala Asp Ala Ile Ile Pro His Ile Leu Arg Leu

20 25 30

Tyr Gly Ser Cys Ala Ser Ala Arg Asp Phe Glu Ile Tyr Ala Pro Asp

35 40 45

Ala Ser Phe Glu Asp Pro Leu Met Arg Ala Gln Gly Val Lys Gln Ile

50 55 60

Lys Ser Ala Phe Tyr Ser Leu Pro Lys Leu Phe Ser Glu Ser Lys Ile

65 70 75 80

Val Glu Tyr Ser Val Glu Glu Asn Ile Val Ser Pro Gly Lys Gly Glu

85 90 95

Ile Leu Ile Asp Asn Lys Gln His Tyr Lys Ile Leu Gly Lys Asp Ile

100 105 110

Asp Met Val Ser Leu Ile Lys Leu Ser Val Glu Glu Gly Lys Val Ile

115 120 125

Arg His Glu Asp Trp Trp Asp Lys Lys Pro Ile Ser Asn Arg Glu Thr

130 135 140

Val Lys Leu Pro Leu Leu Gly Arg Val Ala Glu Met Thr Arg Arg Gly

145 150 155 160

Ser Met Leu Ala Thr His Val Phe Met Arg Phe Gly Lys Asp Pro Thr

165 170 175

Val

<210> 5

<211> 175

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Asp Ala Gly Lys Glu Thr Ser Tyr Lys Glu Ala Phe Thr Ala Lys

1 5 10 15

Lys Ser Ile Ala Asp Ala Ile Ile Pro His Ile Leu Arg Leu Tyr Gly

20 25 30

Ser Cys Ala Thr Ala Arg Asp Phe Glu Ile Tyr Ala Pro Asp Ala Ser

35 40 45

Phe Glu Asp Pro Leu Met Arg Ala Gln Gly Val Lys Gln Ile Lys Ser

50 55 60

Ala Phe Tyr Ser Leu Pro Lys Leu Phe Ser Glu Ser Lys Ile Val Glu

65 70 75 80

Tyr Ser Val Glu Glu Asn Ile Val Ser Pro Gly Lys Gly Glu Ile Leu

85 90 95

Ile Asp Asn Lys Gln His Tyr Lys Ile Leu Gly Lys Asp Ile Asp Met

100 105 110

Val Ser Leu Ile Lys Leu Ser Val Glu Glu Gly Lys Val Ile Arg His

115 120 125

Glu Asp Trp Trp Asp Lys Lys Pro Ile Ser Asn Arg Glu Thr Val Lys

130 135 140

Leu Pro Leu Leu Gly Arg Val Ala Glu Met Thr Arg Arg Gly Ser Met

145 150 155 160

Leu Ala Thr His Val Phe Met Arg Phe Gly Lys Asp Pro Thr Val

165 170 175

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggatgctg gaaaagagac tag 23

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcaaacagtt ggatccttcc c 21

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaggactggt gggacaaaaa ac 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttggatcctt cccgaacctc 20

<210> 10

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcctcgagat ggatgctgga aaagagacta g 31

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcgtcgactc aaacagttgg atccttccc 29

<210> 12

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caccatggat gctggaaaag agactag 27

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tcaaacagtt ggatccttcc c 21

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcacaatccc actatccttc 20

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tcaaacagtt ggatccttcc c 21

<210> 16

<211> 603

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

atgtaccacg tgacacgttt tagacacatc actccctcaa cttctctctg tctttccaga 60

aaatttgcaa tggatgctgg aaaagagact agttacaaag aagcatttga ttccactgcc 120

aaaaagtcta ttgctgatgc catcattcct catattcttc gtctatatgg atcatgtgcc 180

acggctcgcg attttgaaat ctatgcccca gatgcttcct ttgaggatcc ccttatgcgt 240

gcacaagggg tgaagcagat caaatcagca ttctactctc tccctaagct gtttagtgag 300

tcaaagattg tggaatacag tgttgaagaa aatatagttt caccaggaaa aggagagata 360

ttaattgaca ataaacaaca ctataaaatc ttggggaagg atatagatat ggtatcgcta 420

atcaagttgt ctgttgagga gggtaaagtt attcgccatg aggactggtg ggacaaaaaa 480

ccaatttcta atcgagaaac cgtaaagctg ccattgcttg gccgagttgc agaaatgact 540

cgcaggggtt ctatgctagc aactcatgtg tttatgaggt tcgggaagga tccaactgtt 600

tga 603

<210> 17

<211> 534

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atggatgctg gaaaagagac tagttacaaa gaagcatttg attccactgc caaaaagtct 60

attgctgatg ccatcattcc tcatattctt cgtctatatg gatcatgtgc ctcggctcgc 120

gattttgaaa tctatgcccc agatgcttcc tttgaggatc cccttatgcg tgcacaaggg 180

gtgaagcaga tcaaatcagc attctactct ctccctaagc tgtttagtga gtcaaagatt 240

gtggaataca gtgttgaaga aaatatagtt tcaccaggaa aaggagagat attaattgac 300

aataaacaac actataaaat cttggggaag gatatagata tggtatcgct aatcaagttg 360

tctgttgagg agggtaaagt tattcgccat gaggactggt gggacaaaaa accaatttct 420

aatcgagaaa ccgtaaagct gccattgctt ggccgagttg cagaaatgac tcgcaggggt 480

tctatgctag caactcatgt gtttatgagg ttcgggaagg atccaactgt ttga 534

<210> 18

<211> 528

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atggatgctg gaaaagagac tagttacaaa gaagcattta ctgccaaaaa gtctattgct 60

gatgccatca ttcctcatat tcttcgtcta tatggatcat gtgccacggc tcgcgatttt 120

gaaatctatg ccccagatgc ttcctttgag gatcccctta tgcgtgcaca aggggtgaag 180

cagatcaaat cagcattcta ctctctccct aagctgttta gtgagtcaaa gattgtggaa 240

tacagtgttg aagaaaatat agtttcacca ggaaaaggag agatattaat tgacaataaa 300

caacactata aaatcttggg gaaggatata gatatggtat cgctaatcaa gttgtctgtt 360

gaggagggta aagttattcg ccatgaggac tggtgggaca aaaaaccaat ttctaatcga 420

gaaaccgtaa agctgccatt gcttggccga gttgcagaaa tgactcgcag gggttctatg 480

ctagcaactc atgtgtttat gaggttcggg aaggatccaa ctgtttga 528

Claims

1. The application of a gene for coding stress resistance related protein in obtaining transgenic plants with enhanced stress resistance; the gene of the coded stress resistance related protein is a gene shown in SEQ ID NO.2 or SEQ ID NO. 16.

2. Use according to claim 1, wherein the stress resistance comprises drought resistance and/or salt tolerance; the drought resistance refers to the ability to combat drought stress; the salt tolerance refers to the tolerance to salt stress.

3. The use according to claim 2, wherein the salt stress comprises stress or equivalent stress with a final sodium ion concentration of 150mmol/L to 200 mmol/L.

4. The use according to claim 2, wherein the drought stress comprises the same or equivalent stress as that of a final concentration of mannitol of 300-500 mmol/L.