CN111118042B - Powdery mildew-resistant grape calcium-dependent protein kinase gene VpCDPK9 and application thereof - Google Patents

Abstract

The invention discloses an isolated powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK9 and application thereof. The application relates to the field of genetic engineering, in particular to the field of grape disease-resistant breeding. The calcium-dependent protein kinase gene VpCDPK9 is obtained by separating the gene group of disease-resistant Chinese wild Dongfeng grape Baihe-35-1 plants through a gene cloning technology, and the gene is transferred into powdery mildew susceptible grape plants to obtain powdery mildew resistant transgenic grape plants, so that the powdery mildew resistance of the grapes is improved.

Description

Powdery mildew-resistant grape calcium-dependent protein kinase gene VpCDPK9 and application thereof

Technical Field

The invention belongs to the technical field of plant stress resistance gene identification and genetic engineering, in particular relates to separation and identification of a powdery mildew-resistant grape calcium-dependent protein kinase gene, and more particularly relates to a powdery mildew-resistant calcium-dependent protein kinase gene VpCDPK9 separated from China wild east China grape Baihe-35-1 and application thereof in powdery mildew resistance.

Background

Powdery mildew is an important fungal disease seriously damaging grape production, often causing serious yield reduction and even top harvest, and causing huge economic loss. In order to prevent and control the disease, pesticides need to be sprayed for 20-30 times every year in production, so that the edible safety of grape products is seriously influenced, the human health is threatened, and the ecological environment is polluted (Gadoury et al, 2012). At present, grape breeders more and more strongly realize that the development and utilization of disease-resistant genes of wild grapes as soon as possible and the active development of accurate disease-resistant molecular breeding of grapes are important ways for fundamentally solving the problem.

Calcium ions are an important second messenger in eukaryotic cells. Calcium Dependent Protein Kinases (CDPKs) are a specific class of calcium signaling decoding proteins in plants that independently accomplish decoding and transmission of calcium signaling. When plant cells are stressed, receptor proteins on cell membranes can quickly activate calcium ion channels after recognizing stress signals, and calcium ions in apoplast spaces flow in a large quantity to increase the concentration of calcium ions in cytoplasm. The EF-hand structural domain at the carboxyl terminal of the CDPKs is combined with calcium ions to promote the CDPKs to generate conformational change and expose the kinase active center, and at the moment, the CDPKs can interact with the substrate protein and phosphorylate the substrate protein to regulate and control the activity or stability of the downstream substrate protein. The above process converts calcium signals (oscillation of cytoplasmic calcium ion concentration) into phosphorylation events, which enables transmission and processing of stress signals, and thus, CDPKs proteins play an important role in plant growth and development and stress response (Sheen, 1996).

Calcium Dependent Protein Kinases (CDPKs) exist as a family of genes in the grape genome. However, to date, there have been few studies on the glucokinase (CDPKs), and there have been no reports or studies on the glucokinase having an anti-powdery mildew function. This is probably due to the scarcity of powdery mildew resistant grape varieties, most of which are susceptible to powdery mildew. For example, the eurasian grape variety, muscovado (PinotNoir), used for the first sequencing of the grape genome, is well known for its delicacy and adoption by many world vintage (e.g., roman. corni) wines. However, most European and Asian grape varieties, including the grape, are susceptible to diseases such as powdery mildew (Amrine et al 2015; Gao et al 2016; Yin et al 2017).

Wild Vitis vinifera (Vitis pseudoreticulata) is a wild grape species in China. The Baihe-35-1 of the east China grape strain stored in the wild grape germplasm resource garden of northwest agriculture and forestry science and technology university has higher resistance to main grape diseases such as grape powdery mildew, downy mildew and the like, but the specific genetic basis (disease resistance gene) is not clear at present (Gao et al, 2016; Yin et al, 2017). The method takes the calcium-dependent protein kinase gene VpCDPK9 of a powdery mildew susceptible variety, namely Hebino grape (reference genome) as reference, designs a specific primer, adopts a gene cloning technology to clone from a Huadong grape strain Baihe-35-1 genome cDNA library to obtain a separated powdery mildew resistant calcium-dependent protein kinase gene, provides gene resources and molecular markers for accurate molecular breeding of powdery mildew resistance of grapes, and has important theoretical value and practical significance.

Disclosure of Invention

The invention discloses a Calcium Dependent Protein Kinase (CDPKs) gene VpCDPK9 separated and obtained from China wild east China grape Baihe-35-1, and proves that the gene has the function of resisting powdery mildew, and also relates to the application of VpCDPK9 in the resistance of the grape to the powdery mildew.

In one embodiment, the isolated powdery mildew resistant gene VpCDPK9 of the present application for the calcium dependent protein kinase of Vitis vinifera (CDPKs) has the nucleotide sequence shown in SEQ ID NO: 1:

one aspect of the present patent application relates to an isolated powdery mildew resistant grape calcium dependent protein kinase encoded by the isolated powdery mildew resistant calcium dependent protein kinase gene VpCDPK9 described herein having the amino acid sequence shown in SEQ ID NO. 13.

One aspect of the present patent application relates to the use of an isolated powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK9 in the creation of powdery mildew resistant transgenic grape varieties.

One aspect of the present patent application relates to a method for producing transgenic grape plants resistant to powdery mildew, which is characterized in that the isolated powdery mildew-resistant grape calcium-dependent protein kinase gene VpCDPK9 described herein is introduced into a grape plant and stably expressed.

Therefore, one aspect of the present patent application also relates to a method for improving the powdery mildew resistance of grape plants, which is characterized in that the isolated powdery mildew resistance grape calcium dependent protein kinase gene VpCDPK9 described in the present application is introduced into the grape plants.

The patent application of the invention provides a real-time fluorescent quantitative PCR detection primer of a Vitis vinifera Baihe-35-1 calcium dependent protein kinase gene VpCDPK9 in east China and a primer of a reference gene VpActin1, wherein the primer sequences are as follows:

VpCDPK9-qF：5’ATGGGGAATAACTGTGTGGGA 3’(SEQ ID NO:2)

VpCDPK9-qR：5’CCTCTTCGGTGTGGGTGTTGG 3’(SEQ ID NO:3)

VpActin1-qF：5’GTGCTGGATTCTGGTGATGGT 3’(SEQ ID NO:4)

VpActin1-qR：5’TCCCGTTCAGCAGTAGTGGTG 3’(SEQ ID NO:5)

the expression conditions of the VpCDPK9 gene after biotic stress (powdery mildew infection), abiotic stress (salt, low temperature and high temperature), exogenous hormone treatment (salicylic acid (SA), abscisic acid (ABA), methyl jasmonate (MeJA) and ethephon (Eth)) on different leaf age leaves of the Vitis vinifera Baihe-35-1 are respectively detected. The results show that the VpCDPK9 gene is induced to express by powdery mildew, high temperature, salt and a plurality of hormones.

The invention firstly constructs a 35S:: VpCDPK9-GFP plant expression vector, and PEG-Ca is used for the expression vector ²⁺ Mediated transformation method it was introduced into tobacco mesophyll cell protoplasts to study the subcellular localization of VpCDPK9 protein. The results show that GFP-labeled VpCDPK9 full-length protein can be simultaneously labeled with mCherry-labeled endoplasmic reticulum resident protein AtCML5 and GolgiThe body resident protein AtEMP12 and the oil body proteins AtCOL3 and At alpha-DOX 1 are co-localized, and cannot be co-localized with the peroxisome localization leader peptide PTS 1.

The patent application of the invention creates an overexpression transgenic seedless white grape strain of the east China grape Baihe-35-1 calcium dependent protein kinase gene VpCDPK 9. Through PCR detection and Western Blot detection, the exogenous fusion protein can be confirmed to be expressed at a low level in transgenic grape leaves. After the transgenic grape strains and the non-transgenic grape strains of the same age are transplanted to an artificial climate box culture box to grow for half a year, strong pathogenic grape powdery mildew En NAFI 1 is inoculated to leaves of the transgenic grape strains, and the growth conditions of powdery mildew hypha and the defense response of grapes are detected by trypan blue staining, diaminobenzidine staining, aniline blue staining and other methods at different time points after inoculation. Counting the number of conidia averagely generated by a single colony of the powdery mildew, measuring the contents of ethylene and salicylic acid which are plant hormones related to defense, and measuring the contents of hydrogen peroxide which is a core defense molecule and a clearing factor anthocyanin thereof. The results show that the leaves of the VpCDPK9 transgenic grape line are infected by powdery mildew, can generate higher level of ethylene and salicylic acid compared with the leaves of wild grape, and lead to the accumulation of hydrogen peroxide in large quantity; meanwhile, the callose is promoted to be accumulated in epidermal cells around the invaded epidermal cells, so that the hydrogen peroxide can only diffuse to mesophyll cells to cause large-area necrosis of mesophyll tissues, and the leaves are yellowed, senilised and even shed; thereby limiting the growth of powdery mildew hyphae and the generation of conidia and improving the powdery mildew resistance of the grapes.

The beneficial effects of the patent application of the invention are as follows:

(1) the invention discloses a method for obtaining an isolated powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK9 from Vitis vinifera Baihe-35-1 in east China by a cloning technology. This is the isolated anti-powdery mildew calcineurin kinase gene reported for the first time so far. The gene is transferred into the nuclear-free white of a pathogenic European grape variety, and the response of a VpCDPK9 transgenic grape strain and a control grape plant (wild type nuclear-free white) to powdery mildew infection and the growth and reproduction conditions of corresponding powdery mildew are compared, so that the VpCDPK9 transgenic plant shows strong capacity of inhibiting the growth of powdery mildew hyphae and the propagation of conidiospores, and the VpCDPK9 gene is a calcium-dependent protein kinase gene for resisting the powdery mildew, and can improve the powdery mildew resistance of grapes.

(2) The powdery mildew resistant VpCDPK9 gene applied by the invention can improve the powdery mildew resistant hereditary characters of grapes and improve the disease resistance of grape cultivars to powdery mildew resistance.

Drawings

FIG. 1 is a graph of the expression pattern of VpCDPK9 gene in grape leaves of different leaf ages. The growth conditions of leaves with different leaf ages on the same branch are marked on the left side; the right panel is the relative expression level of VpCDPK9 in different leaf age leaves. The analysis used VpActin1 as an internal reference gene. The mean and standard deviation were from three biological replicates and three technical replicates.

Figure 2 is the expression pattern of VpCDPK9 gene under different stress and hormone treatment conditions. The figure indicates the type of duress treatment and the different sampling time points. The analysis used VpActin1 as an internal reference gene. The mean and standard deviation were from three biological replicates and three technical replicates.

Figure 3 is the subcellular localization of VpCDPK9 full-length protein in tobacco mesophyll cell protoplasts. mCherry-labeled AtCML5 belongs to the endoplasmic reticulum resident protein, AtEMP12 is Golgi resident protein, AtCOL3 and At α -DOX1 belong to the oil body proteins, and PTS1 is the peroxisome localization leader peptide.

FIG. 4 is a Western Blot identification of transgenic grape lines overexpressing VpCDPK 9. Anti-GFP shows that murine GFP monoclonal antibody was used to recognize the YFP tag protein during immunoblotting.

FIG. 5 is a powdery mildew resistance assay of transgenic grape lines overexpressing VpCDPK 9. A. Growth of powdery mildew on leaves of Wild Type (WT) and transgenic grape lines after inoculation with powdery mildew En NAFU 120 d. B. Histochemical staining is used for detecting the growth of powdery mildew and the defense reaction of grape cells; trypan blue staining identifies the growth of powdery mildew hyphae and conidiospore production on wild type and transgenic grape leaves after inoculation; diaminobenzidine staining is used for identifying the accumulation condition of hydrogen peroxide on wild grape leaves and transgenic grape leaves after inoculation; and (3) identifying the accumulation condition of callose on wild type and transgenic grape leaves after inoculation by aniline blue staining. C. The number of conidia generated on each single colony on the leaf of the wild type grape and the transgenic grape after 20d inoculation is average. D. And (4) after 20d inoculation, ethylene release amount of wild type and transgenic grape leaves is increased. E. And after 20d of inoculation, the content of free salicylic acid in wild type and transgenic grape leaves is increased. F. And (5) inoculating the wild grape leaves and the transgenic grape leaves after 20d of inoculation with hydrogen peroxide. G. And (5) inoculating the wild grape leaves and the transgenic grape leaves after 20d of inoculation to obtain anthocyanin accumulation. Indicates significant differences compared to the wild type, indicates very significant differences compared to the wild type (Student's t-test,. P <0.05,. P < 0.01). Detailed Description

The patent application of the invention is described in further detail below with reference to examples and figures:

example 1: cloning and expression analysis of Vitis vinifera Baihe-35-1 calcium dependent protein kinase gene VpCDPK9

The extraction step is carried out according to the Kit description method by adopting an OMEGA Plant RNA Kit Plant RNA miniprep Kit to extract the total RNA of the leaf of the white river-35-1 grape. First strand cDNA was synthesized by reverse transcription of RNA using the PrimeScriptTM RT reagent Kit from TaKaRa with gDNA Eraser (Perfect Real Time) reverse transcription Kit, according to the Kit instructions. According to the VviCDPK9 gene sequence identified in the black bino grape genome published in NCBI, Vector NTI software is utilized to design a specific primer, an upstream primer: VpCDPK 9-F: 5 'ATGGGGAATAACTGTGTGGGA 3' (SEQ ID NO:2), downstream primer: VpCDPK 9-R: 5 'ATAGACTGGTAGCGGCTGCCTA 3' (SEQ ID NO:6), using Baihe-35-1 leaf cDNA as a template, and performing PCR amplification by using high fidelity enzyme PrimeSTAR HS DNA Polymerase of TAKARA company, wherein the specific amplification system is as follows: 0.5. mu.L HS Taq, 6.0. mu.L 5 XPCR buffer, 3.0. mu.L dNTP, 1.0. mu.L cDNA template, 1.0. mu.L Forward-primer, 1.0. mu.L Reverse-primer, 17.5. mu.L ddH ₂ And (O). The PCR amplification procedure was: pre-denaturation at 98 deg.C for 10s, and cycle parameters of denaturation at 98 deg.C for 10s, annealing at 57 deg.C for 10s, and extension at 72 deg.C for 1min and 30s, performing 34 cycles, and fully extending at 72 deg.C for 10 min. PCR products were electrophoretically detected in 1% agarose gel, imaged on an ultraviolet gel imaging system and photographed. After taking the picture, the single target band was cut and used with Gensthe glue recovery kit of tar company is recovered, then is connected to a cloning vector pMD19-T to construct a pMD19T-VpCDPK9 plasmid, and then is transformed into an Escherichia coli competent cell. Selecting white monoclonal cells from the transformed competent cells, culturing for 16-18h at constant temperature of 37 ℃ by shaking table at 180rpm/min, identifying the white monoclonal cells as positive clones by bacterial liquid PCR, and sending the positive clones to sequencing verification of the Beijing Olympic department of Organography, wherein the nucleotide sequence and the deduced amino acid sequence are shown in a sequence table. The sequence of the cloned VpCDPK9 gene is analyzed, the full length of the coding sequence of the gene is 1743bp, and 580 amino acids are coded. The nucleotide sequence similarity of the VpCDPK9 gene and its homologous gene vvidpk 9(XM _002264404) in the reference genome of the susceptible grape melanopino is 99.5%, there are 9 single nucleotide differences, and it results in non-synonymous mutations at 4 amino acid sites.

The inventor adopts a real-time fluorescent quantitative PCR technology to detect the expression conditions of the VpCDPK9 gene after biotic stress (powdery mildew infection), abiotic stress (salt, low temperature and high temperature), exogenous hormone treatment (salicylic acid (SA), abscisic acid (ABA), methyl jasmonate (MeJA) and ethephon (Eth)) on different leaf age leaves of the east China grape Baihe-35-1. Leaf sampling at different leaf ages as shown in figure 1, stress and hormone treatment methods were as follows:

treating powdery mildew: grape powdery mildew En NAFU1 (NAFU 1) is inoculated on greenhouse potted east China grape Baihe-35-1 healthy leavesErysiphe neco NAFU1) (Gao et al 2016) and inoculated leaf discs were collected 0, 24, 48, 72, 96, 120, 144 and 168h after treatment and RNA was extracted after rapid freezing with liquid nitrogen.

Salt stress treatment: the potted Baihe-35-1 grape plant growing in normal environment is irrigated with saline (300mM NaCl solution), and samples are taken 0, 0.5, 2, 4, 8, 12, 24 and 48 hours after irrigation, and RNA is extracted after liquid nitrogen is rapidly frozen.

Low-temperature stress treatment: the potted Baihe-35-1 grape plant growing in the normal environment is put in the environment of 4 ℃ for low-temperature stress treatment, samples are respectively taken for 0 hour, 0.5 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours and 48 hours after the treatment, and RNA is extracted after the liquid nitrogen is rapidly frozen.

High-temperature stress treatment: placing potted Baihe-35-1 grape plants growing in a normal environment in an environment of 42 ℃ for high-temperature stress treatment, respectively sampling 0, 0.5, 2, 4, 8, 12, 24 and 48 hours after the treatment, and quickly freezing by liquid nitrogen to extract RNA.

And (3) treating the phytohormone: leaves of potted Baihe-35-1 grape plants grown in normal environment are respectively and uniformly sprayed with 50 mu M abscisic acid (ABA), 50 mu M Salicylic Acid (SA), 50 mu M methyl jasmonate (MeJA) and 50 mu M ethephon (Eth), and samples are respectively taken at 0, 0.5, 2, 4, 8, 12, 24 and 48h after spraying, and RNA is extracted after liquid nitrogen is rapidly frozen.

The following real-time fluorescent quantitative PCR detection primers are designed according to the VpCDPK9 gene sequence:

VpCDPK9-qF：5’ATGGGGAATAACTGTGTGGGA 3’(SEQ ID NO:2)

VpCDPK9-qR：5’CCTCTTCGGTGTGGGTGTTGG 3’(SEQ ID NO:3)

VpActin1-qF：5’GTGCTGGATTCTGGTGATGGT 3’(SEQ ID NO:4)

VpActin1-qR：5’TCCCGTTCAGCAGTAGTGGTG 3’(SEQ ID NO:5)

RT-qPCR assay was performed on a Bio-Rad IQ5 real-time fluorescent quantitative PCR instrument using TaKaRa real-time fluorescent quantitative PCR kit. The reaction system is as follows: SYBR Premix Ex Taq II 10.5. mu.L, cDNA template 1.0. mu.L, Forward-primer 0.8. mu.L, Reverse-primer 0.8. mu.L, ddH ₂ O7.4. mu.L. PCR amplification procedure: pre-denaturation at 95 ℃ for 3min, 40 cycles (95 ℃ for 30s, 58 ℃ for 30 s). After PCR cycling, the temperature was maintained at 50 ℃ for 1min, and then melting curve analysis was performed at 0.5 ℃ increments every 10 seconds. The relative expression levels of the genes were analyzed using IQ5 software normalized expression method. Each treatment was performed 3 biological replicates and 3 technical replicates, respectively.

The results showed that VpCDPK9 gene was highly expressed in mature leaf and less expressed in young and etiolated leaf (figure 1); in the early stage (24-120h) of powdery mildew infection, the up-regulation expression is strongly induced; under abiotic stress, the VpCDPK9 gene has obvious response to NaCl stress treatment and high-temperature stress treatment and also responds to low-temperature stress, but the up-regulation amplitude is not high; both VpCDPK9 genes exhibited varying degrees of up-regulated expression upon exogenous hormone treatment, with the most intense response to Eth and MeJA treatment (figure 2). These results suggest that the VpCDPK9 gene may play an important role in participating in pathogenic bacteria, salt and temperature stress, etc.

Example 2: subcellular localization analysis of Vitis vinifera Baihe-35-1 calcium dependent protein kinase Gene VpCDPK9

Designing gene specific primers with XbaI and KpnI enzyme cutting sites, wherein an upstream primer: VpCDPK 9-GFP-F: 5' TCTGATCAAGAGACATCTAGAATGGGGAATAACTGTGTGGGA 3' (SEQ ID NO:7), downstream primer: VpCDPK 9-GFP-R: 5' GCCCTTGCTCACCATGGTACCATAGACTGGTAGCGGCTGCCT 3' (SEQ ID NO:8) (restriction sites in underlined font), and the coding sequence of VpCDPK9 was amplified using pMD19T-VpCDPK9 plasmid as template, using

The PCR one-step directional cloning kit (seamless cloning) is connected to the plant overexpression vector pBI221 containing GFP labels at a proper molar ratio through a homologous recombination reaction to construct a fusion overexpression vector 35S:: VpCDPK 9-GFP. The 35S plasmid VpCDPK9-GFP and 35S plasmid AtCML5-mCherry, 35S plasmid AtEMP12-mCherry, 35S plasmid AtCLO3-mCherry, 35S plasmid Ata-DOX1-mCherry and 35S plasmid PTS 1-mChery are mixed uniformly in equal amount, and PEG-Ca is used for mixing uniformly ²⁺ The mediated transformation method was poured into tobacco mesophyll cell protoplasts (Zhao et al, 2016), and observed whether GFP-labeled VpCPDK9 co-localized with mCherry-labeled organelle resident protein using OLYMPUS BX63 orthofluorescent microscope. The results indicate that VpCDPK9 can localize to endoplasmic reticulum, golgi and oil bodies simultaneously, but not to peroxisomes (figure 3).

Example 3: obtaining and identifying overexpression transgenic anucleate white strain of Vitis vinifera Baihe-35-1 calcium dependent protein kinase gene VpCDPK9

Designing a gene specific primer with a BamHI enzyme cutting site, wherein an upstream primer: VpCDPK 9-C15-F: 5' TCTGATCAAGAGACAGGATCCATGGGGAATAACTGTGTGGGA 3' (SEQ ID NO:9), downstream primer: VpCDPK 9-C15-R: 5' GCCCTTGCTCACCATGGATCCATAGACTGGTAGCGGCTGCCT 3' (SEQ ID NO:10) (enzyme cutting sites are underlined), and the coding sequence of VpCDPK9 was amplified using pMD19T-VpCDPK9 plasmid as template, using

The PCR one-step directed cloning kit (seamless cloning) is connected to a plant over-expression vector C15 containing YFP label by homologous recombination reaction under a proper molar ratio (Wang et al, 2007) to construct a fusion over-expression vector 35S:: VpCDPK 9-YFP. The 35S-VpCDPK 9-YFP plasmid is transferred into agrobacterium-infected cells GV3101 by an electrotransformation method, and a C15 empty vector is used as a control. After activation, the transformed competent cells were spread evenly on LBA solid medium plates with kanamycin (50mg/L), gentamicin (25mg/L) and rifampicin (25 mg/L). And (4) carrying out colony PCR detection after the plate grows out the monoclonals, and preserving the bacterial liquid after the monoclonals detected as positive are propagated.

Taking out the bacterial liquid of VpCDPK9-YFP/GV3101 which is preserved in a refrigerator of-80' C and is 35S:, unfreezing the bacterial liquid in a refrigerator of 4 ℃, sucking 200 mu L of the bacterial liquid, inoculating the bacterial liquid in an LBA liquid culture medium added with antibiotics, culturing at the constant temperature of 28 ℃ for 18-20h at 180rpm/min, and activating the agrobacterium. And (3) sucking 100 mu L of the activated bacterial liquid, inoculating the bacterial liquid into 20ml of LBA liquid culture medium containing antibiotics, and carrying out amplification culture at 180rpm/min and 28 ℃ for 14-16 h. Pouring into a sterile centrifuge tube in a clean bench, centrifuging at 5500rpm/min for 10min, removing precipitate, removing supernatant, adding equal volume of 1/2MS solution containing 100 μ M acetosyringone, resuspending, culturing at 180rpm/min at 28 deg.C for 1-2h, measuring concentration with an ultraviolet-visible spectrophotometer, and diluting to OD 600 of 0.5-0.8.

Pouring the bacterial liquid into a sterile culture bottle, putting the transformation acceptor material (the seedless white grape embryonic callus) into the culture bottle filled with the infection liquid, and soaking for 20min, and slightly shaking the culture bottle during the soaking process to ensure that the bacterial liquid is fully contacted with the callus. Placing the infected embryonic callus on sterile filter paper to absorb redundant agrobacterium. Then placed on two layers of filter paper in a sterile glass dish (moistened with 1/2MS liquid medium supplemented with 100. mu.M AS) and incubated for 48h at 26 ℃ in the absence of light. The embryogenic callus after co-culture was washed with sterile water 3 times, then sterilized with MS solution supplemented with 200mg/L of cefuroxime (Cef) and carbenicillin (Carb) for 10min, and finally washed with sterile water 3 times. The embryogenic callus after being sterilized is placed on a sterile filter paper to absorb excess sterile water, then the proembryogenic mass is inoculated on a KCC medium (KBN +200mg/L Carb +200mg/L Cef) to be cultured for 3 weeks for delayed screening, and then is transferred to an X3CC medium (X3+200mg/L Carb +200mg/L Cef) for delayed screening for one week. After one month of delayed selection, embryogenic calli were transferred to resistant selection medium containing different concentrations of Basta, cultured in dark at 26 ℃ and subcultured every 4-6 weeks, with the concentration of Basta in the medium required for subculture gradually increasing from 5mg/L to 20mg/L until resistant somatic embryos germinated. After the resistant somatic embryos germinate, the cotyledon embryos are inoculated on a GM culture medium (MS +15g/L of sucrose +1g/L of activated carbon +3g/L of plant gel), cultured under light until the cotyledon turns green, and then inoculated on a rooting culture medium (MS +1mg/L of IBA +30g/L of sucrose +7g/L of agar) to form seedlings. After the root system of the resistant plant grows to the mouth of the culture bottle, transplanting the plant to an artificial climate chamber for hardening the seedling for 1-2 months, and then transplanting the plant to a greenhouse.

VpCDPK9-YFP transgenic plant is tested for the resistance screening of the seedling, the traditional CTAB method is used for extracting the genome DNA of the resistance plant, about 0.1g of leaves are taken, a grinding rod is used for grinding the leaves in a 1.5mL centrifuge tube, 650 mu L of CTAB buffer solution is added, a 65 ℃ oven is placed for 30min, the leaves are taken out and placed at room temperature, equal volume of chloroform isoamyl alcohol is added, the mixture is mixed evenly and centrifuged at 12000rpm/min for 10min, about 400 mu L of supernatant is taken, precooled absolute ethyl alcohol with double volume is added, 30min of precipitation at-20 ℃, 10min of centrifugation at 12000rpm/min is poured out, and the mixture is naturally dried. Dissolved in 20. mu.L of distilled water. The nucleotide sequences on the reporter gene YFP and the promoter 35S are used for designing universal primers (upstream YFP:5'CAGGGTCAGCTTGCCGTAG 3' (SEQ ID NO:11) and downstream 35SA:5'TCCTTCGCAAGACCCTTCCTCTAT 3' (SEQ ID NO:12)) to detect the PCR level of the resistant plants. Among the 129 Basta resistant transgenic lines, 109 could amplify the target band.

In order to examine whether the foreign fusion gene in the PCR positive strain can be normally translated into protein, Western Blot detection was performed on the positive strain. And (3) putting 100mg of fresh leaves into liquid nitrogen for sample grinding, and preserving the ground sample in the liquid nitrogen. Adding protein extract (pH 8.01M Tris-HCl: 10% SDS: 50% glycerol: B-mercaptoethanol ═ 2:4:4:1) until the sample just submerged, mixing well, boiling water bath for 5min, after the sample returns to room temperature, centrifuging at 13000rpm/min for 5min, and taking the supernatant, namely the extract containing protein. Preparing 8% SDS-PAGE separation gel, solidifying the separation gel, preparing 4% concentrated gel, solidifying the concentrated gel, mixing the sample buffer solution with the protein extract, transferring into the sample inlet, performing vertical gel electrophoresis, performing electrophoresis at 70V for about 30min during the migration process in the concentrated gel, adjusting to 90V, performing electrophoresis for 3 hours, and stopping electrophoresis when the blue line is about 0.5cm away from the bottom. The prepared membrane transfer buffer is added into the glass groove. PVDF membrane of appropriate size is cut and activated by soaking in a small amount of methanol for half a minute. The excess of SDS-PAGE gel was cleaved. Fixing the glue and the membrane according to the sequence of the blackboard, the sponge, the filter paper, the glue, the membrane, the filter paper, the sponge and the white board, and placing the fixed splint into a membrane conversion buffer solution. And (5) transferring the membrane for 1h at 100V, and placing the electrophoresis tank under the ice bath condition. After the membrane transfer was completed, the PVDF membrane was removed, the side in contact with the gel was facing upward, and washed with TBST buffer on a decolorizing shaker for 10 min. Preparing 15mL of TBST membrane sealing solution dissolved with 0.5% skimmed milk powder, shaking the solution one hour in advance, and putting the PVDF membrane into the sealing solution to incubate for 90 min. The murine GFP monoclonal antibody diluted 2000-fold was added and incubated overnight at 4 ℃. Wash 5 times with 20ml TBST for 10min each. HRP-labeled goat anti-mouse polyclonal antibody diluted 5000 times was added, incubated at room temperature for hours, and then washed 3 times with TBS for 5min each. The PVDF membrane was taken out, developed using a developer from Millipore, subjected to chemiluminescence imaging using a BIO-RAD gel imaging system, and recorded by photography. Finally, the PVDF membrane was incubated in ponceau staining solution, stained for total protein, and recorded by photography with canon single lens reflex. The results showed that VpCDPK9-YFP fusion protein could be expressed normally but in lower amounts in most transgenic lines (figure 4).

Example 4: identification of powdery mildew resistance of Vitis vinifera Baihe-35-1 calcium-dependent protein kinase gene VpCDPK9 overexpression transgenic anucleate white strain

After 35S, transplanting a VpCDPK9-YFP transgenic grape strain and a non-transgenic grape strain of the same age into an artificial climate box incubator to grow for half a year, inoculating strong pathogenic grape powdery mildew En NAFI 1 to leaves of the grape strain. A small leaf was cut at 10 days after inoculation, and trypan blue, diaminobenzidine and aniline blue staining were performed. Firstly, powdery mildew forms white velvet-like hyphae and larger single colonies on wild type seedless white strain leaves after being inoculated with powdery mildew for 20d, but no obvious powdery mildew colonies are generated on the leaves of the VpCDPK9-YFP transgenic grape strain, but a large amount of necrotic spots exist and the leaves turn yellow integrally (FIG. 5A). After observing the growth condition of hyphae by trypan blue staining and counting the amount of conidia, the hyphae growth on the transgenic grape strain line is inhibited, the hyphae density is lower and the conidia yield is reduced compared with powdery mildew on wild grape leaves (fig. 5B and 5C). After measuring the free salicylic acid and ethylene of the leaf tissue in 20D inoculation by ultra performance liquid chromatography and gas chromatography respectively, the transgenic line leaves were found to have more ethylene accumulation and higher level salicylic acid synthesis (fig. 5D and 5E). Meanwhile, after measuring the content of hydrogen peroxide and the content of anthocyanin by spectrophotometry, higher levels of hydrogen peroxide and anthocyanin are accumulated in the leaves of the transgenic lines, which indicates that the leaves of the transgenic grapes are in a high oxidative stress state (FIGS. 5F and 5G). The results of aniline blue staining indicated that more callose was accumulated in the leaves of the transgenic lines, and that these callose were accumulated mainly in the epidermal cells that were punctured into the periphery of the epidermal cells (FIG. 5B). Therefore, we speculate that overexpression of VpCDPK9-YFP promotes synthesis of ethylene and salicylic acid under erysiphe necator induction conditions, activating downstream signals leading to hydrogen peroxide accumulation and callose accumulation; while callose accumulated in epidermal cells around the punctured epidermal cells prevents hydrogen peroxide from diffusing from the punctured epidermal cells to the surrounding epidermal cells, so that it diffuses mainly to mesophyll cells, causing extensive necrosis of mesophyll tissues. The necrosis of mesophyll tissues of the grapes limits the nutrition supply of the grape powdery mildew, inhibits the hypha growth and the conidiospore generation of the grapes, and improves the powdery mildew resistance of the grapes to a certain degree.

Reference to the literature

Amrine KCH,Blanco-Ulate B,Riaz S,Pap D,Jones L,Figueroa-Balderas R,Walker MA,Cantu D(2015)Comparative transcriptomics of Central Asian Vitis vinifera accessions reveals distinct defense strategies against powdery.Hortic Res-England 2.doi:10.1038/hortres.2015.37

Gadoury DM,Cadle-Davidson L,Wilcox WF,Dry IB,Seem RC,Milgroom MG(2012)Grapevine powdery mildew(Erysiphe necator):a fascinating system for the study of the biology,ecology and epidemiology of an obligate biotroph.Mol Plant Pathol 13(1):1-16.doi:10.1111/j.1364-3703.2011.00728.x

Gao YR,Han YT,Zhao FL,Li YJ,Cheng Y,Ding Q,Wang YJ,Wen YQ(2016)Identification and utilization of a new Erysiphe necator isolate NAFU1 to quickly evaluate powdery mildew resistance in wild Chinese grapevine species using detached leaves.Plant Physiol Biochem 98:12-24.doi:10.1016/j.plaphy.2015.11.003

Sheen J(1996)Ca2+-dependent protein kinases and stress signal transduction in plants.Science 274(5294):1900-1902.doi:10.1126/science.274.5294.1900

Wang W,Devoto A,Turner JG,Xiao S(2007)Expression of the membrane-associated resistance protein RPW8 enhances basal defense against biotrophic pathogens.Mol Plant Microbe Interact 20(8):966-976.doi:10.1094/MPMI-20-8-0966

Yin X,Liu RQ,Su H,Su L,Guo YR,Wang ZJ,Du W,Li MJ,Zhang X,Wang YJ,Liu GT,Xu Y(2017)Pathogen development and host responses to Plasmopara viticola in resistant and susceptible grapevines:an ultrastructural study.Hortic Res-England 4.doi:10.1038/hortres.2017.33

Zhao FL,Li YJ,Hu Y,Gao YR,Zang XW,Ding Q,Wang YJ,Wen YQ(2016)A highly efficient grapevine mesophyll protoplast system for transient gene expression and the study of disease resistance proteins.Plant Cell Tiss Org 125(1):43-57.doi:10.1007/s11240-015-0928-7

Sequence listing

<110> northwest agriculture and forestry science and technology university

<120> powdery mildew-resistant grape calcium-dependent protein kinase gene VpCDPK9 and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1743

<212> DNA

<213> Vitis vinifera (vitas pseudoticulata)

<400> 1

atggggaata actgtgtggg atccatggtt cccgagcatg gattgtttga atcaatttct 60

aattcaattt ggtggacgag agcctcggag tgtatgactt ctcattctac cggagaaggt 120

gtcagcgaaa cgcaaagtaa agagcagaaa tctcctcctc ctgttcaaaa caagcctcca 180

gaagaggtgg agctaataaa tccgccagag gtaatgaaga taacaaagga agagacgaaa 240

ccaacaccca caccgaagag gccactcctt atgaagaggt tgccaagtgc tggacttgag 300

gtggacttgg ttttgaaaaa caaaactgat catttgaagg aacactataa tttggggcgg 360

aagcttgggc acggccagtt tgggacaact tttctatgtg tagagaaaga aacaggcaaa 420

gagtacgctt gcaaatccat tgcaaaaagg aagctgctga caagagatga cattgaagac 480

gtgaggaggg aaatccagat aatgcatcac ttggcgggcc actccaatat catctccatc 540

aagggagctt atgaggatgc ggtggcagtt catcttgtca tggaattgtg tacggggggt 600

gagctttttg ataggattgc caagcgaggc cattatacag aaagaaaggc agctcagctt 660

gcaaggacta taattggtgt tgtagaagcc tgccactctt taggggtcat gcaccgggac 720

cttaagcctg agaattttct ttttgtcaat gagcaagagg aatcacttct taagacaata 780

gactttgggt tgtccgtatt cttcaagcca ggggagattt tcactgatgt ggttggaagc 840

ccatattatg tggcacctga agttctgaga aagtgttatg gtccagaagc agatgtttgg 900

agtgttgggg tgatcattta tattctctta agtggggtgc ctccattttg ggcagaaagt 960

gagcaagaga tatttcaaga agtactgcat ggtgatctta acttctcatc agatccatgg 1020

cctcatatct ctgaaagtgc taaggacttg attaggagaa tacttgtcag agatcccaag 1080

aaacgcctaa ctgcccatga agtcctgtgt cacccttgga ttcaggttga tggagtagct 1140

cctgacaaaa cccttgattc tgcagtcata agtcgcttga agcagttttc agccatgaac 1200

aagcttaaga aaatggctct tagagtgatt gctgagaatc tctccgaaga agaaattgct 1260

ggattgaaag aaatgttcaa gattattgat acagacaata gtggtcagat tacttttgaa 1320

gaactcaagg ctggactaaa aagatttggc gctaatctta atgaagctga aatttatgat 1380

ctaatgcagg ctgcagatgt tgataatagt ggaacaatcg attatgggga gttcatagct 1440

gcaacattcc atctaaacaa aattgagaga gaagatcacc tatttgctgc tttttcctac 1500

tttgacaaag atggaagtgg ctatatcact ccagatgagc tccaaaaagc ctgtgaggag 1560

tttgggatgg aggatgtcca tttggaagaa atgatccaag aagttgacca ggacaatgat 1620

ggcctcatag attataatga gtttgtggca atgatgcaga aaggaaacaa taatgatttt 1680

ggtaagaagg gtctggagaa tggtattagc tttgggttta ggcagccgct accagtctat 1740

tga 1743

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggggaata actgtgtggg a 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cctcttcggt gtgggtgttg g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgctggatt ctggtgatgg t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcccgttcag cagtagtggt g 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atagactggt agcggctgcc ta 22

<210> 7

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctgatcaag agacatctag aatggggaat aactgtgtgg ga 42

<210> 8

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcccttgctc accatggtac catagactgg tagcggctgc ct 42

<210> 9

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctgatcaag agacaggatc catggggaat aactgtgtgg ga 42

<210> 10

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcccttgctc accatggatc catagactgg tagcggctgc ct 42

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagggtcagc ttgccgtag 19

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tccttcgcaa gacccttcct ctat 24

<210> 13

<211> 580

<212> PRT

<213> Vitis vinifera (vitas pseudoticulata)

<400> 13

Met Gly Asn Asn Cys Val Gly Ser Met Val Pro Glu His Gly Leu Phe

1 5 10 15

Glu Ser Ile Ser Asn Ser Ile Trp Trp Thr Arg Ala Ser Glu Cys Met

20 25 30

Thr Ser His Ser Thr Gly Glu Gly Val Ser Glu Thr Gln Ser Lys Glu

35 40 45

Gln Lys Ser Pro Pro Pro Val Gln Asn Lys Pro Pro Glu Glu Val Glu

50 55 60

Leu Ile Asn Pro Pro Glu Val Met Lys Ile Thr Lys Glu Glu Thr Lys

65 70 75 80

Pro Thr Pro Thr Pro Lys Arg Pro Leu Leu Met Lys Arg Leu Pro Ser

85 90 95

Ala Gly Leu Glu Val Asp Leu Val Leu Lys Asn Lys Thr Asp His Leu

100 105 110

Lys Glu His Tyr Asn Leu Gly Arg Lys Leu Gly His Gly Gln Phe Gly

115 120 125

Thr Thr Phe Leu Cys Val Glu Lys Glu Thr Gly Lys Glu Tyr Ala Cys

130 135 140

Lys Ser Ile Ala Lys Arg Lys Leu Leu Thr Arg Asp Asp Ile Glu Asp

145 150 155 160

Val Arg Arg Glu Ile Gln Ile Met His His Leu Ala Gly His Ser Asn

165 170 175

Ile Ile Ser Ile Lys Gly Ala Tyr Glu Asp Ala Val Ala Val His Leu

180 185 190

Val Met Glu Leu Cys Thr Gly Gly Glu Leu Phe Asp Arg Ile Ala Lys

195 200 205

Arg Gly His Tyr Thr Glu Arg Lys Ala Ala Gln Leu Ala Arg Thr Ile

210 215 220

Ile Gly Val Val Glu Ala Cys His Ser Leu Gly Val Met His Arg Asp

225 230 235 240

Leu Lys Pro Glu Asn Phe Leu Phe Val Asn Glu Gln Glu Glu Ser Leu

245 250 255

Leu Lys Thr Ile Asp Phe Gly Leu Ser Val Phe Phe Lys Pro Gly Glu

260 265 270

Ile Phe Thr Asp Val Val Gly Ser Pro Tyr Tyr Val Ala Pro Glu Val

275 280 285

Leu Arg Lys Cys Tyr Gly Pro Glu Ala Asp Val Trp Ser Val Gly Val

290 295 300

Ile Ile Tyr Ile Leu Leu Ser Gly Val Pro Pro Phe Trp Ala Glu Ser

305 310 315 320

Glu Gln Glu Ile Phe Gln Glu Val Leu His Gly Asp Leu Asn Phe Ser

325 330 335

Ser Asp Pro Trp Pro His Ile Ser Glu Ser Ala Lys Asp Leu Ile Arg

340 345 350

Arg Ile Leu Val Arg Asp Pro Lys Lys Arg Leu Thr Ala His Glu Val

355 360 365

Leu Cys His Pro Trp Ile Gln Val Asp Gly Val Ala Pro Asp Lys Thr

370 375 380

Leu Asp Ser Ala Val Ile Ser Arg Leu Lys Gln Phe Ser Ala Met Asn

385 390 395 400

Lys Leu Lys Lys Met Ala Leu Arg Val Ile Ala Glu Asn Leu Ser Glu

405 410 415

Glu Glu Ile Ala Gly Leu Lys Glu Met Phe Lys Ile Ile Asp Thr Asp

420 425 430

Asn Ser Gly Gln Ile Thr Phe Glu Glu Leu Lys Ala Gly Leu Lys Arg

435 440 445

Phe Gly Ala Asn Leu Asn Glu Ala Glu Ile Tyr Asp Leu Met Gln Ala

450 455 460

Ala Asp Val Asp Asn Ser Gly Thr Ile Asp Tyr Gly Glu Phe Ile Ala

465 470 475 480

Ala Thr Phe His Leu Asn Lys Ile Glu Arg Glu Asp His Leu Phe Ala

485 490 495

Ala Phe Ser Tyr Phe Asp Lys Asp Gly Ser Gly Tyr Ile Thr Pro Asp

500 505 510

Glu Leu Gln Lys Ala Cys Glu Glu Phe Gly Met Glu Asp Val His Leu

515 520 525

Glu Glu Met Ile Gln Glu Val Asp Gln Asp Asn Asp Gly Leu Ile Asp

530 535 540

Tyr Asn Glu Phe Val Ala Met Met Gln Lys Gly Asn Asn Asn Asp Phe

545 550 555 560

Gly Lys Lys Gly Leu Glu Asn Gly Ile Ser Phe Gly Phe Arg Gln Pro

565 570 575

Leu Pro Val Tyr

580

Claims (3)

1. Isolated powdery mildew resistant gene of grape calcium dependent protein kinase as shown in SEQ ID NO. 1VpCDPK9The application in the production of powdery mildew resistant grape varieties.

2. A method for producing powdery mildew resistant grape plants, characterized in that the molecule shown in SEQ ID NO. 1Isolated powdery mildew resistant grape calcium dependent protein kinase geneVpCDPK9Introduced into grape plants and stably expressed.

3. A method for improving powdery mildew resistance of grape plants is characterized in that the separated powdery mildew resistant grape calcium dependent protein kinase gene shown in SEQ ID NO. 1VpCDPK9Introduced into the grape plant.

Images