CN112322651B - Application of tomato autophagy gene in improving plant root-knot nematode resistance - Google Patents

Abstract

The invention discloses an application of tomato autophagy genes ATGs in improving the resistance of plant root-knot nematodes, which comprises the following steps: (1) constructing an agrobacterium tumefaciens engineering bacterium A containing a tomato ATG10 gene overexpression vector; (2) transforming a target plant explant by mediating agrobacterium tumefaciens engineering bacteria A to prepare an ATGs gene over-expression plant; (3) and (3) carrying out root knot nematode inoculation stress treatment on the transgenic plants, and observing autophagy change, root knot number and phenotype. The research of the invention finds that the infection of meloidogyne incognita can quickly induce the expression of autophagy genes in tomato root systems, the mutant increases the sensitivity of meloidogyne incognita, and the over-expression of ATG10 is opposite. I.e. autophagy plays a role in tomato root knot nematode resistance.

Description

Application of tomato autophagy gene in improving plant root-knot nematode resistance

Technical Field

The invention relates to the technical field of biology, and in particular relates to application of a tomato autophagy gene in improving the resistance of plant root-knot nematodes.

Background

In recent years, with the steady development of economy in China, modern agriculture is also more and more emphasized, facility horticulture is rapidly developed, the facility vegetable planting area is rapidly increased, the multiple cropping index is continuously improved, the vegetable planting continuous cropping phenomenon is more common, the soil continuous cropping problem is serious, the continuous cropping obstacle harm is great, the plant diseases and insect pests are aggravated, the soil diseases and the allelopathy are caused, particularly, the harm of Root-knot nematodes (RKN) with extremely high concealment and danger is also increasingly serious, and the method becomes a technical bottleneck of facility vegetable development in some regions.

Tomatoes (Solanum lycopersicum L.) are used as a main solanaceous vegetable and are planted in a large area in China. In recent years, the planting area of a tomato protected area is increased year by year, the continuous cropping production causes the accumulation of pathogenic bacteria in the protected area soil, the area of the damage of soil-borne diseases is larger and larger, and the tomato has higher sensitivity to root-knot nematodes, so that the quality and the yield of the tomato are seriously affected, and non-insignificant economic losses are caused.

At present, more than 80 kinds of root-knot nematodes are found and reported worldwide, the root-knot nematodes are found in the rhizosphere of cucumber in UK in Berkeley in 1855, and Cornu is named for the first time in 1879, and the root-knot nematodes become one of the most serious soil-borne diseases which are widely distributed around the world and harm crops. The root-knot nematode damage mainly occurs at the roots of plants, lateral roots and fibrous roots are most easily infected, and the damage to the root systems of the plants is mainly reflected in three aspects: firstly, the direct mechanical injury destroys the normal differentiation and physiological metabolism of host epidermal cells; secondly, the kissing needle injures the host and destroys the host cell to cause the host cell to generate pathological changes; and thirdly, inducing the compound diseases, and providing invasion opportunities for soil fungal diseases such as blight, damping-off and the like due to wounds left by the root-knot nematodes when invading hosts, so that the root-knot nematodes and other pathogenic bacteria are infected in a combined manner, and further the damage to the hosts is aggravated. According to statistics, four common nematodes causing crop loss in China are: the root-knot nematode is characterized by comprising meloidogyne incognita (M.incognita), meloidogyne hapla (M.hapla), meloidogyne arachidi (M.arenaria) and meloidogyne javanica (M.javanica), wherein the meloidogyne incognita is the most serious pathogenic nematode in current vegetable production and seriously restricts the yield and quality of tomatoes. At present, in order to restrict the harm of the root-knot nematode, a series of comprehensive control means are adopted in production, much time is spent on the aspects of environmental regulation and the like, but the harm of the root-knot nematode is not restricted fundamentally, so that the response mechanism of the tomato to the root-knot nematode is analyzed, and the improvement of the resistance of the tomato to the root-knot nematode by using methods such as molecular, physiological and biochemical methods has great scientific and practical significance for increasing the yield of the tomato, improving the economic benefit, protecting the cultivation environment and the like.

In order to cope with external stress, plants evolve an advanced immune system. Autophagy is an evolutionarily conserved self-degradation mechanism in eukaryotes, and intracellular components are wrapped by autophagic vacuoles of double-layer membranes, then are conveyed into vacuoles, are degraded and reused by hydrolytic enzymes, and play an important role in growth and development and adversity stress response. Currently, studies on plant autophagy are mainly conducted in model plant arabidopsis thaliana, and focus on the identification and functional analysis of each component and related elements of autophagosome, while the regulation of plant autophagy is less well understood, and especially in horticultural plants, it is still lacking.

Disclosure of Invention

Autophagy plays an important role in growth and development and in the response to adversity stress. According to the research of the invention, the number of the nematodes which invade the roots of the tomatoes at 36h is the largest by inoculating the wild tomatoes, and the nematode is shown in the attached figure 1; simultaneously, RKN infection was found to induce autophagy in tomato roots, see FIGS. 2.1-2.2; on the basis, RKN infection is found to induce the expression of autophagy genes ATGs in tomato roots, and ATG10, ATG4, ATG6, ATG7 and other genes are found to be significantly expressed, as shown in figure 3; to further validate the relationship between RKN and autophagy, mutant plants of atg10, atg4, atg6, atg7 were constructed and atg10 phenotype was found to be most pronounced. Accordingly, the invention provides an application of tomato autophagy genes ATGs in improving the resistance of plant root-knot nematodes.

Preferably, the invention provides an application of tomato ATG10 gene in improving plant root knot nematode resistance, and tomato ATG10 gene is over-expressed in target plant, comprising the following steps:

(1) constructing an agrobacterium tumefaciens engineering bacterium A containing a tomato ATG10 gene overexpression vector;

(2) constructing agrobacterium tumefaciens engineering bacteria B containing tomato ATG10, ATG4, ATG6 and ATG7 genes CRISPR/Cas9 vectors;

(3) respectively mediating and transforming the agrobacterium tumefaciens engineering bacteria A and B to a target plant explant to prepare an ATG10 gene overexpression plant and ATG10, ATG4, ATG6 and ATG7 mutant plants;

(4) the ATG10 gene overexpression plants and ATG10, ATG4, ATG6 and ATG7 mutant plants were subjected to root knot nematode inoculation stress treatment, autophagosomes were observed and plant root knot number and phenotype were recorded.

The application of the invention refers to that the base sequence is shown as SEQ ID NO: 1, ATG10 shown in SEQ ID NO: 2, ATG4 shown in SEQ ID NO: 3, ATG6 shown in SEQ ID NO: 4 in the regulation of plant root knot nematode resistance, specifically, the expression is that the number of root knots is increased or reduced and the resistance of the root knot nematode is enhanced or reduced.

The lower the expression level of the ATG10 gene in the plant, the lower the number of autophagosomes, and the more the number of root knots of the plant is increased when the root-knot nematode is infected, the more sensitive the root-knot nematode infection is; the higher the expression level of the ATG10 gene in the plant, the more the number of autophagosomes is, the less the number of root knots of the plant is when the root-knot nematode is infected, and the resistance of the root-knot nematode of the plant is enhanced.

The method for cultivating root-knot nematode infection resistance provided by the invention can be specifically divided into the following (A) or (B).

(A) Cultivating a transgenic plant having a trait of interest for reduced root knot number and/or enhanced resistance of the plant to root knot nematodes comprising the steps of:

a) introducing an overexpression vector of the ATG10 gene into a target plant for overexpression to obtain a transgenic plant with the ATG10 gene overexpression;

b) compared with an untreated target plant, the transgenic plant with the ATG10 gene overexpression has the objective character of reducing the number of root knots and/or enhancing the resistance of the plant to the root-knot nematode.

(B) Cultivating a transgenic plant having a trait of interest comprising an increased number of root nodes and/or a plant having reduced resistance to root-knot nematodes, comprising the steps of:

a) introducing CRISPR/Cas9 vectors of ATG10, ATG4, ATG6 and ATG7 genes into a target plant for inhibition expression to obtain mutant plants with ATG10, ATG4, ATG6 and ATG7 genes for inhibition expression;

b) compared with an untreated target plant, the mutant plant with the ATG10, ATG4, ATG6 and ATG7 gene suppression expression obtains a transgenic plant with target traits of increased root knot number and/or reduced plant resistance to root knot nematodes.

In the above method (A), the ATG10 gene can be introduced into a target plant by a recombinant expression vector containing the gene, and the recombinant expression vector can be the existing pFGC5941, pCAMBIA1300 and pBI121, etc., or other derived plant expression vectors, and when a plant expression vector is used to construct a recombinant vector, a constitutive, tissue-specific or inducible promoter can be used.

In the method (B), the target plant may be subjected to expression suppression of the ATG10, ATG4, ATG6 or ATG7 genes, and the expression of the ATG10, ATG4, ATG6 or ATG7 genes in the target plant may be reduced. In the invention, the inhibition expression of ATG10, ATG4, ATG6 and ATG7 genes in a target plant is realized by constructing a CRISPR/Cas9 vector of the genes and further infecting the genes by agrobacterium.

The tomato ATG10, ATG4, ATG6 and ATG7 genes are selected from any one of the following two genes:

a. the base sequences of the tomato ATG10, ATG4, ATG6 and ATG7 genes are shown as SEQ ID NO: 1-4;

b. any one of the nucleotide sequences thereof has a nucleotide sequence similar to that of SEQ ID NO: 1-4 have more than 90% homology and encode a sequence as shown in SEQ ID NO: 5-8 (SEQ ID NO: 5 is the amino acid sequence coded by ATG 10; SEQ ID NO: 6 is the amino acid sequence coded by ATG 4; SEQ ID NO: 7 is the amino acid sequence coded by ATG 6; and SEQ ID NO: 8 is the amino acid sequence coded by ATG 7).

The target plant may be a dicot or a monocot. The target plant is preferably tomato.

Taking tomato as an example, the preparation method of the agrobacterium tumefaciens engineering bacteria A and the agrobacterium tumefaciens engineering bacteria B is as follows:

(a) extracting total RNA from young leaves of wild tomato;

(b) reverse transcribing the tomato total RNA obtained in step (a) into cDNA;

(c) taking the cDNA obtained in the step (b) as a template, and SlAtg 10-OE-F (SEQ ID NO: 9) and SlAtg10-OE-R (SEQ ID NO: 10) as primers (containing AscI and KpnI restriction sites) to perform PCR amplification on the ATG10 gene to obtain 711bp of the full length of CDs of the tomato ATG10 gene; the plant transformation vector pFGC1008-3HA driven by the CaMV 35S promoter is subjected to enzyme digestion by AscI and KpnI restriction enzymes to be linearized, and then homologous recombination of the fragment and the vector is carried out to construct an overexpression vector of the tomato ATG10 gene, which is named as pFGC1008-Sl Atg10-3 HA.

(d) The target sequences of tomato ATG10, ATG4, ATG6 and ATG7 genes are designed at CRISPR-P website (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and primers sgRNA-ATG10-F1(SEQ ID NO: 11), sgRNA-ATG10-R1(SEQ ID NO: 12), sgRNA-ATG10-F2(SEQ ID NO: 13) and sgRNA-ATG10-R2(SEQ ID NO: 14) are designed for deletion editing of large fragments of the genes. The design methods of the rest ATG4, ATG6 and ATG7 are the same, and the primer sequences are respectively as follows: sgRNA-atg4-F1, sgRNA-atg4-R1, sgRNA-atg4-F2, sgRNA-atg4-R2(SEQ ID NOS: 15-18); sgRNA-atg6-F1, sgRNA-atg6-R1, sgRNA-atg6-F2, sgRNA-atg6-R2(SEQ ID NOS: 19-22); sgRNA-atg7-F1, sgRNA-atg7-R1, sgRNA-atg7-F2, sgRNA-atg7-R2(SEQ ID NOS: 23-26). The U6 promoter used in this system, so that linker sequences were added to both ends of the sgRNA recognition sequence, respectively, theoretically, when two sgrnas act simultaneously, a large fragment between them would be deleted.

Since the method for constructing the mutant is the same, taking ATG10 as an example: annealing the synthesized sgRNA forward and reverse primers to form double-stranded sgRNA containing a cohesive end joint, diluting by 200 times, and connecting with a BbsI-digested sgRNA-Cas9 framework vector at 16 ℃ overnight. The ligation product was transformed into E.coli DH 5. alpha. competent cells in the presence of ampicillin (Amp)⁺) After the LB solid medium is cultured overnight at 37 ℃, selecting a single clone, carrying out bacterial liquid PCR by using an M13F universal primer and an annealed downstream primer, and carrying out sequencing identification on a positive single clone to obtain positive sgRNA-atg10-1 and sgRNA-atg10-2 clones.

And (3) amplifying a second sgRNA sequence by taking AtU6-F-KpnI as a front primer and AtsgR-R-EcoRI as a rear primer and a positive vector sgRNA-atg10-2 as a template, and then connecting a framework vector containing the sequences of sgRNA-atg10-1 and Cas 9. The positive plasmid sgRNA-atg10-1-sgRNA-atg10-2 with correct sequencing and the plant expression vector pCAMBIA1300 are respectively subjected to double enzyme digestion by HindIII and EcoRI, the recovered sgRNA-atg10-1-sgRNA-atg10-2 fragment and the linearized pCAMBIA1300 are subjected to overnight connection, are transformed into DH5 alpha competence, are cultured in a solid LB culture medium containing 50mg/L kanamycin at 37 ℃ overnight, are subjected to single clone culture, are subjected to bacterial liquid PCR identification by using 1300-seq-R and AtUBQ-seq-R primers, and are subjected to sequencing after positive clones are identified. The positive plasmid was named pCAMBIA1300-sgRNA-atg10-1-sgRNA-atg10-2-Cas 9.

(e) Respectively transferring the overexpression vector pFGC1008-SlAtg10-3HA and the CRISPR/Cas9 vector pCAMBIA1300-sgRNA-ATG10-1-sgRNA-ATG10-2-Cas9 obtained in the steps (c) and (d) into Agrobacterium tumefaciens GV3101 to obtain Agrobacterium tumefaciens engineering bacteria A containing the tomato ATG10 gene overexpression vector and Agrobacterium tumefaciens engineering bacteria B containing the tomato ATG10 gene CRISPR/Cas9 vector, and similarly obtaining the Agrobacterium tumefaciens engineering bacteria B containing the tomato ATG4, ATG6 and ATG7 gene CRISPR/Cas9 vector according to the above methods.

In the step (3), the inoculation root-knot nematode stress treatment specifically comprises: when the tomato ATG10 gene overexpression plant grows to five leaves and one heart, the root-knot nematode is inoculated.

Preferably, the inoculated root knot nematode is meloidogyne incognita at stage J2 with infective vigor. The time of the inoculation root-knot nematode stress treatment is 4 weeks.

The invention takes Meloidogyne incognita as a representative, and the specific steps of culturing and inoculating treatment are as follows:

1) the meloidogyne incognita is presented by professor Pendlang of Chinese academy of agricultural sciences, and the meloidogyne incognita is bred in sandy soil by ordinary cultivated tomatoes in a greenhouse of an agricultural test station, and the room temperature is maintained at 22-26 ℃. The tomato root system forms macroscopic root lumps in about 2 months.

2) Washing the harvested root knot with tap water, soaking in 0.5% sodium hypochlorite water solution for 5min, and washing with distilled water until no pungent smell of sodium hypochlorite exists.

3) Grinding the root system, sieving the homogenate mixed solution with 80 mesh, 200 mesh, 325 mesh and 500 mesh sieves in turn, repeatedly washing the root system dregs with sterile water for 3 times, filtering, and finally enriching the root-knot nematode eggs on the 500 mesh sieve.

4) The eggs were rinsed into the beaker with distilled water. The egg suspension was stirred well, 10. mu.L was pipetted onto the slide using a pipette, and the total number of eggs was counted and estimated under a 50-fold optical microscope. And calculating the number of the nematodes according to the hatching rate of 10-20%.

5) The egg suspension was pipetted onto sterile absorbent paper laid in 10cm x 10cm square petri dishes using a pipette gun. The petri dish was placed in a constant temperature incubator at 28 ℃ while taking care to keep the absorbent paper in a wet state.

6) After 2-3 days, the nematode is washed by distilled water from the upper part of the absorbent paper and then seeps into a culture dish, and the nematode in the J2 stage for experiments is washed out by the distilled water. The obtained J2 stage nematodes are inoculated for 24h as much as possible to avoid death of the nematode bodies.

7) Inoculation was carried out when ATG10 gene was overexpressed and the mutant plants ATG10, ATG4, ATG6 and ATG7 grew to five leaves and one heart, and about 1000 nematodes were inoculated per plant at the stage of J2 and were watered normally.

Plants were cultivated in plastic cups containing autoclaved river sand, irrigated with Hoagland nutrient solution each time. The growth conditions were: day and night temperature 23 deg.C/20 deg.C, 14h photoperiod and 600 μmol m^-2s^-1The intensity of the light.

The time for inoculation of root-knot nematode stress treatment was 4 weeks.

ATG10, ATG4, ATG6 and ATG7 gene transgenic plants are blank control with tomato cultivar Ailsa Craig.

After the nematode treatment is finished, the nematode is compared with a control group which is not subjected to nematode treatment under the same planting condition, and differences between ATG10, ATG4, ATG6 and ATG7 gene transgenic plants and blank controls thereof and plants which are not subjected to stress treatment are observed.

The observation method of the number of root knots is as follows:

and (3) adopting an acid fuchsin dyeing method for observing the root system phenotype of root-knot nematode infection. The specific method comprises the following steps:

1. after tomato roots infected by root-knot nematodes are washed clean by tap water, bleaching the roots by using 1.5-5% of sodium hypochlorite solution according to the tender degree of the roots, wherein the process takes 5-10 minutes to remove impurities in the roots, which affect dyeing;

2. then repeatedly washing with tap water until no pungent smell of sodium hypochlorite exists, so as to avoid influencing subsequent dyeing effect;

3. absorbing water of root systems by using absorbent paper, soaking in 3.5% acid fuchsin solution, heating to boil, and cooling at room temperature;

4. pouring off fuchsin staining solution, washing the tomato root system with tap water, and removing redundant fuchsin liquid on the surface;

5. adding acid glycerol, heating to boil, and transferring the root system to the acid glycerol at normal temperature;

6. photographing and counting the number of root knots after 24 h.

The number of autophagosomes in tomato roots was observed as follows:

MDC dyeing is adopted, and the tomato root segment is tabletted, treated and observed according to the following method:

(I) tomato leaves were cut into 2mm × 4mm pieces, placed in 100 μ M MDC (Sigma-Aldrich, 30432) solution, and evacuated;

(II) placing for 30min in dark;

(III) rinsing twice with PBS buffer, finally placing in PBS buffer, and observing autophagy with LSM 780 confocal microscope (Zeiss, Germany).

The TEM is adopted to detect the autophagosome activity, and the specific steps are as follows:

A) cutting tomato leaf into pieces of 1mm × 3mm, and fixing with 2.5% glutaraldehyde at 4 deg.C overnight;

B) pouring off the fixing solution, and rinsing the sample with 0.1M phosphate buffer solution with pH7.0 for three times, 15min each time;

C) fixing the sample with 1% osmate solution for 1-2 h;

D) osmate waste was carefully removed and the samples were rinsed three times for 15min each with 0.1M, pH7.0 phosphate buffer;

E) dehydrating the sample with ethanol solution with gradient concentration (including four concentrations of 30%, 50%, 70%, and 80%), each concentration for 15 min;

F) transition to 90%, 100% acetone solution treatment, each time for 20 min;

G) the sample was treated with a mixture of Spurr embedding medium and acetone (V/V-1/1) for 1 h;

H) the sample was treated with a mixture of Spurr embedding medium and acetone (V/V-3/1) for 3 h;

I) treating the sample with pure embedding agent at room temperature overnight;

J) embedding the sample subjected to the permeation treatment, heating at 70 ℃ overnight to obtain an embedded sample, and slicing the sample in an LEICA EM UC7 type ultrathin slicer to obtain 70-90nm slices;

K) staining slices with lead citrate solution and 50% ethanol saturated solution of uranyl acetate for 5-10 min;

l) were observed in a transmission electron microscope of the Hitachi H-7650 type.

The research shows that the meloidogyne incognita infection can rapidly induce the expression of ATGs genes in tomato roots, the sensitivity of the meloidogyne is increased by mutant plants, the number of autophagosomes is reduced, the activity is weakened, and the over-expression is opposite.

Drawings

FIG. 1 shows RKN invasion of wild type tomato roots at various time points. FIG. 1A shows the scale Bar of RKN invasion, Bar 100 μm, in each root tip after acid fuchsin staining; FIG. 1B shows the number of RKN invaded per root.

Figure 2.1 is the expression of autophagy at the protein level in wild-type tomato roots. FIG. 2.1A is Atg8 protein level; FIG. 2.1B is NBR1 protein level; FIG. 2.1C is ubiquitinated protein level.

Figure 2.2 shows the results of autophagosome assays in wild-type tomato roots. Fig. 2.2A shows MDC staining detection autophagy scale Bar 50 μm; FIG. 2.2B shows transmission electron microscopy autophagy. Autophagy packets are indicated by arrows. V, vacuole. Bar 1 μm.

FIG. 3 shows the results of specific expression of ATGs gene in roots of wild type tomato plants after 0h, 24h, 36h, 48h, 72h of RKN infection by qRT-PCR detection in roots of wild type tomato plants.

Fig. 4 is 35S: construction of an ATG10 overexpression vector and verification of ATG10 overexpression transgenic positive plants. Wherein, FIG. 4A is a simple schematic diagram of an overexpression vector of pFGC1008-3 HA; FIG. 4B shows the detection of transgenic positive plants at the protein level; FIG. 4C shows real-time fluorescent quantitative PCR detection of over-expressed transgenic positive plants. Wherein WT is a non-transgenic wild type tomato Ailsa Craig; OE is ATG10 overexpression plant; OE-Atg10-7 and OE-Atg10-44 are two lines of ATG10 overexpressing plants.

FIG. 5 shows the construction of CRISPR/Cas9 vectors of tomato ATG10, ATG4, ATG6 and ATG7 genes and the sequencing results of the gene knockout. Wherein, FIG. 5A is a positional structure diagram of a vector gRNA; FIG. 5B shows sequencing results of tomato ATG10 CRISPR/Cas9 knockout plants; FIG. 5C shows the sequencing result of tomato ATG4CRISPR/Cas9 knockout plant; FIG. 5D shows sequencing results of tomato ATG6 CRISPR/Cas9 knockout plants; FIG. 5E shows sequencing results of tomato ATG7 CRISPR/Cas9 knockout plants.

FIG. 6 shows the results of autophagosome assays of atg10, atg4, atg6 and atg7 mutant plants. MOCK, no nematode inoculation; RKN, inoculated with RKN36 h. Fig. 6A shows MDC staining detection autophagy scale Bar 50 μm; FIG. 6B shows transmission electron microscopy autophagy. Autophagy packets are indicated by arrows. V, vacuole. Bar 1 μm.

FIG. 7 is a statistical and phenotypic record of root node numbers after inoculation of mutant plants atg10, atg4, atg6, atg7 with RKN for four weeks. FIG. 7A is a root node count statistic; fig. 7B shows a root knot chart scale Bar of 1 cm.

FIG. 8 shows the expression results of protein level of Atg8 after tomato ATG10 different genotype plants are inoculated with root-knot nematode for 36 h.

FIG. 9 shows the result of autophagosome detection of tomato ATG10 after different genotype plants are inoculated with root-knot nematode for 36 h. MOCK, no nematode inoculation; RKN, inoculated with RKN36 h. Fig. 9A shows MDC staining detection autophagy scale Bar 50 μm; FIG. 9B is transmission electron microscopy autophagy. Autophagy packets are indicated by arrows. V, vacuole. Bar 1 μm.

FIG. 10 is a statistical and phenotypic record of root node numbers after inoculation of RKN for four weeks on ATG10 different genotype plants. FIG. 10A is a root node count statistic; fig. 10B shows a root knot chart scale Bar of 1 cm.

Detailed Description

The invention is further described with reference to the following drawings and specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples are conducted under conditions not specified, usually according to conventional conditions, or according to conditions recommended by the manufacturer.

The test materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1

RKN treatment induces wild type tomato autophagy

RKN treatment of wild type tomatoes, the specific method is as follows: when the tomato grows to five leaves and one heart, the tomato is inoculated with nematode, and each plant is inoculated with about 1000 nematodes at J2 stage, and the plants are watered normally.

a. Tomato root samples were taken at 0h, 24h, 36h, 48h, 72h after inoculation and acid magenta staining was performed to count the number of phenotypes and invasion per root. FIG. 1A shows RKN invasion Bar 100 μm in each root tip after acid fuchsin staining; FIG. 1B shows the number of RKN invaded per root.

b. Extracting protein from tomato root samples after inoculation for 0h, 24h, 36h, 48h and 72h, and carrying out Western Blot, wherein the specific method comprises the following steps:

1)Western Blot

taking 0.3g of protein sample in a 1.5mL centrifuge tube, putting a steel ball, grinding into powder in a sample grinder, adding a proper amount of protein extracting solution to mix into homogenate, placing on ice for 15min, centrifuging at 4 ℃ and 12000g for 20min, and taking the supernatant. Protein concentration was determined by Coomassie blue assay SDS-PAGE gel protein transfer to nitrocellulose membrane, blocked with 5% skim milk powder in TBS buffer (20mM Tris, pH 7.5, 150mM NaCl, 0.1% Tween 20) for 1h at room temperature, incubated with Atg8a, NBR1a antibody for 1h, and then with goat anti-mouse (Millipore, AP124P) or goat anti-rabbit (Cell Signaling Technology,7074) in HRP secondary antibody for 1h at room temperature, and antigen-antibody complexes were detected using luminol chemiluminescence detection kit (Thermo Fisher Scientific, 34080). The Western Blot results are shown in FIG. 2.1.

Protein extracting solution: 50mM Tris-HCl, pH 8.0, 150mM NaCl, 1mM EDTA, 1% Triton X-100, 1mM phenyl methyl allyl fluoride (PMSF) and 0.2% beta-mercaptoethanol.

c. Tomato root samples were taken after inoculation for 0h, 24h, 36h, 48h and 72h, MDC staining and transmission electron microscopy treatment were performed to observe autophagosome changes, and the detection results are shown in figures 2.2A & B.

d. Tomato root samples are taken after inoculation for 0h, 24h, 36h, 48h and 72h, RNA is extracted (total RNA of tomato tender roots is extracted by adopting a Tiangen Plant total RNA extraction kit), and real-time fluorescent quantitative PCR (qRT-PCR) is carried out according to a primer sequence, and the specific method comprises the following steps:

mu.g of total RNA was reverse transcribed into cDNA using a reverse transcription kit (ReverTra Ace qPCR RT kit, Toyobo). Real-time fluorescent quantitative PCR (qRT-PCR) Using Roche

480II real-time fluorescence detection system, and gene expression analysis using SYBR Green RT-PCR Kit fluorescent dye Kit (Nanjing Novozam), primers are shown in Table 1. mu.L of 2 XSSYBR Green Supermix, 0.4. mu.L of sense and antisense-terminated primers (10. mu.M), 1. mu.L of cDNA template, and 8.2. mu.L of ddH20 were included in a 20. mu.L reaction. The PCR reaction conditions are as follows: 3min at 95 ℃; denaturation at 95 ℃ for 10S, annealing at 58 ℃ for 30S, 40 cycles. Fluorescence data was collected at the end of extension of each cycle. Tomato Actin gene is used as internal reference. The specificity of the primer was judged from the melting curve. The primer sequences are shown in Table 1. The relative gene expression level was calculated by the method described in Livak and Schmittgen (Analysis of relative gene expression data using real-time quantitative PCR and the22DDCT method, Methods,2001,25: 402-408). The tests were all results of three replicates. The results of qRT-PCR are shown in FIG. 3.

TABLE 1 real-time fluorescent quantitative PCR primers

Example 2

Tomato ATG10 overexpression plant construction and detection

1. Tomato total RNA extraction

Extracting total RNA of tomato tender roots by using a Tiangen Plant total RNA extraction kit, which comprises the following steps:

(1) grinding 0.1g of tomato root sample in liquid nitrogen, adding 1mL of lysis solution RZ, and uniformly mixing by vortex;

(2) standing at room temperature for 5min to completely separate nucleic acid protein complex;

(3) centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, and transferring into a new centrifugal tube without RNase;

(4) adding 200 μ L chloroform, covering the tube cover, shaking vigorously for 15s, and standing at room temperature for 3 min;

(5) after centrifugation at 12000rpm for 10min at 4 ℃, the sample will be divided into three layers: yellow organic phase, intermediate layer and colorless aqueous phase, RNA mainly in the upper aqueous phase, the volume of the aqueous phase is about 50% of the lysis solution RZ reagent used. Transferring the water phase to a new tube for the next operation;

(6) 0.5 volume of absolute ethanol was added slowly and mixed well (precipitation may occur). Transferring the obtained solution and the precipitate into an adsorption column CR3, centrifuging at 4 ℃ and 12000rpm for 30s, and removing waste liquid in a collecting pipe;

(7) adding 500 μ L deproteinized solution RD into adsorption column CR3, centrifuging at 4 deg.C and 12000rpm for 30s, and discarding the waste liquid;

(8) adding 600 μ L of rinsing solution RW into adsorption column CR3, standing at room temperature for 2min, centrifuging at 4 deg.C and 12000rpm for 30s, and discarding the waste solution;

(9) repeating the operation step (8);

(10) putting the adsorption column into a 2mL collecting tube, centrifuging at 4 ℃ and 12000rpm for 2min, and removing residual waste liquid;

(11) drying the adsorption column on a super clean bench for 5min, transferring into a new centrifugal tube without RNase, adding 50 μ L RNase-Free ddH₂O, standing at room temperature for 2min, and centrifuging at 12000rpm at 4 ℃ for 2 min;

(12) OD measurement with UV spectrophotometer₂₆₀/OD₂₈₀Checking RNA sample content and purity, concentration is 781 ng/. mu.L, OD₂₆₀/OD₂₈₀＝2.10。

2. Gene cloning and Agrobacterium tumefaciens engineering bacterium construction

Mu.g of tomato total RNA was reverse transcribed into cDNA using Toyobo ReverTra Ace qPCR RT Kit. Using the obtained cDNA as a template, and using SlAtg 10-OE-F (SEQ ID NO: 9) and SlAtg10-OE-R (SEQ ID NO: 10) as primers (containing AscI and KpnI restriction enzyme cutting sites) to perform PCR amplification on the ATG10 gene to obtain 711bp of the full length of CDs of the tomato ATG10 gene; the plant transformation vector pFGC1008-3HA driven by the CaMV 35S promoter is subjected to enzyme digestion by AscI and KpnI restriction enzymes to be linearized, and then homologous recombination of the fragment and the vector is carried out to construct an overexpression vector of the tomato ATG10 gene, which is named as pFGC1008-Sl Atg10-3 HA. FIG. 4A is a simplified schematic diagram of the pFGC1008-3HA overexpression vector.

The sequencing result is shown in SEQ ID NO: 1, and the sequence of the coded protein is shown as SEQ ID NO: 5, the results showed that the cloned sequence was identical to the sequence published in solgenomics (Solyc09g 047840). The obtained overexpression vector pFGC1008-SlAtg10-3HA is transferred into agrobacterium tumefaciens GV3101 to obtain agrobacterium tumefaciens engineering bacteria A containing tomato ATG10 gene overexpression vector.

The primer sequences used were as follows:

Sl Atg10-OE-F：ttacaattaccatggggcgcgccATGACATCTATCTCCTCCTCATGGG(SEQ ID NO：9)

SlAtg10-OE-R：aacatcgtatgggtaggtaccCCGAGTAATAAAGGTCCATTTAGATACT(SEQ ID NO：10)

3. construction of tomato ATG10 Gene overexpression plants

Infecting tomato cotyledons through agrobacterium mediation, transforming a target vector pFGC1008-SlAtg10-3HA into the tomato cotyledons, and primarily screening candidate transgenic plants by utilizing hygromycin. The forward primer and the reverse primer of the hygromycin gene sequence are matched, and the obtained transgenic plant is screened by a PCR amplification method.

The method comprises the following specific steps:

1) preparation of culture Medium

Seeding culture medium: 2.15g/L MS powder +100mg/L inositol +10g/L sucrose +8g/L agar. The pH was 5.8.

A nursing culture medium: alcohol +1.3g/L thiamine hydrochloride +0.2 mg/L2, 4-D +200mg/L KH₂PO₄+0.1mg/L KT +7.5g/L agar. The pH was 5.8.

2Z selection of regeneration medium: 4.44g/L MS powder, 30g/L sucrose, 100mg/L inositol, 2mg/L ZR, 300mg/L timentin and 6mg/L hygromycin. The pH was 5.8.

0.2Z selection of regeneration Medium: 4.44g/L MS powder, 30g/L sucrose, 100mg/L inositol, 0.2mg/L ZR, 300mg/L timentin and 6mg/L hygromycin. The pH was 5.8.

Rooting culture medium: 4.44g/L MS powder, 30g/L sucrose, 100mg/L inositol, 300mg/L timentin and 6mg/L hygromycin. The pH was 5.8.

Liquid MS0.2 medium: 4.44g/L MS powder, 20g/L sucrose, 100mg/L inositol and 0.2mg/L thiamine hydrochloride. The pH was 5.8. For suspension infesting agrobacterium.

YEB Medium: 5g beef extract, 5g peptone, 1g yeast extract, 5g sucrose, 0.5g MgSO 5₄·7H₂And O, diluting to 1L with distilled water, adjusting the pH value to 7.0, and sterilizing at 121 ℃ for 20min for later use. 15g of agar powder is added into each liter of YEB solid culture medium, and other components are the same as liquid culture medium.

2) Cultivation of aseptic seedlings

Soaking tomato seeds in tap water (or shaking table at 28 ℃ for 200r/min) for 6-8 h, then sterilizing with 75% alcohol for 30sec, then sterilizing in 10% NaClO for 15min (shaking table at 28 ℃ for 200r/min), washing with sterilized distilled water for 3 times, transferring to a sterilized vessel, and inoculating to 1/2MS culture medium. Culturing at 25 deg.C in dark to expose white, transferring into light culture room, and culturing at 25 deg.C under 16h light/8 h dark with light intensity of 1800 lx.

3) Preparing explant and culturing agrobacterium

After the seeds germinate for about one week, when cotyledons are stretched and true leaves do not grow out, cutting the cotyledons of the aseptic seedlings into two sections by using a new scalpel, laying the cotyledons with a small leaf stalk in a nursing culture medium for pre-culture for 24 hours (the seedlings are protected from light and can stay overnight, and the too long nursing culture time easily causes over-infection). A single colony of Agrobacterium was picked on an antibiotic-containing LB plate, inoculated into 30mL of antibiotic-containing LB (150mL Erlenmeyer flask), and cultured overnight at 28 ℃ at 200r/min to mid-log phase (OD600 ≈ 1.0, about 16-24 h). Shaking the strain, and then cutting cotyledons (inoculating for 12-20 h).

4) Regeneration by transformation

Taking out the Agrobacterium tumefaciens engineering bacteria A liquid containing target vector plasmids from a refrigerator at the temperature of-80 ℃, after activating on a YEB plate containing antibiotics, selecting single agrobacterium tumefaciens colonies, inoculating the single agrobacterium tumefaciens colonies into 2mL of YEB containing antibiotics, shaking at 28 ℃, shaking at 200rpm for overnight culture, then expanding and shaking at 30mL according to the proportion of 1:100, and culturing at 28 ℃, overnight culture at 200rpm until OD is achieved₆₀₀0.8 to 1.0. The cultured agrobacterium is centrifuged at 4000r/min at 4 ℃ for 10min; the supernatant was discarded, and 15mL of suspension medium MS0.2 was added to suspend the cells for further use. Transferring the pre-cultured cotyledon explants to a sterile culture dish poured with MS0.2 with the volume of 15ml, pouring the suspended bacterial liquid, infecting for 2-3 min in the dark, and slightly shaking the culture dish. Gently scooping the explant with forceps, transferring the explant to sterilizing filter paper, sucking off residual bacteria liquid, transferring to sterilizing filter paper, sucking off residual bacteria liquid, spreading the explant back to the original nursing culture medium with the reverse side facing upwards, and co-culturing for 48h in the dark at 22 ℃.

And transferring the explants subjected to co-culture to a 2Z culture medium with the right side facing upwards, culturing at 25 ℃ under 16h illumination/8 h dark light period, replacing the fresh 2Z culture medium every two weeks, cutting the browned explants after the buds are differentiated, and transferring the differentiated buds to a 0.2Z culture medium for selective culture. Fresh medium was changed every three weeks.

5) Rooting culture and transplantation

When the regeneration bud grows to about 1cm, the bud is cut off (optionally, the bud can not be cut so as to avoid damaging the rooting part), and the bud is put into a rooting culture medium for rooting. After 2 weeks, hardening the transformed seedlings with good roots and about 5cm long, and transplanting the transformed seedlings to grass carbon: and (3) obtaining tomato ATG10 gene overexpression plants in a nutrition pot with a vermiculite-3: 1 matrix.

Detection of ATG10 Gene overexpression plants

(1) Tomato ATG10 overexpression positive plants were detected at the protein level using Western Blot.

The Western method is the same as the above method. The Western Blot results are shown in FIG. 4B.

(2) Detection of tomato ATG10 overexpression positive plants at transcription level by using qRT-PCR

The specific method is shown in the above examples, the same method is used, and the primers are shown in Table 2.

TABLE 2 real-time fluorescent quantitative PCR primers

Example 3

Tomato atg10, atg4, atg6 and atg7 mutant plant construction and detection

1. Tomato total RNA extraction

The extraction method of total RNA of tomato tender roots is the same as the total RNA extraction method by adopting the Tiangen Plant total RNA extraction kit.

2. Gene cloning and Agrobacterium tumefaciens engineering bacterium construction

The target sequences of tomato ATG10, ATG4, ATG6 and ATG7 genes are designed at CRISPR-P website (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and primers sgRNA-ATG10-F1(SEQ ID NO: 11), sgRNA-ATG10-R1(SEQ ID NO: 12), sgRNA-ATG10-F2(SEQ ID NO: 13) and sgRNA-ATG10-R2(SEQ ID NO: 14) are designed for deletion editing of large fragments of the genes. The design methods of the rest ATG4, ATG6 and ATG7 are the same, and the primer sequences are respectively as follows: sgRNA-atg4-F1, sgRNA-atg4-R1, sgRNA-atg4-F2, sgRNA-atg4-R2(SEQ ID NOS: 15-18); sgRNA-atg6-F1, sgRNA-atg6-R1, sgRNA-atg6-F2, sgRNA-atg6-R2(SEQ ID NOS: 19-22); sgRNA-atg7-F1, sgRNA-atg7-R1, sgRNA-atg7-F2, sgRNA-atg7-R2(SEQ ID NOS: 23-26). The U6 promoter used in this system, so that linker sequences were added to both ends of the sgRNA recognition sequence, respectively, theoretically, when two sgrnas act simultaneously, a large fragment between them would be deleted.

Since the method for constructing the mutant is the same, taking ATG10 as an example: annealing the synthesized sgRNA forward and reverse primers to form double-stranded sgRNA containing a cohesive end joint, diluting by 200 times, and connecting with a BbsI-digested sgRNA-Cas9 framework vector at 16 ℃ overnight. The ligation product was transformed into E.coli DH 5. alpha. competent cells in the presence of ampicillin (Amp)⁺) After the LB solid medium is cultured overnight at 37 ℃, selecting a single clone, carrying out bacterial liquid PCR by using an M13F universal primer and an annealed downstream primer, and carrying out sequencing identification on a positive single clone to obtain positive sgRNA-atg10-1 and sgRNA-atg10-2 clones.

And (3) amplifying a second sgRNA sequence by taking AtU6-F-KpnI as a front primer and AtsgR-R-EcoRI as a rear primer and a positive vector sgRNA-atg10-2 as a template, and then connecting a framework vector containing the sequences of sgRNA-atg10-1 and Cas 9. The positive plasmid sgRNA-atg10-1-sgRNA-atg10-2 with correct sequencing and the plant expression vector pCAMBIA1300 are respectively subjected to double enzyme digestion by HindIII and EcoRI, the recovered sgRNA-atg10-1-sgRNA-atg10-2 fragment and the linearized pCAMBIA1300 are subjected to overnight connection, are transformed into DH5 alpha competence, are cultured in a solid LB culture medium containing 50mg/L kanamycin at 37 ℃ overnight, are subjected to single clone culture, are subjected to bacterial liquid PCR identification by using 1300-seq-R and AtUBQ-seq-R primers, and are subjected to sequencing after positive clones are identified. The positive plasmid was named pCAMBIA1300-sgRNA-atg10-1-sgRNA-atg10-2-Cas 9. FIG. 5A is a positional structure diagram of a vector gRNA.

The obtained CRISPR/Cas9 vector pCAMBIA1300-sgRNA-ATG10-1-sgRNA-ATG10-2-Cas9 is transferred into Agrobacterium tumefaciens GV3101 to obtain the Agrobacterium tumefaciens engineering bacteria B containing the CRISPR/Cas9 vectors of tomato ATG10, ATG4, ATG6 and ATG7 genes.

The primer sequences used were as follows:

sgRNA-atg10-F1:CTGGTCTCTATTGaacaaagcaccagtggtctagtg(SEQ ID NO：11)

sgRNA-atg10-R1:CTGGTCTCTGGAGGTAATAGTGCCATC(SEQ ID NO：12)

sgRNA-atg10-F2 GCTGGTCTCTCTCC gttttagagctagaaatagcaagtta(SEQ ID NO：13)

sgRNA-atg10-R2 GCTGGTCTCTAAACTGAGGTTTGTCTTCGGTT(SEQ ID NO：14)

sgRNA-atg4-F1:CTGGTCTCTATTGaacaaagcaccagtggtctagtg(SEQ ID NO：15)

sgRNA-atg4-R1:CTGGTCTCTGCATTATCGTGGTTCTAAAT(SEQ ID NO：16)

sgRNA-atg4-F2:GCTGGTCTCTATGCgttttagagctagaaatagcaagtta(SEQ ID NO：17)

sgRNA-atg4-R2:GCTGGTCTCTAAACTGAGGTTTGTCTTCGGTT(SEQ ID NO：18)

sgRNA-atg6-F1:CTGGTCTCTATTGaacaaagcaccagtggtctagtg(SEQ ID NO：19)

sgRNA-atg6-R1:CTGGTCTCTGACCCGGCCCAGTCTATCACG(SEQ ID NO：20)

sgRNA-atg6-F2:GCTGGTCTCTGGTCtgcaccagccgggaa(SEQ ID NO：21)

sgRNA-atg6-R2:GCTGGTCTCTAAACGGAGGTACTTACTGGGGTTT(SEQ ID NO：22)

sgRNA-atg7-F1:CTGGTCTCTATTGaacaaagcaccagtggtctagtg(SEQ ID NO：23)

sgRNA-atg7-R1:CTGGTCTCTGCAGAAGCCAAGAAGGTATA(SEQ ID NO：24)

sgRNA-atg7-F2:GCTGGTCTCTCTGCgttttagagctagaaatagcaagtta(SEQ ID NO：25)

sgRNA-atg7-R2:GCTGGTCTCTAAACATGAGTCGGGAACAGCCTAT(SEQ ID NO：26)

3. construction of tomato atg10, atg4, atg6 and atg7 mutant plants

Taking atg10 as an example, infecting tomato cotyledons through agrobacterium mediation, transforming a target vector pCAMBIA1300-sgRNA-atg10-1-sgRNA-atg10-2-Cas9 into the tomato cotyledons, and primarily screening candidate transgenic plants by utilizing hygromycin. The forward primer and the reverse primer of the hygromycin gene sequence are matched, and the obtained transgenic plant is screened by a PCR amplification method. The preparation of culture medium and the culture method of aseptic seedling are the same as the above-mentioned over-expression plant, when it is converted and regenerated, the agrobacterium tumefaciens engineering bacterium B bacterial liquid containing target carrier plasmid is adopted, and through rooting culture and transplanting, the mutant plant can be obtained.

4. PCR detection of tomato atg10, atg4, atg6 and atg7 mutant plants

Specific primers are designed near the sequence positions of sgRNAs of tomato ATG10, ATG4, ATG6 and ATG7 genes to detect the change of target gene sequences. The primers are as follows, the fragment length is detected, and homozygous mutants in ATG10, ATG4, ATG6 and ATG7 knockout transgenic plants can be screened according to the size of a PCR product band and a sequencing result. The PCR detection result is sent to be detected, and fig. 5B shows the sequencing result of tomato ATG10 CRISPR/Cas9 knockout plants; FIG. 5C shows the sequencing result of tomato ATG4CRISPR/Cas9 knockout plant; FIG. 5D shows sequencing results of tomato ATG6 CRISPR/Cas9 knockout plants; FIG. 5E shows sequencing results of tomato ATG7 CRISPR/Cas9 knockout plants.

Example 4

The resulting tomato ATG10 gene overexpressed plants and ATG10, ATG4, ATG6, ATG7 mutant plants were inoculated with RKN.

The specific method for inoculating the tomato ATG10 gene overexpression plant and the ATG10, ATG4, ATG6 and ATG7 mutant plant with the root-knot nematode is as follows:

wild type WT, overexpressed plants and mutant plants were divided into two groups, one group being a control group and the other group being an experimental group.

When the tomatoes grew to five leaves and one heart, the experimental groups were inoculated with about 1000 nematodes of stage J2 per strain, during which time they were watered normally.

Plants were cultivated in plastic cups containing autoclaved river sand, irrigated with Hoagland nutrient solution each time. The growth conditions were: day and night temperature 23 deg.C/20 deg.C, 14h photoperiod and 600 μmol m^-2s^-1The intensity of the light.

Nematode treatment time was 4 weeks.

At the end of the experiment, samples were taken and the relevant indices determined. The results are shown in FIGS. 6 to 10.

As can be seen from FIG. 1-2, RKN invades the tomato root after being treated for 24h, and the invasion rate of root-knot nematode to the tomato root is the largest and can reach 85% in 36 h; caused a change in expression of proteins associated with autophagy after RKN treatment and protein accumulation started at 24 h; through autophagosome detection, the highest autophagosome activity is achieved after 36 h. As shown in FIG. 3, RKN treatment induced a large amount of ATGs gene expression, with significantly higher ATG10, ATG4, ATG6, ATG7 gene expression levels than the control group, and with a beginning of up-regulation at 24h and a slight decrease of the up-regulation fold at 48 h. Therefore, we believe that ATGs might mediate resistance of tomato to RKN and reach one node at 36 h.

The test materials of atg10, atg4, atg6 and atg7 mutant plants and wild type WT control plants are inoculated with root knot nematodes for treatment, autophagosome detection is carried out to find that autophagosomes of the mutant plants are obviously less than that of the wild type plants after the mutant plants are inoculated with RKN36h, after the mutant plants are cultured for 4 weeks, the number of root knots of the mutant plants is found to be obviously increased compared with that of the wild type plants, and the difference of the number of the root knots of the atg10 mutant plants is most obvious as shown in FIG. 9.

As shown in FIG. 10, using the mutant ATG10-1, ATG10-3 and ATG10 overexpression lines OE-Atg10-7, OE-Atg10-44 and wild type WT control plants as experimental material, 1000 hatched larvae at stage J2 were inoculated per tomato, and it was found that ATG8-PE was significantly lower than wild type for the ATG10 mutant plants after inoculation of RKN36h, and the number of autophagosomes was significantly lower than wild type, as opposed to the overexpressed plants; after 4 weeks of culture, we found that the ATG10 mutant had a significantly increased number of root knots compared to the wild type, whereas the ATG10 overexpressing plants had significantly reduced number of root knots compared to the wild type. The results show that ATGs are involved in resistance to RKN and ATG10 plays an important role.

Taken together, these results indicate that RKN can induce tomato autophagy production and that ATG10 positively regulates resistance of tomato to RKN.

Furthermore, it should be understood that various changes and modifications can be made by one skilled in the art after reading the above description of the present invention, and equivalents also fall within the scope of the invention as defined by the appended claims.

Sequence listing

<110> Zhejiang university

Application of tomato autophagy gene in improvement of plant root-knot nematode resistance

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 483

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 1

atgacatcta tctcctcctc atgggatggc actattacct ccactcaatt tcacaatgct 60

gcttctactt tttctgagat atggaacaac tttgatctag ggtttcctca ctggtcatgg 120

atcaactttc caaataaacc aggttttgct gctaccaagc tacaaggata tttatcattg 180

gagaatatga ttcttcccat aacaactgag gaagaatgtg ttctagctgg aacagaagat 240

ttgacttgct ctaacgaaga ttcatttgat gatactgcca tattggttca aaaggacagc 300

aaagaaagac atcattacga ctttcatgtc atctacagtt cctcttttag ggttccagta 360

ctttatttcc gtgcatactg cagtgatgga gaacccttgg caatagaaga cctggaaaag 420

gactttcctg cctatactgc gcaggaactg gcagtatcta aatggacctt tattactcgg 480

gag 483

<210> 2

<211> 1176

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 2

atggacaaaa ctgggatgcc taatgggtca aagagtgata tttggctttt gggtgtttgc 60

tataaagttg ttcaagatga tgattcatcc atagaaccaa ctcaaagtga aggttttgct 120

gcttttgttg atgatttctc atctagaatt cttgttacat atcgtaaagg ttttgctcct 180

attgaagata ctaagtatac cagtgatgtt aattggggtt gcatgcttag gagtagtcag 240

atgcttgttg ctcaggctct acttcttcat cgattaggaa gatcgtggag aaaatctatg 300

gacaagccgc ttgaacaaaa gtatgtggag attttgcacc tctttggtga ttctgtggag 360

tcagcttact ctatccataa cctcctgcaa gccggcaaga cttatggtct ttctcctggt 420

tcttgggtgg gtccgtatgc aatgtgccgc acctgggaaa cattagcacg ctgcaaaaga 480

gaagaaacag gaaatgcagt catgtctcca gctatggcta tctatgttgt atctggggat 540

gaagatggag aaagaggtgg agcgccagtt ctctgcgttg aggacattgt caagcattgt 600

tccggcttgg caaaaggcga agttgactgg acacctgttc ttttcttagt accgttggtt 660

cttggacttg acaaaatcaa ttcgaggtat cttcctttac tggcagctac atttagtttt 720

cctcaaagcc ttgggatcct aggtggcaga cctggagcat caacctatat tgttggcgtg 780

caagatgata aagccgttta tcttgaccca catgaagttc agccagttgt tgatattaaa 840

atggataagc tagatgttga tacttcatct tatcactgca atactgtaag gcattttcca 900

ctggattcaa ttgatccctc cttggctatc ggattttact gtagagataa aagtgatttt 960

gatgatttct gtatacgagc atctgagcta gtagatcagt caaacggtgc tccattgttt 1020

accataactg agactcgtag ctctgccaca tcagttgagt acaatgacag gttgactagt 1080

gatactggag tcccggaact ggactccttc gatgctgtag cccccggtga atcagatggt 1140

agtagtagac ctgaagatga gtggcaactc ctttga 1176

<210> 3

<211> 1572

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 3

atggtgaaag gcagcagcgc tacaccggat aagggtcgga ctttaccggt tgacccgaat 60

cttccccggt acatctgtca gaactgccac aatccccttt gcatcgccgg cgtcgataat 120

tatgccgaca agtttttccc tgattcttct tatcgctccg ggatgcaggc ctcttcaatt 180

catggagctg gtagtgctat agggtcgacg agccgaatgg aaaattcgta tgttatgttg 240

ccaaagcaaa gaaatcaggg atcaggaatt ccgcctcgag gacgaggatc tgcacagcca 300

gatgcaagcc agtttgggag ggccatggaa gaatcatttg tggttttgcc tccaccagct 360

gcttcagtat ataagtgtga gcctacgtct gatggatctg gtacaaatct tccatcacca 420

gatggtggac ctccaaatgc tcccatgcag tcaaacaatt ctgggtttca ctccaccatc 480

actgtcctaa aacgtgcatt tgatattgcc acaacacaga cccagattga gcaaccccta 540

tgtcttgaat gcatgagggt gctgtctgat aaacttgata aggaggttga agatgttaac 600

agggacatac aagcctatga agcttgcctt catcaattgg agggagaagc aagaaatgtt 660

cttagcgagg ctgattttct gaaggagaag ttgaagatag aagaagaaga gcggaaactt 720

gaaacagcaa tagaagaaac agagaagcaa tgtgctgtag tcactgctga actgaaggaa 780

ctagagatga agtctggccg ctttaaggag ttggaagagc ggtactggca agaattcaat 840

aactttcagt ttcagttgat atctcatcag gaagagagag atgcaatttt agctaagaca 900

gaagtttcac aagctcactt agagctgcta aagcggacta atgtgctcaa tgatgcattt 960

ccaatctggt atgatggtga atttggaaca attaacaact ttcgtctcgg aagacttcct 1020

aaaattccgg ttgagtggga cgagataaat gcagcatggg gtcaagcgtg ccttcttctc 1080

catacaatgg ctcagcattt ccgaccaaag tttcaatatc ggataaaaat tattcctatg 1140

ggaagttatc ctcggatcat agacaccaac aatactactt atgaactatt tggcccagta 1200

aatctcttct ggagcacacg gtatgataaa gcaatgacat tgttcttgat ctgcctaaag 1260

gagttctccg agtttgcaaa ttcaaaagac agggaaaaca acattcgtcc tgataaatgt 1320

tttaagcttc cttacaagat tgaaaatgac aaagttgaaa gttactccat aacccagagc 1380

tttaacaaac aagaaaattg gaccaaagct ctcaagtaca cactctgcaa tttgaagtgg 1440

gtgctctact ggtttgttgg taacacaaat ttccagccac tttctggaac agtctcttca 1500

caagctgaag ttccagctgc agcaggatca ctgtacagca aacaaccaac taataccaag 1560

tttcaatctt ga 1572

<210> 4

<211> 2148

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 4

atggcggata ctggaaaagg aacaattctt caatttgcac cttttcagag ttttgtagat 60

gaagggtttt ggcataaatt atcttctttc aagcttaata aattgcgtct tgatgaatcc 120

ccaattccaa ttactggctt ttatgcacct tgctcgcatc ctcaagtatc aaatcacttg 180

actctcctgg ctgaatcttt gcctgctgat tccgatgaag aatcatcgtc tcttctagct 240

agtcagggga atagaaatag gtgtcctgtt cctggcattc ttctcaacac aaacacgtta 300

gaaagtttct atgcgcttga taagcagagc ctacttaagg cagaagccaa gaagatatgg 360

gatgacattt actcaggcaa agttgaggag gacagttctg tgctcttaag attcctagtt 420

atatcatttg cagacttgaa aaagtggagc tttcattatt ggtttgcgtt ccctgctttg 480

gtgcttgatc ctcctgcaac tctagttaat ttgaaaccag cttcccagtg cttcacttct 540

gtagaggctg aatctgtgtc tagtgcttgt aatgagtggc gtagcaagag ctccacagca 600

gatataccat tctttttggt gtctattggt tcaaattcag ttgctactct caggcatcta 660

agggagtggg aaacctgcca aaataatggt caaaagattc tttttggttt ttatgaccct 720

tgtcatcttc cacataatcc tggatggcca cttcgcaatt atcttgccta tttctgctca 780

aggtggggcc ttggaaagat tcactttttc tgctaccgcg aaaaccgtgg ttttgcagat 840

cttggattgt cccttgttgg agaagctgaa atatctcttt cacaaggagg gaggaatcat 900

cagaacatgc ccaatgttgt gggatgggaa ctaaataaag ggaagaaggg tttgagatgc 960

atcagcctcg ctaaaactat ggatccgacg aggttagctg tatcagctgc tgatttgaac 1020

ttgaaactaa tgaggtggcg gacattgccg tcattgaatc tagaaatgtt ggcttccaca 1080

agatgtctcc ttctgggagc aggtaccctc ggatgccaag ttgctcgaat gcttatggca 1140

tggggtgtcc gaaaaattac attggttgac agtggtaagg tctcaatgtc taatccaata 1200

aggcagtctc tttatgcgct tgatgactgt ttaaatggtg gcaaatttaa ggccgttgca 1260

gcagttgaaa gtctcaagcg aatatttcca gcagtggaag cagaaggagt tgtgatggct 1320

attccgatgc ctggacatcc agtgtctagc caagaagaaa gtaatatact tcaggactgc 1380

agacatttga gtgatttgat caactcacat gatgcaatct ttctattaac tgatacacgg 1440

gaaagtcggt ggcttcctag tctactttgt gctagtgcta acaagatcac tattactgca 1500

gccttaggtt tcgatagctt tctagtgatg cgtcatggag caggcccttt ggatgctcta 1560

cacaactcac aagctgaaac ttcgaataag ctctctgcca gtatggagaa tctctccctt 1620

tcgaaccaaa aagagtcagt gcgattggga tgttacttct gcaatgatgt ggttgcacca 1680

attgattcaa cggctaaccg taccctggac caacaatgta cagttactcg tcctgggctg 1740

gctcctattg catcagccct tgctgttgaa cttttggttg gagtcttgca tcatccttct 1800

ggaatatgtg ccaaagctga gtttgcaaac tctaatgata acggcagcac tgaacaacct 1860

cttggcattc tacctcatca gattcggggc tccatatctc agttttctca gatgacactt 1920

gtcggtcatg cttcaacttg ttgcactgct tgttgtagca cggttgtatc agaatatcga 1980

acgaaaggga tggacttcat acttcaagct atcaatcatc ctacatatct ggaggatcta 2040

accggactaa cagaactcat gaaatcagca ggatcttaca cgcttgactg ggataacgat 2100

agtgaaaatg atgacaacga cgatgatgat gactgtgtag aaatataa 2148

<210> 5

<211> 236

<212> PRT

<213> tomato (Lycopersicon esculentum)

<400> 5

Met Thr Ser Ile Ser Ser Ser Trp Asp Gly Thr Ile Thr Ser Thr Gln

1 5 10 15

Phe His Asn Ala Ala Ser Thr Phe Ser Glu Ile Trp Asn Asn Phe Asp

20 25 30

Leu Gly Phe Pro His Trp Ser Trp Ile Asn Phe Pro Asn Lys Pro Gly

35 40 45

Phe Ala Ala Thr Lys Leu Gln Gly Tyr Leu Ser Leu Glu Asn Met Ile

50 55 60

Leu Pro Ile Thr Thr Glu Glu Glu Cys Val Leu Ala Gly Thr Glu Asp

65 70 75 80

Leu Thr Cys Ser Asn Glu Asp Ser Phe Asp Asp Thr Ala Ile Leu Val

85 90 95

Gln Lys Asp Ser Lys Glu Arg His His Tyr Asp Phe His Val Ile Tyr

100 105 110

Ser Ser Ser Phe Arg Val Pro Val Leu Tyr Phe Arg Ala Tyr Cys Ser

115 120 125

Asp Gly Glu Pro Leu Ala Ile Glu Asp Leu Glu Lys Asp Phe Pro Ala

130 135 140

Tyr Thr Ala Gln Glu Leu Ala Val Ser Lys Trp Thr Phe Ile Thr Arg

145 150 155 160

Glu Glu His Pro Tyr Leu Asn Arg Pro Trp Tyr Thr Leu His Pro Cys

165 170 175

Gly Thr Ser Glu Trp Met Lys Leu Leu Phe Ser Asn Glu Pro Ser Val

180 185 190

Val Asn Gln Gly Gly Val Ala Ile Glu Lys Tyr Leu Thr Ser Trp Phe

195 200 205

Ser Val Val Ser Pro Val Phe Gly Phe Lys Ile Pro Leu Lys Phe Ser

210 215 220

Thr Phe Met Asn Ser Gly Asn Val Ala Thr Val Ile

225 230 235

<210> 6

<211> 391

<212> PRT

<213> tomato (Lycopersicon esculentum)

<400> 6

Met Asp Lys Thr Gly Met Pro Asn Gly Ser Lys Ser Asp Ile Trp Leu

1 5 10 15

Leu Gly Val Cys Tyr Lys Val Val Gln Asp Asp Asp Ser Ser Ile Glu

20 25 30

Pro Thr Gln Ser Glu Gly Phe Ala Ala Phe Val Asp Asp Phe Ser Ser

35 40 45

Arg Ile Leu Val Thr Tyr Arg Lys Gly Phe Ala Pro Ile Glu Asp Thr

50 55 60

Lys Tyr Thr Ser Asp Val Asn Trp Gly Cys Met Leu Arg Ser Ser Gln

65 70 75 80

Met Leu Val Ala Gln Ala Leu Leu Leu His Arg Leu Gly Arg Ser Trp

85 90 95

Arg Lys Ser Met Asp Lys Pro Leu Glu Gln Lys Tyr Val Glu Ile Leu

100 105 110

His Leu Phe Gly Asp Ser Val Glu Ser Ala Tyr Ser Ile His Asn Leu

115 120 125

Leu Gln Ala Gly Lys Thr Tyr Gly Leu Ser Pro Gly Ser Trp Val Gly

130 135 140

Pro Tyr Ala Met Cys Arg Thr Trp Glu Thr Leu Ala Arg Cys Lys Arg

145 150 155 160

Glu Glu Thr Gly Asn Ala Val Met Ser Pro Ala Met Ala Ile Tyr Val

165 170 175

Val Ser Gly Asp Glu Asp Gly Glu Arg Gly Gly Ala Pro Val Leu Cys

180 185 190

Val Glu Asp Ile Val Lys His Cys Ser Gly Leu Ala Lys Gly Glu Val

195 200 205

Asp Trp Thr Pro Val Leu Phe Leu Val Pro Leu Val Leu Gly Leu Asp

210 215 220

Lys Ile Asn Ser Arg Tyr Leu Pro Leu Leu Ala Ala Thr Phe Ser Phe

225 230 235 240

Pro Gln Ser Leu Gly Ile Leu Gly Gly Arg Pro Gly Ala Ser Thr Tyr

245 250 255

Ile Val Gly Val Gln Asp Asp Lys Ala Val Tyr Leu Asp Pro His Glu

260 265 270

Val Gln Pro Val Val Asp Ile Lys Met Asp Lys Leu Asp Val Asp Thr

275 280 285

Ser Ser Tyr His Cys Asn Thr Val Arg His Phe Pro Leu Asp Ser Ile

290 295 300

Asp Pro Ser Leu Ala Ile Gly Phe Tyr Cys Arg Asp Lys Ser Asp Phe

305 310 315 320

Asp Asp Phe Cys Ile Arg Ala Ser Glu Leu Val Asp Gln Ser Asn Gly

325 330 335

Ala Pro Leu Phe Thr Ile Thr Glu Thr Arg Ser Ser Ala Thr Ser Val

340 345 350

Glu Tyr Asn Asp Arg Leu Thr Ser Asp Thr Gly Val Pro Glu Leu Asp

355 360 365

Ser Phe Asp Ala Val Ala Pro Gly Glu Ser Asp Gly Ser Ser Arg Pro

370 375 380

Glu Asp Glu Trp Gln Leu Leu

385 390

<210> 7

<211> 523

<212> PRT

<213> tomato (Lycopersicon esculentum)

<400> 7

Met Val Lys Gly Ser Ser Ala Thr Pro Asp Lys Gly Arg Thr Leu Pro

1 5 10 15

Val Asp Pro Asn Leu Pro Arg Tyr Ile Cys Gln Asn Cys His Asn Pro

20 25 30

Leu Cys Ile Ala Gly Val Asp Asn Tyr Ala Asp Lys Phe Phe Pro Asp

35 40 45

Ser Ser Tyr Arg Ser Gly Met Gln Ala Ser Ser Ile His Gly Ala Gly

50 55 60

Ser Ala Ile Gly Ser Thr Ser Arg Met Glu Asn Ser Tyr Val Met Leu

65 70 75 80

Pro Lys Gln Arg Asn Gln Gly Ser Gly Ile Pro Pro Arg Gly Arg Gly

85 90 95

Ser Ala Gln Pro Asp Ala Ser Gln Phe Gly Arg Ala Met Glu Glu Ser

100 105 110

Phe Val Val Leu Pro Pro Pro Ala Ala Ser Val Tyr Lys Cys Glu Pro

115 120 125

Thr Ser Asp Gly Ser Gly Thr Asn Leu Pro Ser Pro Asp Gly Gly Pro

130 135 140

Pro Asn Ala Pro Met Gln Ser Asn Asn Ser Gly Phe His Ser Thr Ile

145 150 155 160

Thr Val Leu Lys Arg Ala Phe Asp Ile Ala Thr Thr Gln Thr Gln Ile

165 170 175

Glu Gln Pro Leu Cys Leu Glu Cys Met Arg Val Leu Ser Asp Lys Leu

180 185 190

Asp Lys Glu Val Glu Asp Val Asn Arg Asp Ile Gln Ala Tyr Glu Ala

195 200 205

Cys Leu His Gln Leu Glu Gly Glu Ala Arg Asn Val Leu Ser Glu Ala

210 215 220

Asp Phe Leu Lys Glu Lys Leu Lys Ile Glu Glu Glu Glu Arg Lys Leu

225 230 235 240

Glu Thr Ala Ile Glu Glu Thr Glu Lys Gln Cys Ala Val Val Thr Ala

245 250 255

Glu Leu Lys Glu Leu Glu Met Lys Ser Gly Arg Phe Lys Glu Leu Glu

260 265 270

Glu Arg Tyr Trp Gln Glu Phe Asn Asn Phe Gln Phe Gln Leu Ile Ser

275 280 285

His Gln Glu Glu Arg Asp Ala Ile Leu Ala Lys Thr Glu Val Ser Gln

290 295 300

Ala His Leu Glu Leu Leu Lys Arg Thr Asn Val Leu Asn Asp Ala Phe

305 310 315 320

Pro Ile Trp Tyr Asp Gly Glu Phe Gly Thr Ile Asn Asn Phe Arg Leu

325 330 335

Gly Arg Leu Pro Lys Ile Pro Val Glu Trp Asp Glu Ile Asn Ala Ala

340 345 350

Trp Gly Gln Ala Cys Leu Leu Leu His Thr Met Ala Gln His Phe Arg

355 360 365

Pro Lys Phe Gln Tyr Arg Ile Lys Ile Ile Pro Met Gly Ser Tyr Pro

370 375 380

Arg Ile Ile Asp Thr Asn Asn Thr Thr Tyr Glu Leu Phe Gly Pro Val

385 390 395 400

Asn Leu Phe Trp Ser Thr Arg Tyr Asp Lys Ala Met Thr Leu Phe Leu

405 410 415

Ile Cys Leu Lys Glu Phe Ser Glu Phe Ala Asn Ser Lys Asp Arg Glu

420 425 430

Asn Asn Ile Arg Pro Asp Lys Cys Phe Lys Leu Pro Tyr Lys Ile Glu

435 440 445

Asn Asp Lys Val Glu Ser Tyr Ser Ile Thr Gln Ser Phe Asn Lys Gln

450 455 460

Glu Asn Trp Thr Lys Ala Leu Lys Tyr Thr Leu Cys Asn Leu Lys Trp

465 470 475 480

Val Leu Tyr Trp Phe Val Gly Asn Thr Asn Phe Gln Pro Leu Ser Gly

485 490 495

Thr Val Ser Ser Gln Ala Glu Val Pro Ala Ala Ala Gly Ser Leu Tyr

500 505 510

Ser Lys Gln Pro Thr Asn Thr Lys Phe Gln Ser

515 520

<210> 8

<211> 715

<212> PRT

<213> tomato (Lycopersicon esculentum)

<400> 8

Met Ala Asp Thr Gly Lys Gly Thr Ile Leu Gln Phe Ala Pro Phe Gln

1 5 10 15

Ser Phe Val Asp Glu Gly Phe Trp His Lys Leu Ser Ser Phe Lys Leu

20 25 30

Asn Lys Leu Arg Leu Asp Glu Ser Pro Ile Pro Ile Thr Gly Phe Tyr

35 40 45

Ala Pro Cys Ser His Pro Gln Val Ser Asn His Leu Thr Leu Leu Ala

50 55 60

Glu Ser Leu Pro Ala Asp Ser Asp Glu Glu Ser Ser Ser Leu Leu Ala

65 70 75 80

Ser Gln Gly Asn Arg Asn Arg Cys Pro Val Pro Gly Ile Leu Leu Asn

85 90 95

Thr Asn Thr Leu Glu Ser Phe Tyr Ala Leu Asp Lys Gln Ser Leu Leu

100 105 110

Lys Ala Glu Ala Lys Lys Ile Trp Asp Asp Ile Tyr Ser Gly Lys Val

115 120 125

Glu Glu Asp Ser Ser Val Leu Leu Arg Phe Leu Val Ile Ser Phe Ala

130 135 140

Asp Leu Lys Lys Trp Ser Phe His Tyr Trp Phe Ala Phe Pro Ala Leu

145 150 155 160

Val Leu Asp Pro Pro Ala Thr Leu Val Asn Leu Lys Pro Ala Ser Gln

165 170 175

Cys Phe Thr Ser Val Glu Ala Glu Ser Val Ser Ser Ala Cys Asn Glu

180 185 190

Trp Arg Ser Lys Ser Ser Thr Ala Asp Ile Pro Phe Phe Leu Val Ser

195 200 205

Ile Gly Ser Asn Ser Val Ala Thr Leu Arg His Leu Arg Glu Trp Glu

210 215 220

Thr Cys Gln Asn Asn Gly Gln Lys Ile Leu Phe Gly Phe Tyr Asp Pro

225 230 235 240

Cys His Leu Pro His Asn Pro Gly Trp Pro Leu Arg Asn Tyr Leu Ala

245 250 255

Tyr Phe Cys Ser Arg Trp Gly Leu Gly Lys Ile His Phe Phe Cys Tyr

260 265 270

Arg Glu Asn Arg Gly Phe Ala Asp Leu Gly Leu Ser Leu Val Gly Glu

275 280 285

Ala Glu Ile Ser Leu Ser Gln Gly Gly Arg Asn His Gln Asn Met Pro

290 295 300

Asn Val Val Gly Trp Glu Leu Asn Lys Gly Lys Lys Gly Leu Arg Cys

305 310 315 320

Ile Ser Leu Ala Lys Thr Met Asp Pro Thr Arg Leu Ala Val Ser Ala

325 330 335

Ala Asp Leu Asn Leu Lys Leu Met Arg Trp Arg Thr Leu Pro Ser Leu

340 345 350

Asn Leu Glu Met Leu Ala Ser Thr Arg Cys Leu Leu Leu Gly Ala Gly

355 360 365

Thr Leu Gly Cys Gln Val Ala Arg Met Leu Met Ala Trp Gly Val Arg

370 375 380

Lys Ile Thr Leu Val Asp Ser Gly Lys Val Ser Met Ser Asn Pro Ile

385 390 395 400

Arg Gln Ser Leu Tyr Ala Leu Asp Asp Cys Leu Asn Gly Gly Lys Phe

405 410 415

Lys Ala Val Ala Ala Val Glu Ser Leu Lys Arg Ile Phe Pro Ala Val

420 425 430

Glu Ala Glu Gly Val Val Met Ala Ile Pro Met Pro Gly His Pro Val

435 440 445

Ser Ser Gln Glu Glu Ser Asn Ile Leu Gln Asp Cys Arg His Leu Ser

450 455 460

Asp Leu Ile Asn Ser His Asp Ala Ile Phe Leu Leu Thr Asp Thr Arg

465 470 475 480

Glu Ser Arg Trp Leu Pro Ser Leu Leu Cys Ala Ser Ala Asn Lys Ile

485 490 495

Thr Ile Thr Ala Ala Leu Gly Phe Asp Ser Phe Leu Val Met Arg His

500 505 510

Gly Ala Gly Pro Leu Asp Ala Leu His Asn Ser Gln Ala Glu Thr Ser

515 520 525

Asn Lys Leu Ser Ala Ser Met Glu Asn Leu Ser Leu Ser Asn Gln Lys

530 535 540

Glu Ser Val Arg Leu Gly Cys Tyr Phe Cys Asn Asp Val Val Ala Pro

545 550 555 560

Ile Asp Ser Thr Ala Asn Arg Thr Leu Asp Gln Gln Cys Thr Val Thr

565 570 575

Arg Pro Gly Leu Ala Pro Ile Ala Ser Ala Leu Ala Val Glu Leu Leu

580 585 590

Val Gly Val Leu His His Pro Ser Gly Ile Cys Ala Lys Ala Glu Phe

595 600 605

Ala Asn Ser Asn Asp Asn Gly Ser Thr Glu Gln Pro Leu Gly Ile Leu

610 615 620

Pro His Gln Ile Arg Gly Ser Ile Ser Gln Phe Ser Gln Met Thr Leu

625 630 635 640

Val Gly His Ala Ser Thr Cys Cys Thr Ala Cys Cys Ser Thr Val Val

645 650 655

Ser Glu Tyr Arg Thr Lys Gly Met Asp Phe Ile Leu Gln Ala Ile Asn

660 665 670

His Pro Thr Tyr Leu Glu Asp Leu Thr Gly Leu Thr Glu Leu Met Lys

675 680 685

Ser Ala Gly Ser Tyr Thr Leu Asp Trp Asp Asn Asp Ser Glu Asn Asp

690 695 700

Asp Asn Asp Asp Asp Asp Asp Cys Val Glu Ile

705 710 715

Claims (5)

1. The application of tomato autophagy genes ATGs in improving the resistance of tomatoes to meloidogyne incognita is characterized in that the tomato autophagy genes ATGs in a target plant are expressed by a base sequence shown as SEQ ID NO: 1, tomato ATG10 gene.

2. Use according to claim 1, characterized in that it comprises the steps of:

(1) constructing an agrobacterium tumefaciens engineering bacterium A containing a tomato ATG10 gene overexpression vector;

(2) transforming a target plant explant by the agrobacterium tumefaciens engineering bacteria A in a mediated manner to prepare an ATG10 gene over-expression plant;

(3) inoculating the ATG10 gene overexpression plants to the southern root knot nematode stress treatment, observing autophagosomes and recording the number and phenotype of root knots of the plants.

3. The use according to claim 2, wherein in step (3), the inoculation meloidogyne incognita stress treatment is specifically: when the tomato ATG10 gene overexpression plant grows to five leaves and one heart, the southern root knot nematode is inoculated.

4. The use of claim 3, wherein the inoculated Meloidogyne incognita is Meloidogyne incognita at stage J2 with vigor of infestation.

5. The use of claim 3, wherein the inoculation is with a southern root knot nematode stress treatment for a period of 4 weeks.

Images