CN113528538B

CN113528538B - Cucumber CsSTK gene, protein, expression vector and application

Info

Publication number: CN113528538B
Application number: CN202110937897.0A
Authority: CN
Inventors: 刘�东; 秦智伟; 辛明; 张艳菊; 周秀艳; 潘春清
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2021-08-16
Filing date: 2021-08-16
Publication date: 2022-04-19
Anticipated expiration: 2041-08-16
Also published as: CN113528538A

Abstract

The invention discloses a cucumber CsSTK gene, a cucumber CsSTK protein, an expression vector and application, and belongs to the technical field of molecular biology. The application discloses a cucumber CsSTK gene, the nucleotide sequence of which is shown as SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the protein coded by the CsSTK gene is shown as SEQ ID NO: 2 is shown in the specification; an expression vector containing the CsSTK gene. Also discloses the application of the CsSTK gene or the protein or the expression vector in improving the resistance of cucumber corynespora leaf spot. According to the invention, genetic engineering verifies that the disease symptoms of cucumber corynespora leaf spot are obviously relieved by inoculating and identifying the transgenic plant obtained by over-expressing CsSTK, which indicates that the resistance to the cucumber corynespora leaf spot can be obviously enhanced by the over-expressing CsSTK.

Description

Cucumber CsSTK gene, protein, expression vector and application

Technical Field

The invention relates to the technical field of molecular biology, in particular to a cucumber CsSTK gene, a cucumber CsSTK protein, a cucumber CsSTK expression vector and application thereof.

Background

Cucumbers (having a scientific name: Cucumis sativus L.) are cultivated in various parts of china in common, with annual vine or climbing herbaceous plants of the cucurbitaceae family. In production, cucumbers are easily infected by various pathogenic bacteria, and the yield and the quality of the cucumbers are seriously influenced. Corynespora cassiicola is a common fungal disease, mainly caused by the pathogenic fungus, Corynebacterium polymorpha (Corynespora cassiicola). The existing control method mainly adopts a chemical method for control, and the long-term use of the chemical method for control can play a role in controlling cucumber corynespora leaf spot, but the long-term use of the chemical method can easily cause the generation of drug resistance of pathogenic bacteria. Meanwhile, chemical pesticide residues bring adverse effects on soil and human health. Under the condition, the cultivation of new resistant varieties or the search for safer biological agents is mainly adopted at present, but the cultivation of the resistant varieties needs long time and the resistant varieties of the corynespora leaf spot are extremely short at present, and the biological agents are safer than chemical agents, but have high cost and slow effect. In addition, currently, research on cucumber corynespora leaf spot is few, and most of the research focuses on physiological and biochemical aspects, drug resistance and genetic diversity of pathogenic bacteria, and research on disease resistance mechanism is still in the beginning stage.

With the continuous progress of molecular technology and the completion of sequencing of cucumber genomes, various transcription factors in the cucumber genomes have been systematically analyzed, such as ERF, MLO and the like, but the research on the cucumber STK gene function is very little at present, and particularly, the related research between the cucumber STK gene and the resistance to the alternaria leaf spot is not reported.

Disclosure of Invention

The invention aims to provide a cucumber CsSTK gene, a cucumber CsSTK protein, an expression vector and application, which are used for solving the problems in the prior art and obviously enhancing the resistance to cucumber corynespora leaf spot by over-expressing the CsSTK in a susceptible variety.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a cucumber CsSTK gene, the nucleotide sequence of which is shown as SEQ ID NO: 1 is shown.

SEQ ID NO：1：

atgtcaaaggttcttgcagcaatattaggaggttctgcaggagccgtggcattggtgggattgattattatacttttaagattcttagcacgctcgagaaacactgcaagaacttccgagactggctcttctgatccatctgttcaagtgggaaggcatgttggtattgaattgactctacgagatgctaggcgttttgagatggcagagttggtgttggccactaatgatttcagcgacaagaacttgattggagaagggaaatttggggaggtctataagggtatgcttcaggatggaatgttcgtcgctataaaaaagcggcatggagcgcctagtcaggatttcgtagatgaggtacactacctctcgtctattcagcatcgaaatctcgtgactcttttgggctactgccaggaaaataatctacagtttctcatctttgattatatacccaacggaagtgtttctagccacatatatggcactgagcagcgttcggctgagaagctggagttcaagatcagactctcaatagctctgggggcagctaaaggtctgtcacatcttcactccatgagccctcgtttgacacacagaaacttcaagacatccaacgttcttgtagatgagaattttatagctaaagtggcagatgcaggacttcacaatgtcatgcgaagatttgacgtttcagaatcatcgtcccgagcaacagcagatgagatatttcttgcacctgaggtaaaagagtttcgacaattttccgagaaaagtgacgtatatagtttcggcgtattccttttggagttggtaagcggtcaaaaagcgactgatgcacctgtttccaatcccaattatactctggtggactggatacaaaacaatcagagaaagagcgatattggtagcattacggatccaaggttagggaagagcttcactgaggaaggtatgggtgaactaatggatttgatacttcaatgcgtcgaatattcaagcgagaggcgtccagtgatgagctacgtggtgacagagctggaaaggatactggagaaagagatgaacttaacaacagtgatgggagaaggaagcccaactgttactcttgggagtcagttgttcaaaaccacaaagtaa。

The invention also provides a protein coded by the CsSTK gene.

Preferably, the amino acid sequence is as shown in SEQ ID NO: 2, respectively.

SEQ ID NO：2：

MSKVLAAILGGSAGAVALVGLIIILLRFLARSRNTARTSETGSSDPSVQVGRHVGIELTLRDARRFEMAELVLATNDFSDKNLIGEGKFGEVYKGMLQDGMFVAIKKRHGAPSQDFVDEVHYLSSIQHRNLVTLLGYCQENNLQFLIFDYIPNGSVSSHIYGTEQRSAEKLEFKIRLSIALGAAKGLSHLHSMSPRLTHRNFKTSNVLVDENFIAKVADAGLHNVMRRFDVSESSSRATADEIFLAPEVKEFRQFSEKSDVYSFGVFLLELVSGQKATDAPVSNPNYTLVDWIQNNQRKSDIGSITDPRLGKSFTEEGMGELMDLILQCVEYSSERRPVMSYVVTELERILEKEMNLTTVMGEGSPTVTLGSQLFKTTK。

The invention also provides an expression vector containing the CsSTK gene.

The invention also provides a transformant constructed by using the expression vector.

The invention also provides application of the CsSTK gene or the protein or the expression vector in improving the resistance of cucumber corynespora leaf spot.

The invention discloses the following technical effects:

1. the invention analyzes the sequence information of related genes of cucumber by utilizing gene engineering technology and gene expression analysis, gene cloning and sequence analysis technology.

2. The invention constructs an overexpression vector containing the cucumber CsSTK gene, and can be directly used for cucumber genetic transformation.

3. The cucumber CsSTK gene provided by the invention is a novel coding gene for responding to Corynespora cassiicola of cucumbers, an overexpression CsSTK gene is obtained after an overexpression vector pCXSN-CsSTK is transferred into cucumber cotyledonary nodes by an agrobacterium-mediated transformation method, after Corynespora clavulicola is inoculated, the morbidity symptom of a transgenic plant is obviously lighter than that of an susceptible strain D0401, and the resistance of the susceptible strain with the overexpression CsSTK to Corynespora cassiicola of cucumbers is obviously enhanced.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows CsSTK PCR product and restriction enzyme identification; m: DNA marker 2K; 1: PCR products; 2: carrying out enzyme digestion identification on the plasmid EcoRI;

FIG. 2 shows PCR detection of pCXSN-CsSTK overexpression vector; m: DNA marker 2K; 1-5: PCR products;

FIG. 3 shows PCR detection of bacterial liquid; m: DNA marker 2K; 1-5: PCR products;

FIG. 4 is the process of obtaining transgenic positive plants; a: sowing; b: co-culturing cotyledonary nodes; c-d: cotyledonary node differentiation; e: differentiating the buds to root; f: domestication;

FIG. 5 shows PCR detection of CsSTK-transferred D0401 resistant plants; m: DNA marker 2K; +: a positive control; -: sterile water control; c: negative control; k: pCXSN-1250; 1-13: a resistance plant transformed with the CsSTK gene;

FIG. 6 shows the CsSTK transgenic plant inoculation identification; OE2, OE5, OE 7: 3 strains with the highest expression quantity in T0 generation over-expressed CsSTK strains; d9320: a disease-resistant line; d0401: an infectious disease line;

FIG. 7 is analysis of gene expression of over-expressed plants; and (5) Col: comparison; OE-STK: overexpressing a CsSTK plant; OE-ERF: overexpressing a CsERF004 plant;

FIG. 8 is an analysis of the levels of the hormones in plants overexpressing CsSTK;

FIG. 9 is a PCR assay of the CsSTK open reading frame without the stop codon; m: DNA marker 2K; 1: PCR products;

FIG. 10 shows PCR detection and double restriction enzyme digestion identification of 35S-CsSTK-eGFP expression vector; m: DNA marker 2K; 1: PCR detection; 2: carrying out double digestion identification on the plasmid;

FIG. 11 shows PCR detection of 35S-CsSTK-eGFP fusion expression vector; m: DNA marker 2K; 1-7: PCR products;

FIG. 12 is an analysis of the localization of 35S-CsSTK-eGFP fusion protein in Arabidopsis protoplasts.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Cucumber varieties D9320 and D0401 referred to in the following examples are provided by the cucumber theme group of the Garden school of horticulture, university of agriculture, northeast.

Example 1 cloning of cucumber CsSTK Gene

D9320 fresh leaf cDNA inoculated with pathogenic corynespora leaf spot pathogen for 48h is used as a cloning template, a Primer premier 6.0 is used for designing and cloning a specific Primer of the full length of the CsSTK gene, and PCR amplification is carried out.

The specific primers are as follows:

CsSTK-F：ATGTCAAAGGTTCTTGCAGC

CsSTK-R：TTACTTTGTGGTTTTGAACAACTG

20 mu L of amplification reaction system, which comprises the following components: 2 XTaq PCR MasterMix 10. mu.L, upstream primer 0.5. mu.L, downstream primer 0.5. mu. L, cDNA template 1. mu. L, ddH₂O 8μL。

PCR amplification procedure: 94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 52 ℃ for 30s and 72 ℃ for 1 min; 10min at 72 ℃; hold at 4 ℃.

And connecting the target fragment obtained by amplification with a pEASY-T3 vector to obtain pEASY-T3-CsSTK escherichia coli liquid, carrying out PCR identification, sending the liquid to Harbin prokyengine biology company for sequencing, wherein an electrophoresis result shows that target bands appear at 1140bp positions, carrying out sequence comparison analysis on a sequencing result by using DNAMAN 8, wherein the result is 100% correct, and carrying out single enzyme digestion identification on the plasmid pEASY-T3-CsSTK by using restriction endoenzyme cutting EcoRI (figure 1) to indicate that the CsSTK is cloned successfully. Through determination, the nucleotide sequence of the CsSTK gene is shown as SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO: 2, respectively.

Example 2 construction and transformation of plant overexpression vectors

And cloning and glue recovery are carried out by using a sequence full-length primer of the cloned gene CsSTK. The pCXSN-1250 vector is a plant expression vector containing a 35s promoter and is cleaved from the empty pCXSN-1250 vector by a single enzyme, the restriction endonuclease Xcm I. And mixing the cut empty vector and the target fragment according to a ratio, connecting for 16h at 16 ℃ by using T4 ligase to obtain a pCXSN-CsSTK over-expression vector, and transferring the pCXSN-CsSTK over-expression vector into a DH-5 alpha competent cell by using a freeze-thaw method. Screening and culturing on a Kan-containing culture medium, and carrying out colony PCR identification after 12 h.

pCXSN-CsSTK sequencing primer:

pCXSN-1250-F：CGGCAACAGGATTCAATCTTA；

pCXSN-1250-R：CAAGCATTCTACTTCTATTGCAGC。

the amplification system and reaction procedure were the same as in example 1.

The electrophoresis result of the PCR product shows that the target band appears at the position of 1140bp (FIG. 2). After the bacterial liquid is sent to a company for sequencing, the sequencing result is completely correct, which indicates that the CsSTK is successfully constructed on the pCXSN-1250 carrier, and a subsequent test can be carried out.

The recombinant plasmid was introduced into Agrobacterium tumefaciens competent cells according to the instructions, cultured in YEB solid medium (containing Kan and rifampicin), and when a single colony grew, it was identified using the gene primers (the primers, reaction system and reaction procedure used were the same as in example 1), and the band of interest existed at the 1140bp position (FIG. 3), indicating that the introduction of the pCXSN-CsSTK overexpression vector into Agrobacterium tumefaciens was successful.

Example 3 transgenic Positive plants

Soaking seeds in warm water for 30min, removing seed coat, sterilizing with 75% ethanol for 1min and removing surface tension of seeds, sterilizing with 2-3% sodium hypochlorite for 10min, washing with sterilized water for several times, removing disinfectant on seed surface, drying with sterilized filter paper, and uniformly spreading on germination medium (MS solid powder 4.33 g. L^-1+30g·L^-1Sucrose +2 g.L^-1Plant gel, pH 5.8) and incubated at 28 ℃ in the dark for 48 h.

1/2MS medium (1/2MS solid powder 4.33 g.L) was used^-1+30g·L^-1Sucrose, pH 5.8) resuspending the pCXSN-CsSTK overexpression vector, introducing it into Agrobacterium tumefaciens cells, aseptically cutting off the surface protective film of the cultured seeds, removing cotyledons, and removing the biomassGrowing and hypocotyl, performing shake infection with bacterial solution, sucking off bacterial solution on cotyledonary node surface with sterile filter paper, transferring to co-culture medium (germination medium +0.5 mg. L)^-16-BA+1.0mg·L^-1ABA, pH 5.8) in the dark, after 2d the cotyledonary node was slightly curled and Agrobacterium colonies were grown around, whereupon the cotyledonary node was transferred to a differentiation medium (co-cultivation medium +400 mg. L)^-1Cefotaxime sodium (Cef) +1.0 mg.L^-1Glyphosate with pH of 5.8), culturing in tissue culture chamber to grow cotyledonary node gradually and turn green, growing differentiated bud at position of embryo axis removed after 10 days, growing cucumber plant after 28 days, cutting off the bud completely, and adding rooting culture medium (germination culture medium +400 mg. L)^-1Cef, pH 5.8), the bottom of 7d differentiated bud obviously grows main roots and lateral roots, the main roots and the lateral roots are transferred into a nutrition pot which is formed by mixing vermiculite and soil uniformly in a ratio of 1:1, the nutrition pot is placed in an artificial climate box for acclimatization culture, a plastic film is used for moisturizing, the plastic film is pushed along with the acclimatization process, and the plastic film is continuously removed (figure 4).

Example 4 molecular biological assay of transgenic Positive plants

The DNA of a plant to be identified is taken as a template, the pCXSN-CsSTK bacterial liquid is taken as a positive control, and sterile water, the DNA of a normal plant and the DNA of a transgenic pCXSN-1250 empty carrier plant are respectively taken as negative controls. PCR amplification was performed using pCXSN-1250-F/R.

The amplification primers were as follows:

pCXSN-1250-F：CGGCAACAGGATTCAATCTTA；

pCXSN-1250-R：CAAGCATTCTACTTCTATTGCAGC。

the amplification conditions and reaction procedure were the same as in example 1.

As shown in FIG. 5, the lanes with sterile water and total DNA of non-transgenic cucumber plants as negative controls showed no target band, the lanes with total DNA of leaves of plants with pCXSN-1250 empty vector as negative controls showed a band at 750bp position, and the positive control and the transgenic successful plants showed target bands at target positions and differed from the negative control, indicating that pCXSN-CsSTK has been successfully transferred into cucumber plants.

Example 5CsSTK transgenic plant inoculation identification

Pseudocercospora cubensis (Berk) Leptodermascola (Corynespora cassiicola)&Curt)Wei.]Which is given by the institute of cucumber wetting of Tianjin family. The prepared 1X 10⁵Spore. mL^-1In a 10. mu.L drop of spore suspension^-1Inoculating 30 drops of the seed in vitro on the back of the leaf. The culture conditions are 26/18 deg.C day and night temperature, 16/8h photoperiod, and the moisture is kept continuously. And inoculating for 7d to investigate diseases.

3T strains having a high CsSTK relative expression level obtained in example 4 were selected₀The method for carrying out inoculation identification on plant leaves comprises the following specific steps: the prepared 1X 10⁵Pseudocercospora cubensis (Corynespora cassicola (Berk)&Curt) Wei, given by the institute for cucumber wet in Tianjin, 10. mu.L/drop of spore suspension of spore. mL-1 was inoculated on the back of leaf in vitro, 30 drops. The culture conditions are 26 deg.C/18 deg.C day and night temperature, 16h/8h photoperiod, and the moisture is kept continuously. And inoculating for 7d to investigate diseases. D9320 and D0401 were used as disease-resistant and susceptible controls. The investigation was carried out after the isolation inoculation of 7d pathogenic bacteria.

The results show that after the cucumber corynespora leaf spot pathogen is inoculated on the susceptible strain D0401, the leaves are obviously yellowed, the whole leaves are in a water stain shape, and the disease symptoms are obvious, while the leaves of the transgenic plant only partially show the water stain shape, and the disease symptoms are obviously lighter than those of the susceptible strain D0401, which shows that the resistance of the susceptible strain over-expressing CsSTK to the cucumber corynespora leaf spot is obviously enhanced (figure 6).

Example 6 transgenic plant Gene expression analysis

The gene expression analysis is carried out on the over-expressed CsSTK by utilizing qRT-PCR technology, and meanwhile, the cucumber resistance can be enhanced due to the over-expression of the CsERF004 downstream gene of the CsSTK gene, so that the CsSTK gene and the CsERF004 gene are subjected to comparative analysis.

As shown in fig. 7, the results show that: CsERF004, CsPR1 and CsPR4 in the over-expressed CsERF004 plant are all obviously up-regulated; CsSTK, CsERF004, CsPR1 and CsPR4 in the over-expressed CsSTK plant are all obviously up-regulated. According to the gene expression result, the over-expression of both CsSTK and CsERF004 can cause the up-regulation expression of CsPR1 and CsPR 4; overexpression of CsSTK significantly upregulated expression of CsERF004, but there was no significant change in CsSTK expression after overexpression of CsERF 004.

Example 7 level analysis of different substance content in CsSTK transgenic plants

The determination of ethylene release amount, salicylic acid content and methyl jasmonate content was carried out on transgenic plants, respectively, with reference to gas chromatography (research on molecular mechanism of cucumber downy mildew and Corynespora clava [ D ]. Harbin: Bay university of northeast agriculture university, proceedings of doctor, 2017.) and enzyme-linked immunosorbent assay (Zhao J, Li G, Yi G X, et al, composite between organic and inorganic complex enzyme assay, respectively, Analytica Chimica Acta, 2006, 571 (1): 79-85.).

The results are shown in fig. 8, and show that the salicylic acid content and the ethylene release amount in the over-expressed CsSTK plants are both significantly higher than those of the control, and the methyl jasmonate content is significantly lower than that of the control.

Example 8CsSTK Gene subcellular localization analysis

1. Construction of 35S-CsSTK-eGFP transient expression vector

The RNA of a disease-resistant variety D9320 leaf blade of 48h of the inoculated corynebacterium sporotrichum is extracted and subjected to reverse transcription (5 multiplied Integrated RT MasterMix of the company DiNing Beijing is used for synthesizing a first chain cDNA), and the specific operation flow is as follows according to the instruction of the product:

to 200. mu.L of sterilized and precooled EP tube were added 2 pg-2. mu.g of RNA sample, 4 XDIRT Reaction Mix 4. mu.L, DEPC-ddH₂After supplementing O to 16. mu.L, incubating at 42 ℃ for 2min for the gDNA removal step, immediately placing the EP tube on ice and collecting all the liquid in the tube to the bottom of the tube, adding 4. mu.L of 5 × Integrated RT MasterMix, incubating at 42 ℃ in a PCR instrument for 20min, incubating at 85 ℃ for 5min to terminate the reaction, and after the first strand of cDNA is synthesized, storing at-20 ℃. After sequence analysis, cloning was performed using GFP-CsSTK-F/R to obtain a CsSTK open reading frame containing no stop codon (FIG. 9).

CsSTK transient expression vector construction primer:

GFP-CsSTK-F CCAAGCTTATGTCAAAGGTTCTTGCAGCAATA

GFP-CsSTK-R GGACCCGGGTCTTTGTGGTTTTGAACA

the cloning reaction system and the reaction procedure were the same as in example 1.

Sequencing the cloned gene sequence, and comparing the sequence of the sequencing result by using DNAMAN 8 to be 100% correct, thereby indicating that the CsSTK open reading frame is successfully cloned and being capable of carrying out subsequent tests.

And (3) respectively carrying out double enzyme digestion (BamHI and SmalI) on the pGII-eGFP empty vector and the PCR recovery product, mixing the two samples according to a proportion after glue recovery, connecting the two recovery products by using T4 ligase to obtain a 35S-CsSTK-eGFP transient expression vector, and displaying the electrophoresis results of the PCR product and the double enzyme digestion product, wherein target bands appear at 1140bp positions (figure 10), which indicates that the CsSTK is successfully constructed on the pGII-eGFP vector, the construction of the 35S-CsSTK-eGFP transient expression vector is completed, and the vector can be used for subsequent tests.

2. Introduction of 35S-CsSTK-eGFP transient expression vector into agrobacterium tumefaciens

Respectively extracting a 35S-CsSTK-eGFP fusion expression vector and a pGII-eGFP empty vector plasmid, respectively transforming the two vectors into a GV3101 agrobacterium-infected state containing an auxiliary plasmid pSoup, carrying out 48-hour dark inversion culture, carrying out PCR identification after a single strain grows out, and displaying a target band at a 1140bp position by an electrophoresis result of a PCR product (figure 11), thereby indicating that the 35S-CsSTK-eGFP fusion expression vector is successfully transferred into the agrobacterium tumefaciens.

3. Extracting a protoplast cell of arabidopsis thaliana, then respectively introducing the 35S-CsSTK-eGFP fusion expression vector and the pGII-eGFP empty vector into the arabidopsis thaliana protoplast, and observing the subcellular localization condition of the 35S-CsSTK-eGFP fusion expression protein under a laser confocal microscope.

As a result, pGII-eGFP protein showed fluorescence signals at various sites of the cell, whereas the 35S-CsSTK-eGFP fusion-expressed protein showed only green fluorescence signals on the cell membrane (FIG. 12). Indicating that CsSTK is a cell membrane localization protein and plays a main role in cell membrane ascending.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> northeast university of agriculture

<120> cucumber CsSTK gene, protein, expression vector and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1140

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtcaaagg ttcttgcagc aatattagga ggttctgcag gagccgtggc attggtggga 60

ttgattatta tacttttaag attcttagca cgctcgagaa acactgcaag aacttccgag 120

actggctctt ctgatccatc tgttcaagtg ggaaggcatg ttggtattga attgactcta 180

cgagatgcta ggcgttttga gatggcagag ttggtgttgg ccactaatga tttcagcgac 240

aagaacttga ttggagaagg gaaatttggg gaggtctata agggtatgct tcaggatgga 300

atgttcgtcg ctataaaaaa gcggcatgga gcgcctagtc aggatttcgt agatgaggta 360

cactacctct cgtctattca gcatcgaaat ctcgtgactc ttttgggcta ctgccaggaa 420

aataatctac agtttctcat ctttgattat atacccaacg gaagtgtttc tagccacata 480

tatggcactg agcagcgttc ggctgagaag ctggagttca agatcagact ctcaatagct 540

ctgggggcag ctaaaggtct gtcacatctt cactccatga gccctcgttt gacacacaga 600

aacttcaaga catccaacgt tcttgtagat gagaatttta tagctaaagt ggcagatgca 660

ggacttcaca atgtcatgcg aagatttgac gtttcagaat catcgtcccg agcaacagca 720

gatgagatat ttcttgcacc tgaggtaaaa gagtttcgac aattttccga gaaaagtgac 780

gtatatagtt tcggcgtatt ccttttggag ttggtaagcg gtcaaaaagc gactgatgca 840

cctgtttcca atcccaatta tactctggtg gactggatac aaaacaatca gagaaagagc 900

gatattggta gcattacgga tccaaggtta gggaagagct tcactgagga aggtatgggt 960

gaactaatgg atttgatact tcaatgcgtc gaatattcaa gcgagaggcg tccagtgatg 1020

agctacgtgg tgacagagct ggaaaggata ctggagaaag agatgaactt aacaacagtg 1080

atgggagaag gaagcccaac tgttactctt gggagtcagt tgttcaaaac cacaaagtaa 1140

<210> 2

<211> 379

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Lys Val Leu Ala Ala Ile Leu Gly Gly Ser Ala Gly Ala Val

1 5 10 15

Ala Leu Val Gly Leu Ile Ile Ile Leu Leu Arg Phe Leu Ala Arg Ser

20 25 30

Arg Asn Thr Ala Arg Thr Ser Glu Thr Gly Ser Ser Asp Pro Ser Val

35 40 45

Gln Val Gly Arg His Val Gly Ile Glu Leu Thr Leu Arg Asp Ala Arg

50 55 60

Arg Phe Glu Met Ala Glu Leu Val Leu Ala Thr Asn Asp Phe Ser Asp

65 70 75 80

Lys Asn Leu Ile Gly Glu Gly Lys Phe Gly Glu Val Tyr Lys Gly Met

85 90 95

Leu Gln Asp Gly Met Phe Val Ala Ile Lys Lys Arg His Gly Ala Pro

100 105 110

Ser Gln Asp Phe Val Asp Glu Val His Tyr Leu Ser Ser Ile Gln His

115 120 125

Arg Asn Leu Val Thr Leu Leu Gly Tyr Cys Gln Glu Asn Asn Leu Gln

130 135 140

Phe Leu Ile Phe Asp Tyr Ile Pro Asn Gly Ser Val Ser Ser His Ile

145 150 155 160

Tyr Gly Thr Glu Gln Arg Ser Ala Glu Lys Leu Glu Phe Lys Ile Arg

165 170 175

Leu Ser Ile Ala Leu Gly Ala Ala Lys Gly Leu Ser His Leu His Ser

180 185 190

Met Ser Pro Arg Leu Thr His Arg Asn Phe Lys Thr Ser Asn Val Leu

195 200 205

Val Asp Glu Asn Phe Ile Ala Lys Val Ala Asp Ala Gly Leu His Asn

210 215 220

Val Met Arg Arg Phe Asp Val Ser Glu Ser Ser Ser Arg Ala Thr Ala

225 230 235 240

Asp Glu Ile Phe Leu Ala Pro Glu Val Lys Glu Phe Arg Gln Phe Ser

245 250 255

Glu Lys Ser Asp Val Tyr Ser Phe Gly Val Phe Leu Leu Glu Leu Val

260 265 270

Ser Gly Gln Lys Ala Thr Asp Ala Pro Val Ser Asn Pro Asn Tyr Thr

275 280 285

Leu Val Asp Trp Ile Gln Asn Asn Gln Arg Lys Ser Asp Ile Gly Ser

290 295 300

Ile Thr Asp Pro Arg Leu Gly Lys Ser Phe Thr Glu Glu Gly Met Gly

305 310 315 320

Glu Leu Met Asp Leu Ile Leu Gln Cys Val Glu Tyr Ser Ser Glu Arg

325 330 335

Arg Pro Val Met Ser Tyr Val Val Thr Glu Leu Glu Arg Ile Leu Glu

340 345 350

Lys Glu Met Asn Leu Thr Thr Val Met Gly Glu Gly Ser Pro Thr Val

355 360 365

Thr Leu Gly Ser Gln Leu Phe Lys Thr Thr Lys

370 375

Claims

The application of the CsSTK gene or the protein coded by the CsSTK gene or the expression vector containing the CsSTK gene in improving the resistance of cucumber corynespora leaf spot is characterized in that the nucleotide sequence of the CsSTK gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein is shown as SEQ ID NO: 2, respectively.