CN118028310A

CN118028310A - A upland cotton gene GhKMT; 2a and application thereof in regulating and controlling premature traits

Info

Publication number: CN118028310A
Application number: CN202410285860.8A
Authority: CN
Inventors: 宿俊吉; 王彩香; 巨吉生; 袁文敏; 张雪利; 李丹丹; 杨琦文
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2024-03-13
Filing date: 2024-03-13
Publication date: 2024-05-14
Anticipated expiration: 2044-03-13

Abstract

The invention discloses a upland cotton gene GhKMT; 2a and the application thereof in regulating and controlling the premature trait, relating to the technical field of genetic engineering. The GhKMT; the nucleotide sequence of the 2a gene is shown as SEQ ID NO.1. The research of the invention finds GhKMT; 2a gene is obviously expressed in the full bloom stage and flower organ, a VIGS silencing vector of the target gene is constructed by cloning the target gene, and biological functions of regulating and controlling early maturity are researched, and GhKMT is found as a result; 2a gene silencing causes short plant height, bud emergence and flowering time delay of upland cotton, and affects the growth and development of upland cotton. Thereby confirming GhKMT; 2a, the gene positively regulates and controls the early ripening of upland cotton, improves the phenotype growth and development characters of the upland cotton such as flower opening, bud emergence, plant height and the like, and provides important gene resources for the early ripening breeding of upland cotton.

Description

A upland cotton gene GhKMT; 2a and application thereof in regulating and controlling premature traits

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a upland cotton gene GhKMT; 2a and application thereof in regulating and controlling the premature trait.

Background

Upland cotton is widely planted cotton and is a main source of natural fibers in the world. Early ripening is an important excellent property of upland cotton, and can effectively avoid low-temperature influence, thereby being beneficial to expanding upland cotton planting and realizing large-scale mechanical planting and harvesting.

Upland cotton early maturing is a complex character, mainly comprising characters such as a full-growth period, a seedling period, a bud period, a boll period, a first fruit branch position height, a pre-frost flower rate and the like, wherein the characters are quantitative characters, are controlled by a plurality of quantitative character gene loci, have a complex genetic mechanism and are easily influenced by environmental factors, so that the traditional breeding method is slow in progress and low in efficiency.

Earlier studies by the inventors showed that histone methylation regulates flowering by modulating the key flowering gene FLC. However, upland cotton lacks the FLC gene, so that the difficulty of regulating the gene for flowering time of Liu Deliu cotton through histone methylation studies is increased.

The digging of the gene for controlling the early ripening property of upland cotton has very important significance for cultivating upland cotton varieties with the early ripening property.

Disclosure of Invention

The invention aims to provide a upland cotton gene GhKMT; 2a and the application thereof in regulating and controlling the premature property so as to solve the problems existing in the prior art, and the invention discovers GhKMT; 2a, the gene positively regulates and controls the early ripening of upland cotton, improves the phenotype growth and development characters of the upland cotton such as flower opening, bud emergence, plant height and the like, and provides important gene resources for the early ripening breeding of upland cotton.

In order to achieve the above object, the present invention provides the following solutions:

The invention provides GhKMT for regulating and controlling the early ripening property of upland cotton; 2a gene, ghKMT; the nucleotide sequence of the 2a gene is shown as SEQ ID NO. 1.

The invention also provides GhKMT of the above; application of 2a gene in regulation and control of early ripening property of upland cotton, ghKMT; 2a gene positively regulates and controls the early ripening property of upland cotton.

Further, the early maturing trait includes bud time and flowering time.

The invention also provides a GhKMT for over-expression; the application of the biological material of the 2a gene in improving the early ripening property of upland cotton.

Further, the biological material is the substance described in the following (1) or (2):

(1) Over-expression GhKMT; 2a gene;

(2) Recombinant microorganism strains comprising said recombinant expression vectors.

Further, the early maturing trait includes bud time and flowering time.

The invention also provides a method for improving the precocity property of upland cotton, which is to overexpress GhKMT; 2a, transforming the biological material of the gene into upland cotton, and constructing to obtain the GhKMT over-expressed; 2a transgenic upland cotton plants of the gene.

The invention also provides a silencing GhKMT; the application of the biological material of the 2a gene in reducing the height of upland cotton plants.

Further, the biological material is the substance described in the following (a) or (b):

(a) Silencing GhKMT; 2a gene silencing vector;

(b) Recombinant microbial strains comprising said silencing vector.

The invention also provides a method for reducing the height of upland cotton plants, which is to silence GhKMT; 2a, transforming the biological material of the gene into upland cotton, and constructing to silence GhKMT; 2a transgenic upland cotton plants of the gene.

The invention discloses the following technical effects:

The candidate genes related to reproductive development are mined by adopting gene family analysis, and GhKMT is found; the 2a gene is remarkably expressed in the full bloom stage and the flower organ. To further clarify GhKMT; 2a, cloning a target gene to construct a VIGS silencing vector of the target gene, researching the biological function of regulating and controlling prematurity, and finding GhKMT; 2a gene silencing causes short plant height, bud emergence and flowering time delay of upland cotton, and affects the growth and development of upland cotton. Thereby confirming GhKMT; 2a, the gene positively regulates and controls the early ripening of upland cotton, improves the phenotype growth and development characters of the upland cotton such as flower opening, bud emergence, plant height and the like, and provides important gene resources for the early ripening breeding of upland cotton.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a map of pEASY-T5 Zero vector;

FIG. 2 is a map of a TRV vector;

FIG. 3 shows the result of PCR detection of the objective genetic bacteria solution;

FIG. 4 shows the results of double cleavage assay;

FIG. 5 is GhKMT; sequencing the cloned product of 2a;

FIG. 6 is a phenotypic alignment of gene silencing;

FIG. 7 is GhKMT; 2a gene expression level detection result;

FIG. 8 is GhKMT; 2a phenotype test results of the silenced plants; wherein A is bud time; b is flowering time; c is the plant height.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

Example 1

1 Test materials and reagents

1.1 Test materials

The material used in this test was cotton-in-cotton 113 (ZM 113), and seeds were provided by cotton institute, national academy of agricultural sciences.

1.2 Test reagents

The reagents used in this study are shown in Table 1:

Table 1 reagents used in the experiments

1.3 Strain and vector

GV3101 Agrobacterium competent cells and pEASY-T5 Zero cloning vectors (CT 501-01, DH 5. Alpha. Containing E.coli competent cells) were purchased from Shanghai Weidi Biotechnology Inc. and full gold Biotechnology Inc., respectively, and the VIGS vector systems (TRV 156, TRV192 and TRV-GhPDS) for gene silencing were given by the cotton institute transgenic subject group of China academy of agriculture, and the pEASY-T5 Zero vector map is shown in FIG. 1.

1.4 Preparation of solutions

A. The formulation of the medium is shown in Table 2:

Table 2 culture medium formulation

Note that: the culture medium is sterilized at 121deg.C for 20min

B.100mL 50 xTAE buffer: 24.2g Tris+3.72g Na ₂EDTA·2H₂ o+5.71mL glacial acetic acid;

50mg/mL rifampicin (Rif) and 20mg/mL Acetosyringone (AS): respectively dissolving 5g of Rif powder and 2g of acetosyringone powder in 100mLDMSO solution, respectively filtering and sterilizing with 0.22 filter membrane, packaging, and preserving at-20deg.C;

d.0.5M MES: 10.65g MES powder is dissolved in 50mL ddH ₂ O, the pH value is adjusted to 5.6 by NaOH, the volume is fixed to 100mL, and the mixture is filtered and sterilized by a filter membrane of 0.22, packaged and stored at 4 ℃;

e.1m MgCl ₂: 9.521g of MgCl ₂ powder (heat of amplification) was dissolved in 100mL of ddH ₂ O, sterilized by filtration through a 0.22 filter membrane and stored at 4 ℃;

f.500mL of heavy suspension: 10mL 0.5M MES+1mL 20mg/mLAS +5mL of 1M MgCl ₂, sterile ddH ₂ O up to 500mL.

1.5 Use of instruments

The main instrument is as follows: visible spectrophotometers, high-speed refrigerated centrifuges, water baths, electrophoresis apparatuses, artificial climate boxes, gel cutting apparatuses, ultra-low temperature refrigerators, fluorescence quantitative apparatuses, gradient PCR apparatuses, sterilization pans, electronic balances, microwave ovens, table-type constant temperature shaking tables, ice-making machines, ultra-clean benches, biochemical incubators, ultra-micro spectrophotometers, ultra-pure water apparatuses and mini vortex mixing apparatuses.

2 Test method

2.1 Primer design

GhKMT3 was designed using NCBIPrimer-BLAST (https:// www.ncbi.nlm.nih.gov/tools/primer-BLAST /); 2a gene cloning primer, qRT-PCR primer and VIGS silencing primer (the fragment size of the VIGS silencing primer is 300-500 bp), the primer sequences are shown in Table 3:

TABLE 3 list of primers used in the present invention

2.2 Extraction of RNA

2.2.1RNA extraction and reverse transcription

RNA is extracted according to the instruction of the polysaccharide polyphenol plant total RNA extraction kit.

Reverse transcription (synthesis of the first strand of cDNA):

a. Taking out the split RNA from the refrigerator at-80 ℃ according to the own requirement, melting on ice, taking out the 5X FastKing-RT Supermix reagent and RNase-Free ddH ₂ O from the refrigerator at-20 ℃ to melt on ice, and mixing the mixture slightly;

b. The reaction system is shown in Table 4:

TABLE 4 reverse transcription reaction system

C. the reaction procedure is shown in Table 5:

table 5 reaction procedure

D. after the reaction, the purity and concentration of cDNA were measured, and the cDNA was packaged and stored at-20 ℃.

2.3 Amplification of fragments of interest and ligation and transformation of cloning vectors

2.3.1 Amplification of fragments of interest

The cDNA of Zhongcotton 113 (ZM 113) is used as a template, and Taq 2X PCR Mix with Dye V2 premix (containing dye) kit is used for amplifying the target gene, and the amplification system is shown in Table 6:

TABLE 6 amplification System

After the reaction solution is added according to the system, the mixture is gently mixed, centrifuged for a short time, and the reaction is carried out according to the reaction procedure of Table 7:

TABLE 7 amplification reaction procedure

After completion of the reaction, the size of the target gene was determined to be appropriate by agarose gel electrophoresis at 1.8%.

Upland cotton GhKMT; 2a gene has the nucleotide sequence shown in SEQ ID NO. 1.

Cloning to obtain GhKMT; 2a (SEQ ID NO. 2).

SEQ ID NO.1：

ATGGATCCTGAGAATGAAGACCTTCCTCAATATGAACACATTTTTCAAAACGAATTCTCATATCGAAAACATAAAAAGCAAAAAGAGGAAGATATTGCTATATGCGAGTGCAAATTTGACTTTAGTGATCCTGATAGTACATGTGGAGAGAGGTGCTTGAATGTACTAACAAGCACAGAATGTACACCCGGTTATTGTCCTTGCGGTGTTTACTGCAAGAATCAGAAATTT CAGAAATGCCAATATGCTAGAGTTACGTTGTTTAAAACAGAGGGTCGTGGTTGGGGTCTGCTTGCTGCTGAATATATAAAGACTGGACAATTTATTGTTGAGTACTGTGGAGAAGTAATATCTTGGAAAGAAGCAAAGCGAAGATCTCAAGCTTATGAAAATCAAGGTCTTAAGGATGCATTTATTATTTCTCTGAATGGCTCTGAATCCATTGATGCCACCAAAAAGGGAAACCTTGCTAGATTCATCAACCACTCATGCCAACCGAACTGTGAGACTAGGAAGTGGACTGTTTTGGGAGAAATACGAGTTGGAATATTTGCAAAAGAAGATATTCCAATTGGAACTGAGCTTGCATATGATTATAACTTTGAATGGTATGGTGGTGCAAAAGTTCGCTGCCTCTGTGGTGCACTCAACTGTTCAGGATTTCTTGGAGCAAAGTCTCGTGGCTTTCAGGAGGATACCTATTTATGGGAAGATGATGATGAACGGTATTCAGTTGAAAAAATCCCGTTGTATGATTCTGCAGAAGATGAGCCTGCCACAAAGCTCCTGAAAGCTATAAATTTGAATTCTGAGAATGATGTTAATACTAAAAGTGAACAGTCCATAACAATGGATGTTAATCTGAAATCTAAGCACCAGTTGGAGTCTACTATTGATACAGTTCCCATGGAAGGGGTAGATGTGAATACACTGAAAATTGAATCACCTAAAGATATAAACTTGTATTCTCAAGATGCTCAGCAGGCTTTTTCACAAAAGAATGCTATGATATCTCGCATCCGAAGTAACAGTGCATGCCGGAATTATCACATTAGATCAGGGCCAATGCTTAAGAAAAAGTCGCAGCATTATTCAAATGGAAAGTTGAAACATCTTTCAAAGAAGCAAATTGATTTAAAACATCTTGCTAAGCTCTTAGCATCAAAAGAAGCACAAGAGGAAGTCTTCAGATATGAGGAAATGAAGAATGAAGCAGCTTCCCAACTAGCTTCTTTGTACAATGATATACGCCCTGCAATTGAAGAACATGAGAGGGATAACCAAGACAGTGTATCGACCAGTGTTGCTGAGAAGTGGATCGAAGCGTCCTGCTCCAAACTGAAGATAGAATTTGATTTTCATTCTTCAATTCTCAGAAATATTGTCTGCACTCCGCAAAAGGCATGTGAACAAGTGAAGCCTTGTGAACCGGAAGGACACGGAGGCAATAATGATACTGAAGTAAAGTTGGAATTTTGA; Wherein the underlined section is a silent fragment.

SEQ ID NO.2：

GTCTCGTGGCTTTCAGGAGGATACCTATTTATGGGAAGATGATGATGAACGGTATTCAGTTGAAAAAATCCCGTTGTATGATTCTGCAGAAGATGAGCCTGCCACAAAGCTCCTGAAAGCTATAAATTTGAATTCTGAGAATGATGTTAATACTAAAAGTGAACAGTCCATAACAATGGATGTTAATCTGAAATCTAAGCACCAGTTGGAGTCTACTATTGATACAGTTCCCATGGAAGGGGTAGATGTGAATACACTGAAAATTGAATCACCTAAAGATATAAACTTGTATTCTCAAGATGCTCAGCAGGCTTTTTCACAAAAGAATGCTATGATATCTCGCATCCGAAGTAACAGTGCATGCCG.

2.3.3 Ligation of the Gene of interest to the cloning vector pEASY-T5 Zero

A. the pEASY-T5 Zero vector was removed from the-80℃refrigerator and thawed on ice.

B. The volume of the added target fragment (molar ratio of carrier to target fragment=1:5) was calculated and the following ingredients (whole procedure completed on ice) were added to a sterile 1.5mL centrifuge tube:

Table 8 connection system

C. the mixture was gently mixed, centrifuged briefly, and then connected at 25℃for 5 minutes.

2.3.4 Transformation of DH 5. Alpha. E.coli competent cells

The strain is transformed into DH5 alpha escherichia coli competent cells by a heat shock method, and bacterial liquid PCR verification and sequencing (completed by Shanghai biological engineering Co., ltd.) are carried out by using a target gene sequence primer.

2.4 Construction of silencing vectors

2.3.4 Positive plasmid which is sequenced successfully is used as a template, a silencing fragment is amplified by a primer added with restriction enzyme Xba I and Kpn I restriction sites and a protective base, and GhKMT is carried out by a double restriction enzyme method; 2a into a TRV2 silencing vector to construct TRV2: ghKMT3;2a silencing vector, the specific cleavage system is as follows: stopping the reaction after 3 hours at 37 ℃, adding 10X Loading Buffer, recovering the PCR product of the target gene fragment, recovering the large fragment by enzyme digestion of the vector, connecting the target fragment with a silencing vector, converting the connecting product into competent cells of escherichia coli, carrying out bacterial liquid PCR and double enzyme digestion identification, sequencing positive plasmids (Shanghai) after completion, and transferring the positive plasmids into the competent cells of agrobacterium GV 3101.

A. GV3101 competent cells were removed from the-80℃ultra-low temperature refrigerator, thawed on ice, split into two tubes, 2. Mu.L of the successfully sequenced plasmid was aspirated, and added to centrifuge tubes for transformation.

B. After the above steps were completed, 350. Mu.L of LB liquid medium (without antibiotics) was added, shaking culture was performed for 2 hours (28 ℃,200 rpm), the bacterial liquid was uniformly spread on the solid medium (Kan ⁺ and Rif antibiotics were added), and the culture was performed for 2 days in the dark at 28 ℃.

C. After the culture is completed, picking the single colony into 5mL LB liquid culture medium (adding Kan ⁺ and Rif antibiotics), and culturing for 16h according to the condition of shaking culture in the step b;

d. After the cultivation is completed, the bacterial liquid is preserved by using 50% glycerol (bacterial liquid: glycerol=1:1), and is preserved at 80 ℃ for standby; and (5) performing bacterial liquid PCR to confirm that the vector is positive.

2.5 Upland cotton VIGS silencing target Gene

VIGS silencing of cotton 113 seedlings was performed as follows:

a. Cotton 113 seeds are planted, when the seeds grow to the seventh day and cotyledons are fully unfolded, the seeds are soaked in water until nutrient soil in the flowerpot absorbs water to the surface, and then the soaking is stopped, and the seeds are placed for standby.

B. Kan ⁺ and Rif were added to LB liquid medium for use, wherein the final concentrations of Kan ⁺ and Rif were 50. Mu.g/mL and 25. Mu.g/mL, respectively. The VIGS vector system and the objective gene bacterial liquid taken out from-80 ℃ were thawed on ice, at 28 ℃, activated at 200rpm for 16h (bacterial liquid: LB liquid medium=1:10). And after the activation is finished, the propagation is carried out according to the same proportion.

C. After the bacterial liquid is propagated, centrifuging for 10min at a rotation speed of 5000rpm, pouring out supernatant, retaining bacterial cells, suspending the bacterial cells by using a spectrophotometry heavy suspension, and adjusting the OD ₆₀₀ to 0.8.

D. after the resuspension is finished, the bacteria are placed in the dark for 3 hours, and after the bacteria are resuscitated, TRV1 is respectively combined with TRV 00 (which is a blank control group), TRV2 GhCAL (which is a positive control group) and TRV2 GhKMT; 2a (experimental group) were mixed 1:1 and thoroughly mixed.

E. On the seventh day of the growth of upland cotton seedlings, they were soaked in water according to the method of step a. VIGS injections were performed on the eighth day of upland cotton seedling growth, with specific manipulations: and d, cutting the back of the cotyledon by using a 1mL syringe needle (the wound is not too large and the needle point is just large), injecting the mixed bacterial liquid in the step d into the upland cotton cotyledon, and filling the whole cotyledon with the bacterial liquid as much as possible.

F. After injection, in order to achieve better infection effect, the seeds are wrapped by a plastic bag, and are cultivated under normal growth conditions after being placed in darkness at 25 ℃ for 24 hours.

2.6 Identification of silenced plants

And after the positive control upland cotton seedlings whiten, adopting experimental groups and blank group upland cotton young leaves to carry out fluorescent quantitative experiments, and detecting the silencing efficiency.

3 Results and analysis

3.1 Construction of silencing vectors and Positive identification of silencing lines

3.1.1 Construction of the Gene fragment of interest and silencing vector

The primer was designed using NCBI blast-primer, and the target fragment was amplified using Taq 2X PCRMix with Dye V2 enzyme of Eboltaaceae using cDNA of Zhongcotton 113 as a template, and recovered using a universal DNA purification recovery kit (Tiangen). The recovered target fragment was ligated with pEASY-T5 Zero vector to select for plasmid extraction. The target fragment was ligated with TRV156 vector by double digestion (FIG. 2) and cultured, and positive plasmid was obtained by bacterial liquid PCR (FIG. 3), double digestion and sequencing (FIGS. 4 and 5). The target fragment ligated to the vector was obtained by sequencing without base deletion and substitution, and thus sequencing was successful. The positive plasmid was transformed into Agrobacterium by freeze thawing for cultivation.

3.1.2 Detection of silencing efficiency of the Gene of interest and phenotypic analysis

Screening out candidate genes for the growth and development of upland cotton based on gene family data analysis. Therefore, the effect of the target gene in the flowering regulation of upland cotton is researched by utilizing the VIGS technology. The selection gene GhKMT of the invention; 2a the VIGS test was performed. Silencing of the gene of interest in cotton 113 in upland cotton by epicutaneous injection under cotyledons revealed that the positive control (TRV: ghCAL) plants began to whiten on day 8 post-infection, and whitening of the positive control was apparent on day 12 post-silencing, indicating successful infection of upland cotton with Agrobacterium (FIG. 6). The silencing efficiency of the target gene is detected, and compared with a control group, TRV is GhKMT; ghKMT3 in 2a plants; 2a was significantly inhibited (FIG. 7). Analysis of the expression levels of VIGS-silenced plants and control plants indicated that the gene of interest had been silenced.

3.1.3 Phenotypic Effect of silenced plants

Selecting four-week-old TRV, ghPDS, TRV 00 and TRV GhKMT; 2a plants were cultivated at 25 ℃. Then observing the plant height, bud and flowering time, and finding GhKMT < 3 >; after 2a gene silencing, the plant height of upland cotton became shorter, bud and flowering time was delayed, affecting the growth and development of upland cotton (fig. 8). After the gene was found to silence, upland cotton GhKMT; the plant height of the 2a silent plants is reduced by 5.8cm, and the average bud and flowering time are respectively delayed by 5.8 days and 7.03 days, which reach significant levels. The above results indicate GhKMT; 2a gene can regulate and control the flowering time of upland cotton.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. GhKMT3 for regulating and controlling early ripening property of upland cotton; 2a gene, characterized in that said GhKMT; the nucleotide sequence of the 2a gene is shown as SEQ ID NO. 1.

2. GhKMT3 according to claim 1; the application of the 2a gene in regulating and controlling the precocious trait of upland cotton is characterized in that GhKMT; 2a gene positively regulates and controls the early ripening property of upland cotton.

3. The use according to claim 2, wherein the early maturing trait comprises bud time and flowering time.

4. Overexpressing GhKMT according to claim 1; the application of the biological material of the 2a gene in improving the early ripening property of upland cotton.

5. The use according to claim 4, wherein the biological material is the substance of the following (1) or (2):

(1) Overexpressing GhKMT3 according to claim 1; 2a gene;

6. The use according to claim 4, wherein the early maturing trait comprises bud time and flowering time.

7. A method for improving the precocity properties of upland cotton, characterized in that GhKMT according to claim 1 is overexpressed; 2a, transforming the biological material of the gene into upland cotton, and constructing to obtain the GhKMT over-expressed; 2a transgenic upland cotton plants of the gene.

8. A method of silencing GhKMT of claim 1; the application of the biological material of the 2a gene in reducing the height of upland cotton plants.

9. The use according to claim 8, wherein the biological material is the substance of the following (a) or (b):

(a) Silencing GhKMT of claim 1; 2a gene silencing vector;

(b) Recombinant microbial strains comprising said silencing vector.

10. A method of reducing upland cotton plant height comprising silencing GhKMT of claim 1; 2a, transforming the biological material of the gene into upland cotton, and constructing to silence GhKMT; 2a transgenic upland cotton plants of the gene.