CN117209583B

CN117209583B - Application of gene ZmMYB86 in improving drought resistance of plants

Info

Publication number: CN117209583B
Application number: CN202311486224.3A
Authority: CN
Inventors: 关淑艳; 姜青平; 焦鹏; 马义勇; 刘思言; 齐晶; 魏小童; 王春来; 范素杰; 张卓
Original assignee: Jilin Agricultural University
Current assignee: Jilin Agricultural University
Priority date: 2023-11-09
Filing date: 2023-11-09
Publication date: 2024-03-22
Anticipated expiration: 2043-11-09
Also published as: CN117209583A

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses application of a gene ZmMYB86 in improving drought resistance of plants. The invention is realized by cloningZmMYB86The gene is constructed by a plant over-expression vector, then transformed into a corn plant by an agrobacterium-mediated method, and the gene function is explored under drought stress conditions. Provides theoretical basis and technical support for the subsequent cultivation of new drought-resistant corn strain and germplasm resource innovation, and has wide prospect in improving drought tolerance of corn plants in abiotic stress.

Description

Application of gene ZmMYB86 in improving drought resistance of plants

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of a gene ZmMYB86 in improving drought resistance of plants.

Background

In the context of global climate change, extreme weather events are frequent. Drought, one of the most complex and damaging natural phenomena, has serious effects on ecology, agriculture and socioeconomic performance due to its characteristics of wide distribution, high frequency of occurrence and long duration. Studies have shown that the risk of future drought events will increase further worldwide. Therefore, the physiological and biochemical index change and the molecular genetic mechanism of the corn are needed to be known temporarily under drought stress, and the genetic improvement technology is utilized to improve the drought tolerance of the corn, so that a foundation is laid for cultivating new corn germplasm and further improving the corn yield.

The corn is located at the first place of the planting area and the yield of Chinese grain crops, the sowing area and the yield account for about 33% and 36% of the total area and the total yield of the grain crops, and the status in the production of Chinese grain crops is important, so that the response rule of corn to soil moisture is researched, the influence of drought of different degrees in different breeding periods on the production of corn is ascertained, and the significance for guaranteeing the grain safety and the like is great.

MYB transcription factors are the largest transcription factor family in plants, MYB proteins play an important role in resisting abiotic stress regulation, and the functions of the maize MYB transcription factor family are classified, analyzed and identified, so that a foundation is laid for the drought resistance function research of maize MYB transcription factor family proteins, and an important reference is provided for researching the response of maize MYB transcription factor family proteins to drought stress. MYB transcription factors, the number of family members in plants is large, and 168, 203 and 130 MYB transcription factors are found in arabidopsis (Arabidopsis thaliana), maize (Zea mays l.) and rice (Oryza sativa l.) respectively. MYB transcription factor family members all have highly conserved MYB domains, MYB transcription factors are generally classified into MYB-related, R2R3-MYB (2R-MYB), 3R-MYB and 4R-M according to the number of repeats of the MYB domain they containFour YB proteins, R2R3-MYB proteins, contain a DNA binding domain at the N end and an activating or inhibiting domain at the C end, and are involved in the regulation of physiological mechanisms such as plant growth, metabolism, stress, metabolism and the like. The MYB transcription factor family has been demonstrated to participate in plant responses to drought, barley transcription factorsHvMYB1Is a positive regulatory factor of drought tolerance, and is maize MYB transcription factorZmMYB3RCan improve drought and salt stress tolerance of transgenic plants, in poplarPtrMYB94The drought resistance of plants can be improved by synergistic effect with ABA signals.

Disclosure of Invention

The invention aims to provide application of a gene ZmMYB86 in improving drought resistance of plants.

In order to achieve the aim of the invention, in a first aspect, the invention provides application of a gene ZmMYB86 in improving drought resistance of plants.

The gene ZmMYB86 is a gene encoding the following protein (a) or (b):

(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2; or (b)

(b) And (b) a protein which is derived from (a) and has equivalent functions and is obtained by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.

Plants of the invention include, but are not limited to, maize, rice, wheat, arabidopsis.

In a second aspect, the present invention provides a method for improving drought resistance in a plant comprising: the gene ZmMYB86 is over-expressed in plants by utilizing a genetic engineering means;

the over-expression mode is selected from the following 1) to 5), or an optional combination:

1) By introducing a plasmid having the gene;

2) By increasing the copy number of the gene on the plant chromosome;

3) By altering the promoter sequence of said gene on the plant chromosome;

4) By operably linking a strong promoter to the gene;

5) By introducing enhancers.

Further, the gene ZmMYB86 is constructed on a plant expression vector (such as pCAMBIA 3301), the plant is transformed by using the recombinant vector, and positive transgenic plants are screened.

In a third aspect, the invention provides an application of the gene ZmMYB86 in the improvement of corn germplasm resources.

In a fourth aspect, the invention provides application of a gene ZmMYB86 in preparing drought-resistant transgenic corn.

The invention is realized by cloningZmMYB86The gene is constructed by a plant over-expression vector, then transformed into a corn plant by an agrobacterium-mediated method, and the gene function is explored under drought stress conditions. Provides theoretical basis and technical support for the subsequent cultivation of new drought-resistant corn strain and germplasm resource innovation, and has wide prospect in improving drought tolerance of corn plants in abiotic stress.

Drawings

FIG. 1 shows the results of the detection of the bar gene of transgenic maize in a preferred embodiment of the present invention.

FIG. 2 is a bar graph of ROS scavenging enzyme activity of transgenic corn and wild type corn under drought stress treatment according to a preferred embodiment of the present invention.

FIG. 3 is a graph showing the phenotype change results of transgenic corn and wild-type corn under drought stress treatment according to the preferred embodiment of the present invention.

FIG. 4 is a graph showing pore variation results of transgenic corn and wild-type corn under drought stress treatment according to the preferred embodiment of the present invention.

FIG. 5 is a graph showing NBT staining results of transgenic corn and wild-type corn leaves under normal culture conditions and drought stress treatment in a preferred embodiment of the present invention.

FIG. 6 is a graph showing DAB staining results of transgenic corn and wild-type corn leaves under normal culture conditions and drought stress treatment in a preferred embodiment of the present invention.

Detailed Description

The invention provides a maize drought-resistant gene ZmMYB86 and application thereof, and provides a novel gene for maize drought-resistant genetic improvement.

The invention adopts the following technical scheme:

the invention provides a maize drought-resistant gene ZmMYB86, the nucleotide sequence of which is shown in a sequence table SEQ ID NO. 1.

The invention also provides application of the corn drought-resistant gene ZmMYB86 in improving the drought resistance of corn.

The invention also provides application of the maize drought-resistant gene ZmMYB86 in maize germplasm resource improvement.

The invention also provides application of the maize drought-resistant gene ZmMYB86 in preparation of drought-resistant transgenic maize.

The invention also provides a coding protein of the drought-resistant gene ZmMYB86 of the corn, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.

The invention also provides a biological material containing the corn drought-resistant gene ZmMYB86, wherein the biological material is an expression cassette, a vector, engineering bacteria or cells.

Further, the biological material is a vector, the vector is a pCAMBIA3301 vector, and a 35S promoter, the ZmMYB86 gene and a terminator are sequentially connected to a multi-cloning site region of the pCAMBIA3301 vector.

Further, the biological material is a cell, the cell is a host cell, the host cell contains the vector, and/or a positive sequence or a negative sequence of an exogenous ZmMYB86 gene is integrated in the genome of the host cell.

The invention also provides a method for improving drought resistance of plants, which integrates the corn drought resistance related gene ZmMYB86 into cells, tissues and organs of the plants and enables the cells, tissues and organs to be over-expressed.

Further, the plants include maize, rice, wheat, arabidopsis.

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.

EXAMPLE 1 cloning of the ZmMYB86 Gene

Corn inbred line H8186 is selected as an experimental material, and three-leaf-period corn leaf tissue is extracted and reversely transcribed into cDNA for standby.

Biological information of ZmMYB86 was retrieved from the corn database with transcript ID nm_001147132.1. Designing a specific amplification primer by taking a gene sequence as a template, wherein the specific amplification primer has the following sequence:

ZmMYB86-F：5’- GCATTGCCCCGTCTCTTAGT -3’

ZmMYB86-R：5’- GTGTGTATCATGGCCTAGACAAAA-3’

using cDNA as a template and ZmMYB86-F and ZmMYB86-R as primers, amplification reaction was performed by using high-fidelity enzyme Primer STAR Max Premix (2X) produced by TAKARA company, and the amplification reaction system is shown in Table 1:

TABLE 1

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 35s, extension at 72 ℃ for 30s, adding 0.5 mu L of Taq enzyme after 30 cycles, adding a poly tail to the 3' end, and finally continuing extension at 72 ℃ for 10min to complete the reaction, wherein the obtained PCR product is detected by agarose gel electrophoresis with the mass ratio of 1%.

The target gene is subjected to gel cutting recovery by using a gel recovery kit of Axygen company, connected with a pMD-18T vector, transformed into DH5 alpha escherichia coli competent cells, screened for positive clones, and sent to sequencing. Sequencing results showed that the clone yielded a fragment size of 816bp (FIG. 1).

And (3) comparing and verifying the ZmMYB86 gene:

after the sequencing result is compared with the sequences in the database by MEGA6.0 software, the sequence is consistent with the nucleotide sequence shown in SEQ ID NO. 1, which shows that the ZmMYB86 gene is successfully cloned. Sequence analysis shows that the total length of the coding region of the ZmMYB86 gene is 816bp, and the total coding is 271 amino acids.

EXAMPLE 2 construction of ZmMYB86 Gene overexpression vector

According to the multiple cloning sites of pCAMBIA3301 and the sequence characteristics of the target gene, bglII and BstEII enzyme cutting sites are added at two ends of the target gene ZmMYB86, and positive plasmid obtained by cloning is used as a template for amplification, so that PCR amplified fragments are obtained. The amplification primer sequences were as follows:

ZmMYB86-F：5’-actcttgaccatggtagatct ATGGGACGGCTCTCCTGCG -3’

ZmMYB86-R：5’-ggggaaattcgagctggtcacc TCAGAAGTATTCCAAATTGAATTCTATGTTG -3’

the recombinant plasmid is transformed into competent cells of escherichia coli, sequenced by shaking and stored, the plasmid is extracted, and the plasmid is digested by BglII and BstEII to obtain a small target fragment. The connection system is shown in Table 2:

TABLE 2

After the ligation reaction was performed at 16℃for 3 hours, the ligation reaction was transformed into competent cells of E.coli, and the plasmid was extracted by macula selection, shaking.

Example 3 maize genetic transformation of ZmMYB86 Gene

1. Cleaning of corn seeds

10ml of sodium hypochlorite solution was taken in 90ml of water to prepare a 10% sodium hypochlorite solution, and then 100ml of 70% alcohol was prepared. Corn seeds to be cleaned (maize inbred line H8186, which is taught by Jilin university of agriculture Guan Shuyan, see Jiao P, ma R, wang C, chen N, liu S, qu J, guan S and Ma Y (2022) Integration of mRNA and microRNA analysis reveals the molecular mechanisms underlying drought stress tolerance in maize (Zea mays L.). Front. Plant Sci.13:932667. Doi: 10.3389/fpls.2022.932667) were placed in sterile centrifuge tubes, 1ml of 70% alcohol was added to each tube, soaked for 5-10min, and then rinsed 3 times with sterile water, then 1ml of 10% sodium hypochlorite solution was added, soaked for 5-10min, and rinsed with sterile water at intervals, and mixed with shaking to clean the sterilized corn H8186 seeds after rinsing in a refrigerator at 4℃for 1-2 days.

2. Cultivation of corn

The seeds after the cleaning are taken out and evenly spread on a square culture dish of N6 solid culture medium by a liquid-transfering gun, and the culture dish is placed in a culture room for long-day culture for 14-21 days.

3. Agrobacterium-mediated transformation of corn neck tip

Cutting off leaf stalks of the corn neck tip in an ultra clean bench when the corn neck tip grows to a proper size, and using agrobacterium-mediated method to invade the corn neck tip with agrobacterium EAH105 containing pCAMBIA-ZmMYB86-Bar, then sequentially performing co-culture, screening culture, differentiation culture and rooting culture (the formula of each culture medium is shown in Table 3), and adding about 70ml ddH when the corn neck tip grows to a top cover ₂ And O, hardening seedlings, and transplanting the seedlings to sterile soil for continuous culture after two days.

TABLE 3 Table 3

4. Screening of ZmMYB86 Gene-transferred corn

About 1.5g of corn leaves are taken after 10 days, the genome of the corn leaves is extracted, the bar gene is taken as a target gene, molecular detection is carried out on the screened positive plants, and whether the transgenic corn is successfully transformed is primarily identified.

5. Obtaining of ZmMYB86 gene-transferred positive maize plant offspring

According to the method of the steps, the transgenic corn plants which are initially identified are further cultured in a culture room for 5 months, and the seeds of the T0 generation transgenic corn are obtained. And (3) screening seeds (T0 generation) preliminarily identified as transgenic corn plants by using a culture medium plate containing herbicide to obtain T1 generation corn plants, transplanting the T1 generation corn plants into nutrient soil, and continuously carrying out greenhouse culture to obtain the T1 generation transgenic corn, wherein the volume ratio of the nutrient black soil to the frog stone is 1:1.

6. Observation of aboveground phenotypes of transgenic and wild-type maize under drought stress conditions

And culturing wild corn and T1 generation transgenic corn under the same conditions of 25 ℃ and 16h/8h light/dark, carrying out drought 14d treatment on one group when the wild corn and the T1 generation transgenic corn grow to a trefoil period, and simultaneously carrying out 4h drought simulation treatment on the other group of trefoil period plants under 10% PEG6000 solution, and carrying out phenotype observation and air hole opening and closing.

As shown in FIG. 3, when the transgenic corn is cultured under normal temperature, the transgenic corn has approximately the same growth vigor as wild corn, leaf wilting occurs after drought treatment for 14d, the leaf wilting degree of the wild corn is greater than that of the transgenic corn, and experimental results show that ZmMYB86 gene can enhance the tolerance of corn to drought stress.

7. Determination of enzymatic Activity of transgenic corn and wild corn under drought stress conditions

The seed points of the wild corn H8186 seed and the T1 generation transgenic corn are sown in nutrient soil, and when the corn grows to the trefoil stage, leaves are adopted to respectively measure the ROS scavenging enzyme activity. Each group was set with 3 replicates and statistics. As shown in fig. 2, the ROS scavenger enzyme activities of transgenic corn and wild-type corn were not significantly different under normal moisture culture conditions; under drought-simulated stress of 10% PEG6000, the ROS scavenging enzyme activities of both the transgenic corn and the wild-type corn are up-regulated, wherein the ROS scavenging enzyme activities of the transgenic corn are obviously increased compared with the wild-type corn. Experimental results show that the ZmMYB86 gene can enhance the ROS scavenging enzyme activity of corn under drought stress conditions.

8. Stomata opening and closing assay for transgenic corn and wild corn under drought stress conditions

The seed points of the wild corn H8186 seed and the T1 generation transgenic corn are sowed in nutrient soil, when the corn grows to the trefoil period, leaves are adopted, the corn is placed in an electronic competition fixing solution (2.5% pentanediol), and air holes are observed to be opened and closed through a scanning electron microscope. Each group was set with 3 replicates and statistics. As shown in FIG. 4, under normal moisture culture conditions, both the stomata of transgenic corn and wild-type corn are open; under drought simulation stress of 10% PEG6000, transgenic corn responds to drought more rapidly than wild corn stomata, and the comparison group has the stomata in a semi-open state at 2h, and the transgenic corn has the stomata closed, so that water loss is effectively reduced. Experimental results show that the ZmMYB86 gene can enhance the stomatal sensitivity of corn under drought stress conditions.

9. Histochemical staining analysis of ROS content in transgenic corn and wild corn leaves under drought stress treatment

Histochemical Nitrogen Blue Tetrazolium (NBT) staining is often used to detect O in plant tissue ₂ ^- The lighter the general color, the stronger the antioxidant capacity of the plant, the more convenient and quick the stress the plant is stressed, and the darker the color, the more the active oxygen in the plant tissue is accumulated. Organisms produce a wide variety of ROS molecules in aerobic environments, such as superoxide anions, hydrogen peroxide, hydroxyl radicals, singlet molecular oxygen, and lipid peroxides, among others. ROS are very reactive and extremely unstable, so detection of ROS is usually dependent on their end product. The hydrogen peroxide can be detected by DAB staining, and the part of the root tip or leaf of the plant, where the hydrogen peroxide is generated, is dark brown, and other light brown or colorless or pigment of the plant itself.

And (3) respectively carrying out histochemical staining on the transgenic corn and the wild corn which are subjected to the dry and dry treatment in the step (6).

NBT staining: firstly, NBT solution was prepared, 0.05g of NBT was weighed into a 50ml centrifuge tube, 0.5ml of 1M phosphate buffer (pH 7.8) was added, and ddH was added ₂ O was fixed to a volume of 50ml. The sampled leaves were then placed in NBT solution for staining for 0.5. 0.5 h and removed, and the stained leaves were decolorized with 95% alcohol until chlorophyll was completely degraded for observation and photographic recording.

DAB staining: firstly preparing DAB solution, weighing 0.02g DAB and 38ml ddH ₂ O,0.2M HCl was adjusted to pH for dissolution to prepare DAB dye liquor with a final concentration of 0.5mg/ml (note that the preparation is ready-to-use, avoiding autoxidation). The sampled leaves were then placed in DAB solution for staining for 0.5. 0.5 h and removed, and the stained leaves were decolorized with 95% alcohol until the chlorophyll was completely degraded for viewing and recording by photographing.

As shown in FIG. 5, NBT staining results showed that the color shades of transgenic corn and wild corn were not significantly different when cultured under normal temperature conditions; after 4h incubation at 10% peg6000, both transgenic corn and wild-type corn darkened. As shown in fig. 6, DAB staining results showed no obvious difference in the color shades of transgenic corn and wild-type corn when cultured under normal temperature conditions; after 4h incubation at 10% peg6000, both transgenic corn and wild-type corn darkened. Experimental results show that ZmMYB86 can improve the antioxidation capability of corn leaves, thereby improving the drought tolerance of plants.

The drought tolerance test on the transgenic plant shows that under drought stress, the transgenic plant has high oxidation resistance and less damage caused by stress, and the gene is further verified to be relevant to drought resistance regulation and control of the plant, and the drought tolerance of the transgenic plant can be improved through over-expression of the gene, so that new genetic resources are provided for genetic engineering improvement of corn varieties.

Compared with the prior art, the invention discloses that the gene ZmMYB86 is a novel plant drought-resistant related gene for the first time, and plays a vital role in defending under drought stress conditions. The research of the gene provides theoretical basis and technical support for the subsequent cultivation of new drought-resistant corn strain and germplasm resource innovation.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims

1. Application of gene ZmMYB86 in improving drought resistance of corn;

the gene ZmMYB86 is a gene for encoding a protein with an amino acid sequence shown as SEQ ID NO. 2.

2. A method for improving drought resistance of corn, comprising: the gene ZmMYB86 is over-expressed in corn by utilizing a genetic engineering means;

1) By introducing a plasmid having the gene;

2) By increasing the copy number of the gene on the maize chromosome;

3) By operably linking a strong promoter to the gene;

4) By introducing enhancers;

wherein the gene ZmMYB86 is as described in claim 1.

3. The method according to claim 2, wherein the gene ZmMYB86 is constructed on a plant expression vector, the plant is transformed with the recombinant vector, and positive transgenic plants are selected.

4. The method of claim 3, wherein the plant expression vector is pCAMBIA3301.

5. Application of gene ZmMYB86 in corn germplasm resource improvement;

the purpose of improvement is to improve drought resistance of corn;

wherein the gene ZmMYB86 is as described in claim 1.

6. Application of gene ZmMYB86 in preparing drought-resistant transgenic corn;

wherein the gene ZmMYB86 is as described in claim 1.