CN114854855A

CN114854855A - Biomarkers, nucleic acid products and kits for esophageal cancer

Info

Publication number: CN114854855A
Application number: CN202210161853.8A
Authority: CN
Inventors: 周俊; 万康康; 熊杨辉
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-02-22
Filing date: 2022-02-22
Publication date: 2022-08-05
Also published as: CN116083586A

Abstract

The invention relates to a biomarker of esophageal cancer, a nucleic acid product and a kit. The biomarker of the esophageal cancer is at least one of HOXD1 gene and GSX1 gene, and the esophageal cancer is diagnosed by detecting the methylation level of the biomarker. The biomarker of the esophageal cancer has higher sensitivity in the application process, can improve the detection rate of the esophageal cancer, improves the detection accuracy, is beneficial to realizing crowd shunting, improves the compliance of endoscopic examination, and is beneficial to improving the early diagnosis rate of the esophageal cancer, particularly early esophageal cancer.

Description

Biomarkers, nucleic acid products and kits for esophageal cancer

Technical Field

The invention relates to the technical field of biology, in particular to a biomarker of esophageal cancer, a nucleic acid product and a kit.

Background

According to the latest statistics of GLOBOCAN 2020, esophageal cancer is the tenth malignancy of the global incidence, with the mortality rate being the sixth. Although increased survival of patients with esophageal cancer is observed in some studies, the prognosis of esophageal squamous carcinoma/esophageal cancer is relatively poor compared to other cancers, and most studies show that 5-year survival rates of patients with esophageal cancer are between 15% and 25%. In a study of a population of 1033 ESCC patients undergoing surgery, 5-year survival rates for stage IA, IB, IIA, IIB, IIIA, IIIB, IIIC and IV patients were 84.9%, 70.9%, 56.2%, 43.3%, 37.9%, 23.3%, 12.9% and 3.4%, respectively (Wang J, Wu N, Zheng QF, Yan S, Lv C, Li SL, et al. evaluation of the 7th edition of the TNM classification in a patient with a patient having a surgery J.gateway (2014)20: 18397-403. doi:10.3748/wjg.v 20.48.1839). In addition, esophageal cancer patients with distant organ metastases at the time of first diagnosis are particularly poor in survival, and a retrospective study showed that median survival of these patients was only 6 months, with 21.1% or 11.8% for 1-or 2-year survival (Chen MQ, Xu BH, Zhang YY. analysis of protective factors for esophageal gastric cancer cell with discrete organ metabolism at initial diagnosis of esophageal cancer, J Chin Med Assic. (2014)77: 562-6. doi:10.1016/j. jcma.2014.05.014), all of which demonstrated that early diagnosis of esophageal cancer could improve survival of esophageal cancer patients.

Currently, endoscopic and pathological biopsy are the gold standard for the diagnosis of early esophageal cancer. The esophageal mucosa change can be visually observed under an endoscope, the cancer and swelling state can be evaluated, lesion image data can be shot or recorded, the nature, the part, the boundary and the range of a lesion can be evaluated by methods such as dyeing, amplification and the like, and the screening and the early diagnosis can be completed in one step. However, endoscope detection depends on hospital hardware equipment and doctor experience, and has the defects of invasiveness, low patient compliance and the like, and in addition, the screening amount of endoscopes is far lower than the screening requirement of people in high-incidence areas of esophageal cancer in China. In addition, although kits for diagnosing esophageal cancer using tumor markers are available, the sensitivity of these kits is yet to be improved.

Disclosure of Invention

Based on this, there is a need for providing a biomarker for esophageal cancer, which can improve the problem of low sensitivity of conventional biomarkers for esophageal cancer detection by detecting the methylation level of the biomarker to diagnose esophageal cancer.

In addition, the application of the biomarker in preparing a reagent or a kit for diagnosing esophageal cancer, a nucleic acid product for diagnosing esophageal cancer and the kit are also provided.

A biomarker of esophageal cancer, the biomarker being at least one of HOXD1 gene and GSX1 gene, and diagnosing esophageal cancer by detecting the methylation level of the biomarker.

The research of the invention finds that at least one of the HOXD1 gene and the GSX1 gene is used as a biomarker, and the esophageal cancer is diagnosed or assisted to diagnose by detecting the methylation level of at least one of the HOXD1 gene and the GSX1 gene, so that the sensitivity is higher, the detection rate of the esophageal cancer can be effectively improved, and the detection accuracy is further improved.

The application of the biomarker in preparing a reagent or a kit for diagnosing esophageal cancer.

A nucleic acid product comprising a pair of detection primers for detecting the methylation level of HOXD1 gene and/or GSX1 gene.

In one embodiment, the nucleic acid product comprises a detection primer pair for detecting the methylation level of the Chr2: 176189800-176189943 region and/or the Chr13: 27793590-27793770 region.

In one embodiment, the detection primer pair comprises a HOXD1 methylated primer pair and a HOXD1 unmethylated primer pair, the HOXD1 methylated primer pair is used for amplifying methylated Chr2: 176189800-176189943 regions, and the HOXD1 unmethylated primer pair is used for amplifying unmethylated Chr2: 176189800-176189943.

In one embodiment, the detection primer pair comprises a GSX1 methylated primer pair and a GSX1 unmethylated primer pair, and the GSX1 methylated primer pair is used for amplifying methylated Chr13: 27793590-27793770, the GSX1 unmethylated primer pair is used for amplifying unmethylated Chr13:27793590 region 27793770.

In one embodiment, the nucleotide sequence of the HOXD1 methylation primer pair is as shown in SEQ ID NO: 1 to SEQ ID NO: 2 is shown in the specification; and/or, the nucleotide sequence of the HOXD1 unmethylated primer pair is as shown in SEQ ID NO: 3 to SEQ ID NO: 4 is shown in the specification;

in one embodiment, the nucleotide sequence of the GSX1 methylation primer pair is as set forth in SEQ ID NO: 5 to SEQ ID NO: 6 is shown in the specification; and/or, the nucleotide sequence of the GSX1 unmethylated primer pair is shown in SEQ ID NO: 7 to SEQ ID NO: shown in fig. 8.

In one embodiment, the kit further comprises an internal reference primer pair.

In one embodiment, the nucleotide sequence of the reference primer pair is as shown in SEQ ID NO: 9 to SEQ ID NO: shown at 10.

A kit for diagnosing esophageal cancer, which comprises the nucleic acid product.

In one embodiment, the kit further comprises at least one of nucleic acid extraction reagents, methylation conversion reagents, quality control products, PCR reaction reagents and sequencing reagents.

Detailed Description

The present invention will now be described more fully hereinafter for purposes of facilitating an understanding thereof, and may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The term "and/or" includes any and all combinations of one or more of the associated listed items. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The term "gene" refers to a segment of DNA encoding a polypeptide chain of amino acids, which includes sequences located in coding and non-coding regions, as well as exon and intron sequences, involved in the transcription/translation and transcriptional/translational regulation of a gene.

The term "methylation" is a form of chemical modification of DNA that alters its genetic appearance without altering the DNA sequence. Generally, DNA methylation refers to the covalent attachment of a methyl group at the cytosine carbon position 5 of a genomic CpG dinucleotide under the influence of a DNA methyltransferase enzyme. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not a cytosine in one or more CpG dinucleotides in a DNA sequence is methylated or the frequency/ratio/percentage of methylation, and represents both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare DNA methylation levels according to actual conditions. For example, in some cases, the comparison may be based on the Ct values detected for the samples; in some cases, the proportion of gene methylation in the sample, i.e., the number of methylated molecules/(the number of methylated molecules + the number of unmethylated molecules) × 100, may be calculated and then compared; in some cases, statistical analysis and integration of each index are also required to obtain a final judgment index.

The term "CpG island" refers to a region of DNA that is enriched for a number of cytosines and guanines linked by phosphoester bonds. CpG dinucleotides are usually concentrated in the promoter region and exons of human genes. In a normal human genome, CpG sites outside of a CpG island are usually methylated, whereas CpG sites in a CpG island are usually unmethylated, and this methylated form is inherited stably with cell division. When tumors occur, the non-methylation degree of CpG sites outside the CpG island of the cancer suppressor gene is increased, and the CpG sites in the CpG island are in a hypermethylation state, so that the chromosome helix degree is increased, the transcription is inhibited, and the gene expression is deleted.

The HOXD1(homeobox D1) gene is a member of the Antp homeobox family (Antp homeobox family) and encodes a protein with a homeobox DNA binding domain. With reference to grch38.p13, the HOXD1 gene is located on human chromosome 2. It should be noted that the positions of the sites or regions mentioned herein are all referred to as grch38.p 13.

The GSX1(GS homeobox 1) gene has an enabling sequence-specific double-stranded DNA binding activity. Acting upstream or within the positive regulation of transcription by RNA polymerase II. Using grch38.p13 as reference genome, HOXD1 gene is located on human chromosome 13.

The research of the invention finds that at least one of the HOXD1 gene and the GSX1 gene is used as a biomarker, and the esophageal cancer is diagnosed or assisted to diagnose by detecting the methylation level of at least one of the HOXD1 gene and the GSX1 gene, so that the invention has higher sensitivity, can effectively improve the detection rate of the esophageal cancer and improve the detection accuracy. Proved by verification, the sensitivity of the HOXD1 gene as a biological object of the esophageal cancer is 100 percent, the specificity can reach 80 percent, the sensitivity of the GSX1 gene as the biological object of the esophageal cancer is 100 percent, and both the HOXD1 gene and the GSX1 gene can be used for early diagnosis of the esophageal cancer.

Based on the above, an embodiment of the present application provides a biomarker of esophageal cancer, wherein the biomarker is at least one of HOXD1 gene and GSX1 gene, and esophageal cancer is diagnosed by detecting methylation level of the biomarker.

In some embodiments, the target region for detecting methylation level of HOXD1 gene (abbreviated as "HOXD 1 target region") is a CpG island of HOXD1 gene. Further, the HOXD1 target region was Chr2: 176189800-176189943. At Chr2: 176189800-176189943, has 11 CG dinucleotide sites. Further, esophageal cancer is diagnosed by detecting the methylation level of a target site in the HOXD1 target region. In one optional specific example, the target site in the HOXD1 target region is at least one of the following sites: chr2:176189800, Chr2: 176189815, Chr2: 176189818, Chr2: 176189830, Chr2: 176189845, Chr2: 176189852, Chr2: 176189856, Chr2: 176189921, Chr2: 176189927, Chr2: 176189930 and Chr2: 176189935.

in some embodiments, the target region for detecting methylation levels of the GSX1 gene (abbreviated "GSX 1 target region") is a CpG island of the GSX1 gene. Further, the GSX1 target region was Chr13: 27793590-27793730. At Chr13: the 27793590-27793730 region has 13 CG dinucleotide sites. Further, esophageal cancer is diagnosed by detecting the methylation level of a target site in a target region of GSX 1. In one optionally specific example, the target site in the GSX1 target region is at least one of the following: chr13:27793604, Chr13:27793608, Chr13:27793623, Chr13:27793643, Chr13:27793645, Chr13:27793651, Chr13:27793673, Chr13:27793679, Chr13:27793682, Chr13:27793687, Chr13:27793693, Chr13:27793695 and Chr13: 27793714.

It is understood that, when detecting the methylation level of the target region, the detection may be performed for the whole region of the target region, and the detection may be performed for a partial region of the target region.

Based on the above, an embodiment of the present application further provides an application of the above biomarker in preparing a reagent or a kit for diagnosing esophageal cancer.

Based on the above, one embodiment of the present application further provides a kit for diagnosing esophageal cancer, which includes a reagent for detecting the methylation level of HOXD1 gene and/or GSX1 gene.

In some embodiments, the kit comprises a nucleic acid product. In particular, the nucleic acid product comprises a detection primer pair for detecting the methylation level of the HOXD1 gene and/or the GSX1 gene.

In some embodiments, the above nucleic acid product comprises a nucleic acid sequence for detecting Chr2: 176189800-176189943 region methylation level detection primer pair.

Alternatively, the kit for diagnosing esophageal cancer detects the methylation level of the target region of HOXD1 by using a methylation-specific PCR method. Specifically, for detecting Chr2: 176189800-176189943 region methylation level detection primer pairs comprise a HOXD1 methylation primer pair and a HOXD1 non-methylation primer pair, and the HOXD1 methylation primer pair is used for amplifying methylated Chr2: 176189800-176189943 region, HOXD1 unmethylated primer pair was used to amplify unmethylated Chr2: 176189800-176189943. In an alternative specific example, the nucleotide sequence of the HOXD1 methylation primer pair is as set forth in SEQ ID NO: 1 to SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the HOXD1 unmethylated primer pair is shown in SEQ ID NO: 3 to SEQ ID NO: 4, respectively.

In some embodiments, the above nucleic acid product comprises a nucleic acid sequence for detecting Chr13: 27793590-27793770 region methylation level detection primer pair. Alternatively, the kit for diagnosing esophageal cancer detects the methylation level of the GSX1 target region by using a methylation-specific PCR method. Specifically, for detecting Chr13: 27793590-27793770 region methylation level detection primer pairs comprise a GSX1 methylation primer pair and a GSX1 non-methylation primer pair, and a GSX1 methylation primer pair is used for amplifying methylated Chr13: 27793590-27793770, GSX1 unmethylated primer pair was used to amplify unmethylated Chr13: 27793590-27793770. Further, the nucleic acid product comprises a nucleic acid sequence for detecting Chr13: 27793590-27793730 region methylation level detection primer pair. In an alternative specific example, the nucleotide sequence of the GSX1 methylation primer pair is as set forth in SEQ ID NO: 5 to SEQ ID NO: 6 is shown in the specification; and/or, the nucleotide sequence of the GSX1 unmethylated primer pair is shown in SEQ ID NO: 7 to SEQ ID NO: shown in fig. 8. In some embodiments, the above nucleic acid product comprises a nucleic acid sequence for detecting Chr2: 176189800-176189943 region methylation level detection primer pair and detection primer pair for detecting Chr13: 27793590-27793770 region methylation level detection primer pair.

In some embodiments, the nucleic acid product further comprises an internal reference primer pair. Alternatively, the reference primer pair is an ACTB primer pair designed for the ACTB gene. In an alternative embodiment, the nucleotide sequence of the ACTB primer pair is as set forth in SEQ ID No: 9 to SEQ ID No: shown at 10. It is understood that, in other embodiments, other genes can be selected as the reference gene, and in this case, the reference primer pair is designed correspondingly.

In some embodiments, the kit further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control, a PCR reaction reagent, and a sequencing reagent. The nucleic acid extraction reagent is used for extracting nucleic acid; the methylation conversion reagent is used for converting cytosine which is not methylated in DNA into uracil, and the methylated cytosine is kept unchanged; the quality control product is used for quality control; the PCR reaction reagent is used for constructing a PCR amplification reaction system; sequencing reagents were used for sequencing.

In one embodiment, the methylation conversion reagent is a sulfite conversion reagent or an enzymatic conversion reagent.

In one embodiment, the PCR reactionThe reagent comprises PCR buffer solution, dNTP and MgCl ₂ And Taq DNA polymerase.

In one embodiment, the quality control product comprises a positive reference product and a negative reference product.

It is understood that, in other embodiments, the method for detecting the methylation level of HOXD1 and/or GSX1 gene by using the above-described kit for diagnosing esophageal cancer is not limited to the above-described methylation-specific PCR method, but may be other methods. Such as fluorescence quantification, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, or methylation-sensitive restriction endonuclease methods. Correspondingly, the kit for diagnosing esophageal cancer comprises corresponding reagents.

In some embodiments, the kit for diagnosing esophageal cancer is suitable for samples including, but not limited to, blood samples and tissue samples.

The kit for diagnosing esophageal cancer uses at least one of HOXD1 gene and GSX1 gene as a biomarker, and diagnoses esophageal cancer by detecting the methylation level of the biomarker, and the kit has high sensitivity and high accuracy; the kit is beneficial to realizing crowd shunting, improving the compliance of endoscopic examination, and is beneficial to improving the early diagnosis rate of esophageal cancer, particularly early esophageal cancer, by further performing endoscopic and pathological diagnosis on a methylation positive sample.

In addition, an embodiment of the present application further provides a chip for diagnosing esophageal cancer, wherein a reaction unit for detecting the methylation level of the HOXD1 gene and/or the GSX1 gene is disposed on the chip.

Optionally, the reaction unit is provided with a nucleic acid product of any of the embodiments above.

In some embodiments, the chip is further provided with at least one of an extraction unit and a conversion unit. Specifically, the extraction unit is used for extracting nucleic acid in a sample to be detected; the conversion unit is used to convert nucleic acids (unmethylated cytosine to uracil).

The chip for diagnosing esophageal cancer has the advantages of high sensitivity and high detection rate by taking the HOXD1 gene and/or the GSX1 gene as biomarkers for diagnosing esophageal cancer.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The following detailed description is given with reference to specific examples. The following examples are not specifically described, and other components except inevitable impurities are not included. Reagents and instruments used in the examples are all conventional in the art and are not specifically described. The experimental procedures, in which specific conditions are not indicated in the examples, were carried out according to conventional conditions, such as those described in the literature, in books, or as recommended by the manufacturer.

Example 1

Whole blood samples of 20 healthy people and plasma samples of 20 esophageal cancer patients are collected at a certain hospital in Zhengzhou, sample information is recorded, and all samples are processed in an anonymization mode. The sample information is shown in table 1.

TABLE 1

1. Extracting DNA;

the cell genome DNA of each sample was extracted using a blood/cell/tissue genome DNA extraction kit (catalog number: DP304) from Tiangen Biochemical technology (Beijing) Ltd, see the kit instructions for the specific procedures.

2. Bisulfite conversion and recovery

The extracted genome DNA of each sample is respectively subjected to bisulfite conversion, the nucleic acid conversion kit is a nucleic acid purification reagent (20200843, Ehan instruments) of Wuhan Amison Life technologies, Ltd, and the specific experimental operation is shown in the kit specification. During the transformation, unmethylated cytosine (C) is converted to uracil (U), methylated cytosine is unchanged, uracil (U) is paired with adenine (a) and cytosine (C) is paired with guanine (G) in the subsequent PCR step, thereby achieving the discrimination of methylated from unmethylated sequences.

3. PCR reaction

PCR amplification was performed using Taq DNA polymerase using bisulfite converted DNA as a template, and using both a methylated primer pair and an unmethylated primer pair. Methylated primer pairs can amplify the methylated template after conversion, and unmethylated primer pairs can amplify the unmethylated template after conversion.

Specifically, the upstream primer sequence of the HOXD1 methylation primer pair is (5 '-3'): CCCCGTTGTAGGTAAATTCGTC (SEQ ID NO: 1), and the sequence of the downstream primer of the HOXD1 methylation primer pair is (5 '-3'): GGGACTATCTCGATACGCCGA (SEQ ID NO: 2); the sequence of the upstream primer of the HOXD1 unmethylated primer pair was (5 '-3'): CCCCCGTTGTAGGTAAATTTGTT (SEQ ID NO: 3), and the downstream primer sequence of HOXD1 unmethylated primer pair is (5 '-3'): CCCCCACTATCTCAATACACCAA (SEQ ID NO: 4).

The sequence of the upstream primer of the GSX1 methylation primer pair is (5 '-3'): CCCGTAGTAAGAGGATGCGTAC (SEQ ID NO: 5), the sequence of the downstream primer of the GSX1 methylation primer pair is (5 '-3'): CCCCTCTTCACCTACTTCTCGA (SEQ ID NO: 6); the sequence of the upstream primer of the GSX1 unmethylated primer pair is (5 '-3'): CCCCGTAGTAAGAGGATGTGTAT (SEQ ID NO: 7), the sequence of the downstream primer of the GSX1 unmethylated primer pair is (5 '-3'): GGGGGTCTTCACCTACTTCTCAA (SEQ ID NO: 8)

Specifically, PCR was performed on the same sample to detect methylation levels of HOXD1 gene and GSX1 gene, respectively. That is, only one methylation primer pair and one non-methylation primer pair of one gene (HOXD1 gene or GSX1 gene) are added into one PCR tube, and an ACTB primer pair of an internal reference gene is added at the same time. The sequence of the ACTB upstream primer is as follows: AAGGTGGTTGGGTGGTTGTTTTG (SEQ ID NO: 9), the sequence of the ACTB downstream primer is: AATAACACCCCCACCCTGC (SEQ ID NO.10), and the PCR amplification system for each sample is shown in Table 2.

TABLE 2

Components	Dosage (mu L)
		10×Taq buffer(Mg ²⁺ Free)	5
25mM Mg ²⁺	4
		dNTP Mix(10mM each)	1
Methylation primer pair upstream primer (10. mu.M)	1
		Methylation primer pair downstream primer (10. mu.M)	1
Unmethylated primer set Top primer (10. mu.M)	0.5
		Unmethylated primer set downstream primer (10. mu.M)	0.5
ACTB upstream primer (10. mu.M)	1
		ACTB downstream primer (10. mu.M)	1
Hot start Taq DNA polymerase	0.5
		Template DNA	10
Ultrapure water	Supplement to 50

The PCR amplification procedure is shown in Table 3.

TABLE 3

4. Sequencing and analysis

And (3) sending the PCR product to a sequencing company for Sanger sequencing, sequencing the amplification product of the HOXD1 gene by taking primers corresponding to SEQ ID NO. 1-4 as sequencing primers, sequencing the amplification product of the GSX1 gene by taking primers corresponding to SEQ ID NO.5-8 as sequencing primers, and analyzing the methylation condition of each CpG site in each amplicon according to a sequencing peak map. Specifically, methylation of cytosine in a CpG nucleotide is classified into two types: i.e., methylation and non-methylation, wherein methylation is divided into complete methylation and partial methylation, and a cytosine at a CpG dinucleotide site is considered partially methylated if sequencing of the site reveals both a C and a T at the position of the cytosine.

A sample is considered methylated in an amplicon if more than 95% of the C's in CpG dinucleotide sites in the amplicon are methylated (i.e., at least 10 are methylated for the HOXD1 gene and at least 12 are methylated for the GSX1 gene).

The number of methylation positives/negatives in each sample was calculated, and the methylation positive/negative ratio was calculated. Sensitivity is the proportion of methylation positivity in samples with positive pathological results; specificity is the proportion of methylation negatives in samples with negative pathological results. The results are shown in Table 4. It should be noted that, when performing a PCR reaction experiment, an experimenter does not know the pathological information of a sample in advance, and after the PCR reaction is completed, the experimenter compares the PCR result with the pathological information and calculates sensitivity and specificity data.

TABLE 4

As can be seen from the results in table 4, both HOXD1 gene and GSX1 gene were methylated in 20 esophageal cancer samples, and the methylation positive ratio was 100%, which indicates that the detection sensitivity of 20 esophageal cancer samples was 100% with HOXD1 gene or GSX1 gene as biomarker; the methylation positive rate of the GSX1 gene in 20 healthy human samples is as high as 85%, which indicates that the specificity is 15%; the methylation positive rate of the HOXD1 gene in 20 healthy human samples was 20%, indicating that the specificity was 80%. Therefore, methylation of CpG island of HOXD1 gene is a biomarker of esophageal cancer with high sensitivity and high specificity. In addition, as can be seen from the sample information in table 1, the 20 samples diagnosed with esophageal cancer include 3 samples at stage T1 and 2 samples at stage T2, which indicates that methylation of HOXD1 gene and GSX1 gene is also effective for early stage esophageal cancer detection, and is a product that can be used as an early stage screen.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, so as to understand the technical solutions of the present invention specifically and in detail, but not to be understood as the limitation of the protection scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. It should be understood that the technical solutions obtained by logical analysis, reasoning or limited experiments based on the technical solutions provided by the present invention are all within the protection scope of the appended claims of the present invention. Therefore, the protection scope of the patent of the invention is subject to the content of the appended claims, and the description can be used for explaining the content of the claims.

Sequence listing

<110> Wuhan Amisen Life technologies Ltd

<120> biomarkers of esophageal cancer, nucleic acid products and kits

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccccgttgta ggtaaattcg tc 22

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gggactatct cgatacgccg a 21

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cccccgttgt aggtaaattt gtt 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccccactat ctcaatacac caa 23

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cccgtagtaa gaggatgcgt ac 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cccctcttca cctacttctc ga 22

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccccgtagta agaggatgtg tat 23

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gggggtcttc acctacttct caa 23

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aaggtggttg ggtggttgtt ttg 23

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aataacaccc ccaccctgc 19

Claims

1. A biomarker of esophageal cancer, wherein the biomarker is at least one of HOXD1 gene and GSX1 gene, and esophageal cancer is diagnosed by detecting the methylation level of the biomarker.

2. Use of a biomarker according to claim 1 in the manufacture of a reagent or kit for the diagnosis of oesophageal cancer.

3. A nucleic acid product comprising a pair of detection primers for detecting the methylation level of HOXD1 gene and/or GSX1 gene.

4. The nucleic acid product of claim 3, wherein the nucleic acid product comprises a nucleic acid sequence for detecting Chr2: 176189800-176189943 region and/or Chr13: 27793590-27793770 region methylation level detection primer pair.

5. The nucleic acid product of claim 4, wherein the pair of detection primers comprises a HOXD1 methylated primer pair and a HOXD1 unmethylated primer pair, wherein the HOXD1 methylated primer pair is used for amplifying methylated Chr2: 176189800-176189943 regions, and the HOXD1 unmethylated primer pair is used for amplifying unmethylated Chr2: 176189800-176189943 areas;

and/or the detection primer pair comprises a GSX1 methylated primer pair and a GSX1 unmethylated primer pair, and the GSX1 methylated primer pair is used for amplifying methylated Chr13: 27793590-27793770, the GSX1 unmethylated primer pair is used for amplifying unmethylated Chr13: 27793590-27793770.

6. The nucleic acid product of claim 5, wherein the nucleotide sequence of the HOXD1 methylation primer pair is set forth in SEQ ID NO: 1 to SEQ ID NO: 2 is shown in the specification; and/or, the nucleotide sequence of the HOXD1 unmethylated primer pair is as shown in SEQ ID NO: 3 to SEQ ID NO: 4 is shown in the specification;

and/or the nucleotide sequence of the GSX1 methylation primer pair is shown as SEQ ID NO: 5 to SEQ ID NO: 6 is shown in the specification; and/or, the nucleotide sequence of the GSX1 unmethylated primer pair is shown in SEQ ID NO: 7 to SEQ ID NO: shown in fig. 8.

7. The nucleic acid product of any one of claims 3 to 6, further comprising an internal reference primer pair.

8. The nucleic acid product of claim 7, wherein the nucleotide sequence of the internal reference primer pair is as set forth in SEQ ID NO: 9 to SEQ ID NO: shown at 10.

9. A kit for diagnosing oesophageal cancer comprising a nucleic acid product according to any one of claims 3 to 8.

10. The kit of claim 9, further comprising at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control, a PCR reaction reagent, and a sequencing reagent.