CN117587124A

CN117587124A - Detection reagent and kit for diagnosing pancreatic cancer and application thereof

Info

Publication number: CN117587124A
Application number: CN202210980864.9A
Authority: CN
Inventors: 张燕; 张良禄; 董兰兰; 吴悦茨; 吴志诚; 赵巴丽
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-08-16
Filing date: 2022-08-16
Publication date: 2024-02-23

Abstract

The application relates to a detection reagent and a kit for diagnosing pancreatic cancer and application thereof. The detection reagent or the kit can diagnose or assist in diagnosing pancreatic cancer by detecting the methylation level of the full length or partial region of the Chr6:30171742 ～ 30172465, and has high sensitivity and specificity.

Description

Detection reagent and kit for diagnosing pancreatic cancer and application thereof

Technical Field

The application relates to the technical field of biomedicine, in particular to a detection reagent and a kit for diagnosing pancreatic cancer and application thereof.

Background

Pancreatic cancer is a malignant tumor originating from pancreatic ductal epithelium and acinar cells, and has hidden onset, rapid progress and extremely high malignancy, and is one of the worst malignant tumors, and pancreatic ductal adenocarcinoma accounts for more than 90% of pancreatic cancers. In recent years, the incidence and mortality of pancreatic cancer have been on the rise worldwide. Pancreatic cancer is difficult to diagnose in the early stages due to early asymptomatic and lack of effective diagnostic methods, and most patients have metastasized when they first find cancer, thereby missing optimal treatment opportunities. The low survival rate of pancreatic cancer has not improved significantly over the last 40 years. Therefore, if pancreatic cancer can be found at an early stage, the operation rate can be improved, and the survival rate and the quality of life of patients can be improved.

Currently, diagnosis of pancreatic cancer relies mainly on imaging examinations such as Computed Tomography (CT), magnetic Resonance Imaging (MRI), positron emission computed tomography (PET), endoscopic Ultrasound (EUS), etc. Among them, computed Tomography (CT) is the most commonly used method for diagnosing and staging pancreatic cancer, and puncture biopsy is performed on pancreatic site-occupying lesions under endoscopic ultrasound, which is beneficial for identifying benign and malignant lesions. In view of the above-described methods or the risk of nephrotoxicity due to iodine contrast agents, or the radiometric or invasive procedures, there is a great need for convenient, non-radiometric, highly sensitive, highly specific, non-invasive pancreatic cancer screening and diagnosis methods. The diagnosis method of some blood tumor markers can partially meet the requirements of convenient, non-radiative and minimally invasive detection, such as tumor markers related to pancreatic cancer diagnosis in clinical practice, such as CA19-9, CEA, CA125 and the like. The serum marker CA19-9 can be used for auxiliary diagnosis, recurrence monitoring and the like of pancreatic cancer, and has a certain clinical application value. However, about 10% of patients with pancreatic cancer do not express CA19-9 protein, and some patients with biliary tract infection or biliary tract obstruction also have elevated CA19-9, so diagnosis or auxiliary diagnosis of pancreatic cancer using blood CA19-9 level has a large limitation, and sensitivity and specificity are low.

Therefore, there is an urgent need for a highly sensitive, highly specific blood marker for pancreatic cancer diagnosis or auxiliary diagnosis.

Disclosure of Invention

Based on this, it is necessary to provide a detection reagent and a kit for diagnosing pancreatic cancer with high sensitivity and high specificity for diagnosing pancreatic cancer, particularly for early diagnosis of pancreatic cancer.

The specific technical scheme is as follows:

in a first aspect of the present application, there is provided a detection reagent for diagnosing pancreatic cancer, the detection reagent comprising a reagent capable of specifically detecting the methylation level of a target region in a sample of a subject, the target region comprising the full length or a partial region of Chr6:30171742 ～ 30172465, with reference to grch 38.p14.

In one embodiment, the target area includes area 1 and/or area 2:

the region 1 is a Chr6:30171779-30172465 positive strand;

the region 2 is the Chr6:30171742-30172444 negative strand.

In one embodiment, the target region includes one or more of regions 3-12:

the region 3 is a Chr6:30171780-30171930 positive strand;

the region 4 is a Chr6:30171845-30172007 positive strand;

the region 5 is Chr6:30172016-30172123, positive strand;

The region 6 is Chr6:30172107-30172226, positive strand;

the region 7 is Chr6:30172340-30172463, positive strand;

the region 8 is the Chr6:30172289-30172444 negative strand;

the region 9 is Chr6:30172197-30172309, negative strand;

the region 10 is Chr6:30172090-30172190, negative strand;

the region 11 is Chr6:30171924-30172044, negative strand;

the region 12 is the Chr6:30171783-30171879 negative strand.

In one embodiment, the reagent enables detection of the methylation level of the target region by one or more of the following methods:

methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and methylation fluorescent quantitative PCR.

In one embodiment, the reagent comprises a primer pair that detects the methylation level of the target region; or further comprises a detection probe for detecting the target region.

In one embodiment, the reagent comprises a methylation primer pair and a non-methylation primer pair that detect the methylation level of the region 1 and/or the region 2:

The nucleotide sequences of the methylation primer pair of the methylation level of the detection region 1 are shown as SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequences of the non-methylation primer pair are shown as SEQ ID NO.9 and SEQ ID NO. 10;

the nucleotide sequences of the methylation primer pairs of the methylation level of the detection region 2 are shown as SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequences of the unmethylated primer pairs are shown as SEQ ID NO.13 and SEQ ID NO. 14.

In one embodiment, the reagent comprises a primer pair that detects the methylation level of one or more of regions 3-12 and its corresponding detection probe:

the nucleotide sequences of the primer pair of the methylation level of the detection region 3 are shown as SEQ ID NO.35 and SEQ ID NO.36, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 37;

the nucleotide sequences of the primer pair of the methylation level of the detection region 4 are shown as SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 40;

the nucleotide sequences of the primer pair of the methylation level of the detection region 5 are shown as SEQ ID NO.41 and SEQ ID NO.42, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 43;

the nucleotide sequences of the primer pair of the methylation level of the detection region 6 are shown as SEQ ID NO.44 and SEQ ID NO.45, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 46;

The nucleotide sequences of the primer pair of the methylation level of the detection region 7 are shown as SEQ ID NO.47 and SEQ ID NO.48, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 49;

the nucleotide sequences of the primer pair of the methylation level of the detection region 8 are shown as SEQ ID NO.50 and SEQ ID NO.51, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 52;

the nucleotide sequences of the primer pair of the methylation level of the detection region 9 are shown as SEQ ID NO.53 and SEQ ID NO.54, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 55;

the nucleotide sequences of the primer pair of the methylation level of the detection region 10 are shown as SEQ ID NO.56 and SEQ ID NO.57, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 58;

the nucleotide sequences of the primer pair of the methylation level of the detection region 11 are shown as SEQ ID NO.59 and SEQ ID NO.60, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 61;

the nucleotide sequences of the primer pair of the methylation level of the detection region 12 are shown as SEQ ID NO.62 and SEQ ID NO.63, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 64.

In one embodiment, the sample comprises a blood sample, a tissue sample, or a cell sample.

In a second aspect of the present application, there is provided a kit for diagnosing pancreatic cancer, the kit comprising the detection reagent of any one of the above.

In one embodiment, the kit further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a nucleic acid purification reagent, a PCR reaction reagent, a sequencing reagent, and a quality control.

In a third aspect of the present application there is provided the use of an agent capable of specifically detecting the methylation level of a target region in a sample of a subject, said target region comprising the full length or partial region of Chr6:30171742-30172465, with reference to grch38.p14, in the manufacture of a diagnostic product for pancreatic cancer.

Compared with the prior art, the application has the following beneficial effects:

the detection reagent and the kit for diagnosing pancreatic cancer provided by the application detect the methylation level of the full length or partial region of the Chr6:30171742 ～ 30172465, can be used for diagnosing or assisting in diagnosing pancreatic cancer, have the sensitivity range of 73.53% -86.76% for detecting a blood sample and the specificity range of 92.05% -97.73%, have higher sensitivity and specificity, and have important significance for early treatment of pancreatic cancer and improvement of survival rate of patients.

Drawings

FIG. 1 is an ROC curve of a blood sample for diagnosing pancreatic cancer and a blood sample for healthy persons in regions 3-12.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Interpretation of the terms

The term "and/or" and/or "is intended to include any and all combinations of one or more of the associated listed items.

The term "plurality" refers to two or more; "plurality of" means two or more; "above" in combination with a number means that the number is included, for example, "two or more" includes two.

The term "diagnosis" includes auxiliary diagnosis, recurrence risk assessment, assessment of risk and extent of cancerous lesions, prognosis, and the like.

The term "gene" refers to a segment of DNA encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, as well as exon and intron sequences involved in gene transcription/translation and transcriptional/translational regulation.

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified.

The term "Taqman probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

The term "sanger sequencing", i.e., a generation of sequencing, the reaction system comprises: target fragment, four deoxyribonucleotides (dNTPs), DNA polymerase, primer, etc., and 4 kinds of dideoxyribonucleotides (ddNTPs) marked by different fluorophores are required. Because ddNTP lacks 3' -OH group required for extension, the extended oligonucleotide is selectively terminated at G, A, T or C, and the four optical wavelength signals are converted into computer recognizable electric signals through optical excitation, and the target DNA sequence is judged according to the fluorescence signal of the ddNTP finally doped in the reaction tube.

The term "methylation-specific PCR" is one of the most sensitive experimental techniques currently studied for methylation, and a minimum of about 50pg of DNA methylation can be found. After the single-stranded DNA is subjected to bisulfite conversion, all unmethylated cytosines are deaminated to uracil, and methylated cytosines in CpG sites are kept unchanged, so that two pairs of primers aiming at methylated and unmethylated sequences are respectively designed, and the methylated and unmethylated DNA sequences can be distinguished through PCR amplification. In the present disclosure, methylation primers are added when performing real-time quantitative methylation-specific PCR, and if the Ct value meets the requirement (e.g., ct.ltoreq.38 in a tissue sample), it indicates that the target sequence is methylated.

The term "AUC" is an abbreviation for "area under the curve". Specifically, it refers to the area under the Receiver Operating Characteristic (ROC) curve. ROC curves are graphs of true positive versus false positive rates for different possible cut points of a diagnostic test. Depending on the trade-off between sensitivity and specificity of the selected cut point (any increase in sensitivity will be accompanied by a decrease in specificity). The area under the ROC curve (AUC) is a measure of the accuracy of the diagnostic test (the larger the area the better; the best value is 1; the random test will have the ROC curve lying on the diagonal with an area of 0.5).

The method detects the methylation level of DNA of the TRIM15 gene located in the Chr6:30171742-30172465 region in a subject sample by a bisulfite sequencing method or a fluorescence quantitative methylation specific PCR method, is used for noninvasive or minimally invasive diagnosis of pancreatic cancer, and has high sensitivity and specificity.

Accordingly, one embodiment of the present application provides a test agent for diagnosing pancreatic cancer comprising an agent capable of specifically detecting the methylation level of a target region in a biological sample, the target region comprising the full length or partial region of Chr6: 30171742-30172465.

In one specific example, the target area includes area 1 and/or area 2; specifically, region 1 is Chr6:30171779-30172465 (plus strand), and region 2 is Chr6:30171742-30172444 (minus strand).

In one specific example, the methylation level of a target region can be detected using a bisulfite sequencing method, wherein region 1 diagnoses pancreatic cancer with a sensitivity of 84.42% and a specificity of 94.57%; region 2 diagnosed pancreatic cancer with a sensitivity of 81.08% and a specificity of 93.41%. In one specific example, the target region includes one or more of regions 3-12; specifically, region 3 is the Chr6:30171780-30171930 plus strand; region 4 is Chr6:30171845-30172007, plus strand; region 5 is Chr6:30172016-30172123, plus strand; region 6 is Chr6:30172107-30172226, plus strand; region 7 is Chr6:30172340-30172463, plus strand; region 8 is Chr6:30172289-30172444, negative strand; region 9 is Chr6:30172197-30172309, negative strand; region 10 is Chr6:30172090-30172190, negative strand; region 11 is Chr6:30171924-30172044, negative strand; region 12 is the Chr6:30171783-30171879 minus strand.

In a specific example, methylation levels of a target region can be detected using methylation fluorescent quantitative PCR, wherein regions 3-12 are each more than 75% sensitive to pancreatic cancer, are each more than 91% specific to diagnosis, and have an area under ROC curve (AUC) value of greater than 0.83.

Preferably, region 5 and region 10 are optimally diagnosed with an AUC value of the ROC curve of greater than 0.9, wherein region 5 is diagnosed with pancreatic cancer blood sample with a sensitivity of 85.7% and a specificity of 97.1%; the sensitivity of the region 10 for diagnosing pancreatic cancer blood samples was 88.3% and the specificity was 95.1%.

It should be noted that, unless otherwise specified, the positions on the chromosome are all referred to as grch 38.p14; further, since the DNA on the chromosome is a double-stranded structure composed of a positive strand and a negative strand, if the region indicated by the chromosomal location is not specified as a positive strand or a negative strand of the DNA, it means that the region may be either a positive strand or a negative strand of the DNA of the region or both the positive and negative strands of the DNA of the region. For example, if the region Chr6:30171742 ～ 30172465 is described as "Chr6:30171742 ～ 30172465", it is intended that the DNA may be either a positive strand of DNA in the region Chr6:30171742 ～ 30172465, a negative strand of DNA in the region Chr6:30171742 ～ 30172465, or both positive and negative strands of DNA in the region Chr6:30171742 ～ 30172465.

In a specific example, the sample may be selected from a blood sample, a tissue sample, or a cell sample, and may be other biological samples such as a urine sample, a saliva sample, and the like.

In a specific example, the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and methylation fluorescent quantitative PCR.

In one specific example, the reagent includes a primer pair that detects the methylation level of the target region; detection probes for detecting a target region may also be included.

In a specific example, the reagent comprises a methylation primer pair and a non-methylation primer pair that detect the methylation level of region 1 and/or region 2: the nucleotide sequences of the methylation primer pairs in the detection region 1 are shown as SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequences of the non-methylation primer pairs are shown as SEQ ID NO.9 and SEQ ID NO. 10; the nucleotide sequences of the methylation primer pairs of the methylation level of the detection region 2 are shown as SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequences of the unmethylated primer pairs are shown as SEQ ID NO.13 and SEQ ID NO. 14.

In another specific example, the reagent comprises a primer pair that detects the methylation level of one or more of regions 3-12 and its corresponding detection probe; specifically, the nucleotide sequence of the primer pair of the methylation level of the detection region 3 is shown as SEQ ID NO.35 and SEQ ID NO.36, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 37; the nucleotide sequences of the primer pair of the methylation level of the detection region 4 are shown as SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 40; the nucleotide sequences of the primer pair of the methylation level of the detection region 5 are shown as SEQ ID NO.41 and SEQ ID NO.42, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 43; the nucleotide sequences of the primer pair of the methylation level of the detection region 6 are shown as SEQ ID NO.44 and SEQ ID NO.45, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 46; the nucleotide sequences of the primer pair of the methylation level of the detection region 7 are shown as SEQ ID NO.47 and SEQ ID NO.48, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 49; the nucleotide sequences of the primer pair of the methylation level of the detection region 8 are shown as SEQ ID NO.50 and SEQ ID NO.51, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 52; the nucleotide sequences of the primer pair of the methylation level of the detection region 9 are shown as SEQ ID NO.53 and SEQ ID NO.54, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 55; the nucleotide sequences of the primer pair of the methylation level of the detection region 10 are shown as SEQ ID NO.56 and SEQ ID NO.57, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 58; the nucleotide sequences of the primer pair of the methylation level of the detection region 11 are shown as SEQ ID NO.59 and SEQ ID NO.60, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 61; the nucleotide sequences of the primer pair of the methylation level of the detection region 12 are shown as SEQ ID NO.62 and SEQ ID NO.63, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 64.

Further, still another embodiment of the present application provides a kit for diagnosing pancreatic cancer, which includes the detection reagent of any one of the above.

In a specific example, the kit further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a nucleic acid purification reagent, a PCR reaction reagent, a sequencing reagent, a quality control. The nucleic acid extraction reagent is used for extracting nucleic acid molecules in a sample. Methylation converting reagents are used to deaminate unmethylated cytosines in DNA to uracil while methylated cytosines remain unchanged; alternatively, the methylation conversion reagent comprises bisulphite. Nucleic acid purification reagents are used for the purification of nucleic acid molecules. The PCR reaction reagents may include amplification buffers, dNTPs, DNA polymerase and Mg ²⁺ For PCR detection. Sequencing reagents are used for sequencing. The quality control product is used for quality control, such as a positive quality control product and a negative quality control product. Optionally, the kit may further comprise controls, such as positive controls and negative controls. Optionally, the kit may further comprise an internal reference gene including ACTB.

In addition, an embodiment of the present application also provides a method for diagnosing pancreatic cancer by detecting the methylation level of a target region in a sample of a subject. Specifically, the target region is as described above.

In one specific example, the methylation level of a target region in a sample of a subject (a sample of the subject such as a blood sample, a cell sample, or a tissue sample) is detected, and if the methylation level of the target region in the sample of the subject is significantly higher than in a sample of a healthy person, the subject is considered to have pancreatic cancer, and the method diagnoses pancreatic cancer with high sensitivity and specificity.

In one specific example, the methylation level of a target region in a sample of a subject (e.g., a sample of a subject such as a blood sample, a cell sample, or a tissue sample) is detected, a delta Ct value is calculated for amplifying all sample target regions, and the methylation state of the sample in the target region is determined based on the delta Ct value. Specifically, the target region is as described above.

The specific judgment standard is as follows: if the delta Ct value of a certain sample is smaller than or equal to the cut-off value, determining that the sample is positive for methylation in the area, namely, pancreatic cancer is positive; if the delta Ct value of a certain sample is larger than the cut-off value, the sample is methylation negative, namely pancreatic cancer negative is judged. Wherein the cutoff value can be determined by ROC curve analysis of a training set sample of pancreatic cancer. Preferably, the cut-off value of each region is as shown in table 11. The method diagnosis has high sensitivity and specificity.

Still further, an embodiment of the present application provides the use of an agent capable of specifically detecting the methylation level of a target region in a sample of a subject, including the full length or partial region of Chr6:30171742-30172465, with reference to grch38.p14, in the preparation of a diagnostic product for pancreatic cancer.

In one specific example, diagnostic products include, but are not limited to, reagents, kits, test strips, diagnostic systems, and the like for diagnosing pancreatic cancer. Wherein the diagnostic system comprises a detection portion and an analysis portion. The detection section detects the methylation level of the target region, and the analysis section analyzes the methylation level and judges whether or not pancreatic cancer is present.

Pancreatic cancer referred to in this application is referred to as pancreatic ductal adenocarcinoma.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

Embodiments of the present application will be described in detail below with reference to examples. It should be understood that these examples are illustrative only of the present application and are not intended to limit the scope of the present application. The experimental methods, in which specific conditions are not noted in the following examples, are preferably referred to in the guidelines given in the present application, may be according to the experimental manual or conventional conditions in the art, may be according to the conditions suggested by the manufacturer, or may be referred to experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Example 1

The methylation level of DNA of TRIM15 gene located in the Chr6:30171742-30172465 region and the pancreatic cancer diagnosis performance of the pancreatic cancer tissue samples are analyzed by a bisulfite sequencing method.

1. Sample collection

86 tissue samples diagnosed with pancreatic cancer by pathology biopsy and 102 anticoagulated blood samples of healthy people who were subjected to routine physical examination were collected in total. Pancreatic tissue samples were formalin-immersed and paraffin-embedded tissues. All samples were collected by ethical committee approval and all volunteers signed informed consent.

2. Extraction of sample DNA

For pancreatic tissue samples, QIAamp DNA FFPE Tissue Kit (Cat: 56404) was used to extract tissue DNA, see kit instructions for specific procedures.

For anticoagulated blood samples, after centrifugation, the leukocyte layer was taken for extraction of genomic DNA. The extraction of the genomic DNA of the leucocytes is carried out by using a centrifugal column type blood/cell/tissue genomic DNA extraction kit (DP 304) of Tiangen biochemical technology (Beijing) limited company, and the specific operation is described in the specification of the kit.

3. Transformation and purification of sample DNA

The kit for the transformation and purification of the sample DNA is a nucleic acid transformation reagent (20200843) of the life technology limited company of Wuhan Ai Misen, and the specific operation steps are described in the specification of the kit.

PCR amplification and sequencing

The DNA molecule of TRIM15 gene in the region of chr6:30171742-30172465 is used as a reference sequence, and the positive strand and the negative strand of the DNA molecule in the region after bisulfite conversion are respectively used as templates, so that a sequencing primer is designed. The sequencing primer comprises a methylation sequencing primer and a non-methylation sequencing primer, and the sequencing primer is used for amplifying a methylated template and a non-methylated template respectively. The ratio of the methylation primer pair to the unmethylation primer pair is screened to ensure that the methylation primer pair and the unmethylation primer pair are added into a PCR reaction system simultaneously, when the methylation sequence is more than or equal to 1% in the template, a methylated product can be obtained by amplification, and only when the template is the unmethylation sequence, the amplified product is the unmethylated product. TRIM15 gene is located in the chr6:30171779-30172465 region (region 1) and the positive strand DNA sequence is shown as SEQ ID NO.1, the fully methylated sequence of the region is shown as SEQ ID NO.2 after bisulfite conversion, and the fully unmethylated sequence of the region is shown as SEQ ID NO.3 after bisulfite conversion. TRIM15 gene is located in the Chr6:30171742-30172444 region (region 2) and has a negative strand DNA sequence shown as SEQ ID NO.4, the fully methylated sequence of the region is shown as SEQ ID NO.5 after bisulfite conversion, and the fully unmethylated sequence of the region is shown as SEQ ID NO.6 after bisulfite conversion.

SEQ ID NO.1:

GGAACATCTGTGGTTGCCGCCCGCTGTTGATGTCTGCGCGCTCCTCCCTCTAGGGGTCATCACTCTGGACCCTCAGACCGCCAGCCGGAGCCTGGTTCTCTCGGAAGACAGGAAGTCAGTGAGGTACACCCGGCAGAAGAAGAGCCTGCCAGACAGCCCCCTGCGCTTCGACGGCCTCCCGGCGGTTCTGGGCTTCCCGGGCTTCTCCTCCGGGCGCCACCGCTGGCAGGTTGACCTGCAGCTGGGCGACGGCGGCGGCTGCACGGTGGGGGTGGCCGGGGAGGGGGTGAGGAGGAAGGGAGAGATGGGACTCAGCGCCGAGGACGGCGTCTGGGCCGTGATCATCTCGCACCAGCAGTGCTGGGCCAGCACCTCCCCGGGCACCGACCTGCCGCTGAGCGAGATCCCGCGCGGCGTGAGAGTCGCCCTGGACTACGAGGCGGGGCAGGTGACCCTCCACAACGCCCAGACCCAGGAGCCCATCTTCACCTTCACTGCCTCTTTCTCCGGCAAAGTCTTCCCTTTCTTTGCCGTCTGGAAAAAAGGTTCCTGCCTTACGCTGAAAGGCTGAAGTGGGGCGCGCGAAGGGCGGCGAAGCGGAGACGGCGGCTCTCCGGGATCCAGCTCCGCCCCTGGCCAGTGTGCGGCCCGGGGGCTCCCTGTGCCCGCGTGAGGCGAGAGAACAGG。

SEQ ID NO.2:

GGAATATTTGTGGTTGTCGTTCGTTGTTGATGTTTGCGCGTTTTTTTTTTTAGGGGTTATTATTTTGGATTTTTAGATCGTTAGTCGGAGTTTGGTTTTTTCGGAAGATAGGAAGTTAGTGAGGTATATTCGGTAGAAGAAGAGTTTGTTAGATAGTTTTTTGCGTTTCGACGGTTTTTCGGCGGTTTTGGGTTTTTCGGGTTTTTTTTTCGGGCGTTATCGTTGGTAGGTTGATTTGTAGTTGGGCGACGGCGGCGGTTGTACGGTGGGGGTGGTCGGGGAGGGGGTGAGGAGGAAGGGAGAGATGGGATTTAGCGTCGAGGACGGCGTTTGGGTCGTGATTATTTCGTATTAGTAGTGTTGGGTTAGTATTTTTTCGGGTATCGATTTGTCGTTGAGCGAGATTTCGCGCGGCGTGAGAGTCGTTTTGGATTACGAGGCGGGGTAGGTGATTTTTTATAACGTTTAGATTTAGGAGTTTATTTTTATTTTTATTGTTTTTTTTTTCGGTAAAGTTTTTTTTTTTTTTGTCGTTTGGAAAAAAGGTTTTTGTTTTACGTTGAAAGGTTGAAGTGGGGCGCGCGAAGGGCGGCGAAGCGGAGACGGCGGTTTTTCGGGATTTAGTTTCGTTTTTGGTTAGTGTGCGGTTCGGGGGTTTTTTGTGTTCGCGTGAGGCGAGAGAATAGG。

SEQ ID NO.3:

GGAATATTTGTGGTTGTTGTTTGTTGTTGATGTTTGTGTGTTTTTTTTTTTAGGGGTTATTATTTTGGATTTTTAGATTGTTAGTTGGAGTTTGGTTTTTTTGGAAGATAGGAAGTTAGTGAGGTATATTTGGTAGAAGAAGAGTTTGTTAGATAGTTTTTTGTGTTTTGATGGTTTTTTGGTGGTTTTGGGTTTTTTGGGTTTTTTTTTTGGGTGTTATTGTTGGTAGGTTGATTTGTAGTTGGGTGATGGTGGTGGTTGTATGGTGGGGGTGGTTGGGGAGGGGGTGAGGAGGAAGGGAGAGATGGGATTTAGTGTTGAGGATGGTGTTTGGGTTGTGATTATTTTGTATTAGTAGTGTTGGGTTAGTATTTTTTTGGGTATTGATTTGTTGTTGAGTGAGATTTTGTGTGGTGTGAGAGTTGTTTTGGATTATGAGGTGGGGTAGGTGATTTTTTATAATGTTTAGATTTAGGAGTTTATTTTTATTTTTATTGTTTTTTTTTTTGGTAAAGTTTTTTTTTTTTTTGTTGTTTGGAAAAAAGGTTTTTGTTTTATGTTGAAAGGTTGAAGTGGGGTGTGTGAAGGGTGGTGAAGTGGAGATGGTGGTTTTTTGGGATTTAGTTTTGTTTTTGGTTAGTGTGTGGTTTGGGGGTTTTTTGTGTTTGTGTGAGGTGAGAGAATAGG。

SEQ ID NO.4:

GGCACAGGGAGCCCCCGGGCCGCACACTGGCCAGGGGCGGAGCTGGATCCCGGAGAGCCGCCGTCTCCGCTTCGCCGCCCTTCGCGCGCCCCACTTCAGCCTTTCAGCGTAAGGCAGGAACCTTTTTTCCAGACGGCAAAGAAAGGGAAGACTTTGCCGGAGAAAGAGGCAGTGAAGGTGAAGATGGGCTCCTGGGTCTGGGCGTTGTGGAGGGTCACCTGCCCCGCCTCGTAGTCCAGGGCGACTCTCACGCCGCGCGGGATCTCGCTCAGCGGCAGGTCGGTGCCCGGGGAGGTGCTGGCCCAGCACTGCTGGTGCGAGATGATCACGGCCCAGACGCCGTCCTCGGCGCTGAGTCCCATCTCTCCCTTCCTCCTCACCCCCTCCCCGGCCACCCCCACCGTGCAGCCGCCGCCGTCGCCCAGCTGCAGGTCAACCTGCCAGCGGTGGCGCCCGGAGGAGAAGCCCGGGAAGCCCAGAACCGCCGGGAGGCCGTCGAAGCGCAGGGGGCTGTCTGGCAGGCTCTTCTTCTGCCGGGTGTACCTCACTGACTTCCTGTCTTCCGAGAGAACCAGGCTCCGGCTGGCGGTCTGAGGGTCCAGAGTGATGACCCCTAGAGGGAGGAGCGCGCAGACATCAACAGCGGGCGGCAACCACAGATGTTCCTAGAGCAGGCAACGCACGTGGGAGGCAGAAGGAGTAC。

SEQ ID NO.5:

GGTATAGGGAGTTTTCGGGTCGTATATTGGTTAGGGGCGGAGTTGGATTTCGGAGAGTCGTCGTTTTCGTTTCGTCGTTTTTCGCGCGTTTTATTTTAGTTTTTTAGCGTAAGGTAGGAATTTTTTTTTTAGACGGTAAAGAAAGGGAAGATTTTGTCGGAGAAAGAGGTAGTGAAGGTGAAGATGGGTTTTTGGGTTTGGGCGTTGTGGAGGGTTATTTGTTTCGTTTCGTAGTTTAGGGCGATTTTTACGTCGCGCGGGATTTCGTTTAGCGGTAGGTCGGTGTTCGGGGAGGTGTTGGTTTAGTATTGTTGGTGCGAGATGATTACGGTTTAGACGTCGTTTTCGGCGTTGAGTTTTATTTTTTTTTTTTTTTTTATTTTTTTTTCGGTTATTTTTATCGTGTAGTCGTCGTCGTCGTTTAGTTGTAGGTTAATTTGTTAGCGGTGGCGTTCGGAGGAGAAGTTCGGGAAGTTTAGAATCGTCGGGAGGTCGTCGAAGCGTAGGGGGTTGTTTGGTAGGTTTTTTTTTTGTCGGGTGTATTTTATTGATTTTTTGTTTTTCGAGAGAATTAGGTTTCGGTTGGCGGTTTGAGGGTTTAGAGTGATGATTTTTAGAGGGAGGAGCGCGTAGATATTAATAGCGGGCGGTAATTATAGATGTTTTTAGAGTAGGTAACGTACGTGGGAGGTAGAAGGAGTAT。

SEQ ID NO.6:

GGTATAGGGAGTTTTTGGGTTGTATATTGGTTAGGGGTGGAGTTGGATTTTGGAGAGTTGTTGTTTTTGTTTTGTTGTTTTTTGTGTGTTTTATTTTAGTTTTTTAGTGTAAGGTAGGAATTTTTTTTTTAGATGGTAAAGAAAGGGAAGATTTTGTTGGAGAAAGAGGTAGTGAAGGTGAAGATGGGTTTTTGGGTTTGGGTGTTGTGGAGGGTTATTTGTTTTGTTTTGTAGTTTAGGGTGATTTTTATGTTGTGTGGGATTTTGTTTAGTGGTAGGTTGGTGTTTGGGGAGGTGTTGGTTTAGTATTGTTGGTGTGAGATGATTATGGTTTAGATGTTGTTTTTGGTGTTGAGTTTTATTTTTTTTTTTTTTTTTATTTTTTTTTTGGTTATTTTTATTGTGTAGTTGTTGTTGTTGTTTAGTTGTAGGTTAATTTGTTAGTGGTGGTGTTTGGAGGAGAAGTTTGGGAAGTTTAGAATTGTTGGGAGGTTGTTGAAGTGTAGGGGGTTGTTTGGTAGGTTTTTTTTTTGTTGGGTGTATTTTATTGATTTTTTGTTTTTTGAGAGAATTAGGTTTTGGTTGGTGGTTTGAGGGTTTAGAGTGATGATTTTTAGAGGGAGGAGTGTGTAGATATTAATAGTGGGTGGTAATTATAGATGTTTTTAGAGTAGGTAATGTATGTGGGAGGTAGAAGGAGTAT。

And respectively taking SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.6 as templates, designing a methylation sequencing primer pair and a non-methylation sequencing primer pair corresponding to the positive and negative strands of the TRIM15 gene DNA, wherein the nucleotide sequences of the sequencing primer pairs are shown in table 1.

TABLE 1 nucleotide sequences of sequencing primers

The PCR reaction was then carried out, the formulation of the PCR system is shown in Table 2, the primer pair used in the reaction system (Table 1) was biosynthesized by Shanghai worker, the template used was DNA extracted from a tissue sample or a leukocyte sample and subjected to bisulfite conversion, and the other components were purchased from TAKARA (Cat: R010A). The PCR system was placed on ice, and after the placement was completed, amplification was performed according to the reaction procedure shown in Table 3. The amplified product was sent to the company for sanger sequencing, and sequencing primers were identical to the amplification primers, including a methylation sequencing primer pair and a non-methylation sequencing primer pair.

TABLE 2 PCR reaction System

Component (A)	Dosage (mu L)
		5×PrimeSTAR Buffer(Mg ²⁺ Plus)	10
dNTP Mixture(2.5mM each)	4
		Methylation upstream primer (10. Mu.M)	1
Methylation downstream primer (10. Mu.M)	1
		Unmethylated upstream primer (10. Mu.M)	0.5
Unmethylated downstream primer (10. Mu.M)	0.5
		PrimeSTAR HS DNA Polymerase	0.5
Template DNA	10
		Ultrapure water	Supplement to 50

TABLE 3 PCR amplification procedure

5. Analysis of results

For samples sequenced successfully, methylation of cytosine in CpG dinucleotides in each amplicon of each sample was analyzed. If the cytosine in the CpG dinucleotide is shown as thymine in the sequencing result, it is unmethylated, if the cytosine in the CpG dinucleotide is still shown as cytosine in the sequencing result, it is fully methylated, if the cytosine in the CpG dinucleotide is bimodal in the sequencing result, it is both cytosine and thymine, it is partially methylated. If more than 95% of the cytosine in a CpG dinucleotide in an amplicon is methylated (including both fully methylated and partially methylated), then the sample is considered methylation positive in the amplified region; otherwise, the sample is considered methylation negative in the amplified region.

The sequencing results and methylation status of 86 tissue samples and 102 healthy human leukocyte samples are shown in Table 4. Of 86 tissue samples, for region 1, a total of 77 samples were sequenced successfully; for region 2, a total of 74 samples were sequenced successfully. Of 102 healthy human leukocyte samples, for region 1, a total of 92 samples were successfully sequenced; for region 2, a total of 91 samples were sequenced successfully.

Table 4 methylation ratio of CpG sites in regions 1 and 2 in tissue samples and leukocyte samples

/>

The Sanger sequencing result shows that the methylation level of DNA of TRIM15 gene located in the Chr6:30171742-30172465 region in pancreatic cancer tissue samples is obviously higher than that of the DNA in white blood cells of healthy people.

The sensitivity and specificity of detecting pancreatic cancer tissue samples and healthy human leukocyte samples using the methylation levels of region 1, region 2, respectively, were counted according to the data in table 4. Samples used for performance analysis were all samples that were sequenced successfully. Sensitivity is the proportion of methylation positives in samples with positive pathological results, and specificity is the proportion of methylation negatives in samples with negative pathological results. Sensitivity and specificity of diagnosing pancreatic cancer tissue samples, healthy human leukocyte samples by detecting methylation levels in region 1 and region 2 using the method of sanger sequencing are shown in table 5.

TABLE 5 Performance of bisulfite sequencing to detect pancreatic cancer tissue samples

As can be seen from Table 5, by using the method of Sanger sequencing, pancreatic cancer tissue samples and healthy human leukocyte samples can be effectively distinguished by detecting the methylation levels of the positive and negative strands of DNA of the TRIM15 gene located in the region of Chr6: 30171742-30172465. Specifically, the sensitivity of detecting pancreatic cancer tissue samples in the region 1 is 84.42%, and the specificity of detecting healthy human leucocyte samples is 94.57%; the sensitivity of detecting pancreatic cancer tissue samples in the region 2 is 81.08%, and the specificity of detecting healthy human leucocyte samples is 93.41%.

Example 2

The performance of pancreatic cancer diagnosis of the TRIM15 gene in the Chr6:30171742-30172465 region in the plasma samples is analyzed by a fluorescence quantitative methylation specific PCR method.

The embodiment provides a method for detecting methylation level of a subregion of a Chr6:30171742-30172465 region in a blood sample based on a fluorescence quantitative methylation specific PCR (qMSP), wherein the methylation state of the blood sample can be judged according to a Ct value, so that whether the sample is a cancer sample or not is judged. The specific experimental procedure and detection effect are as follows:

The data used in this embodiment is used as a training set.

1. Sample collection

Collection of blood samples from pancreatic cancer patients: a total of 77 blood samples were collected from patients diagnosed with pancreatic cancer by tissue biopsy, each of which was collected at about 10mL. All blood samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.

The healthy human anticoagulated blood sample collected in example 1 was used as a control for the plasma sample of pancreatic cancer patients, and was collected as in example 1.

2. Extraction of sample DNA

After centrifugation of the anticoagulated blood sample collected in example 1, a plasma layer was collected for extraction of plasma free DNA. Plasma cfDNA extraction was performed using the magnetic bead serum/plasma free DNA (cfDNA) extraction kit (DP 709) from the company of the biochemical technology of the root of the chinese day (beijing), the specific procedure being according to the kit instructions.

3. The transformation and purification steps of the sample DNA were the same as in example 1.

4. Fluorescent quantitative methylation-specific PCR

Since the plasma cfDNA fragment is short and enriched at 170bp, and also considering the amplification efficiency of fluorescent quantitative PCR, in this example, it is difficult to directly amplify the full-length region of TRIM15 gene at chr6:30171742-30172465 position in the plasma sample. Therefore, the region of the TRIM15 gene in the Ch6: 30171742-30172465 is divided into a plurality of sub-regions (the DNA fragment length of each sub-region is not more than 170 bp), and the methylation state of each sample in each sub-region is detected respectively, so that the cancerous and healthy samples are distinguished.

For each subregion, a sequence converted by bisulphite is used as a template, a primer pair and a detection probe for amplifying each subregion are respectively designed, and the methylation state of each sample in each subregion is detected by a qMSP method. The TRIM15 gene was located in the subregion of Chr6:30171742-30172465 and the bisulfite-converted sequence is shown in Table 6. It will be appreciated that the region of the TRIM15 gene that is located in the region of Chr6:30171742-30172465 may be other regions located in this region not listed. The nucleotide sequences of the primer pair and probe used for amplifying and detecting each of the subregions are shown in Table 7, and the methylated cytosine sites recognized by the detection primer pair and probe are shown in Table 8.

TABLE 6 TRIM15 Gene located in the subregion sequence of Chr6:30171742-30172465

/>

TABLE 7 nucleotide sequences of primer pairs and detection probes for amplifying and detecting respective subregions

Table 8, detection primer pairs for subregions and methylated cytosine sites recognizable by detection probes

/>

In the qMSP reaction, the formulation of the PCR reaction system is shown in Table 9, the primer pair and the detection probe used in the reaction system were biosynthesized by Shanghai worker, the template used was DNA extracted from plasma sample and converted by bisulfite, and the other components were all purchased from Invitrogen (Cat: 14966005). As can be seen from Table 9, in each PCR tube, in addition to the primer set and the detection probe for the target region, the primer set and the detection probe for the internal reference gene ACTB were added. The detection probes are TaqMan probes, the fluorescent reporter group at the 5 '-end of the detection probe of the target area is FAM, the fluorescent quenching group at the 3' -end of the detection probe of the target area is MGB, the fluorescent reporter group at the 5 '-end of the detection probe of the ACTB gene is VIC, and the fluorescent quenching group at the 3' -end of the detection probe of the ACTB gene is BHQ-1. After completion of the PCR reaction system configuration, amplification was performed according to the reaction procedure shown in Table 10.

TABLE 9 qMSP reaction System

Table 10, qMSP reaction procedure

Negative control tube: for each subregion, the qMSP reaction system was configured according to the formulation of table 9, but the template was TE buffer.

Positive control tube: for each subregion, the qMSP reaction system was configured according to the recipe of table 9, but the template was a synthetic plasmid containing ACTB (post-transformation sequence) and the target region. The preparation method of the positive control template comprises the following steps: cloning the bisulphite converted sequence of ACTB gene and the corresponding sequences of SEQ ID No. 25-SEQ ID No.34 onto pUC57 to form artificial plasmids, and diluting the plasmids to 10 ³ Copy/microliter. The positive control templates as in region 3 were: 10 ³ Copy/microliter of plasmid containing post-transformation ACTB gene and 10 ³ Copy/microliter of plasmid 1:1 containing SEQ ID No. 25.

Ct value reading: after qPCR reaction is finished, the baseline can be manually adjusted, the fluorescence intensity value corresponding to 10 times of the standard deviation of the baseline fluorescence value is set as a threshold value, a threshold line is a straight line which passes through the threshold value and is parallel to the X axis, the straight line is required to be positioned in the exponential amplification period, and the cycle number corresponding to the intersection point of the threshold line and the amplification curve is the Ct value.

And (3) quality control: the negative control needs no amplification, the positive control needs a significant exponential growth period, and the Ct value of the positive control is between 26 and 30. The Ct value of the reference gene of the sample to be detected is less than or equal to 33, and after the negative control, the positive control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.

qMSP results analysis

Delta Ct = Ct (region of interest) -Ct (ACTB) was defined, delta Ct values were calculated for all sample individual sub-regions amplified, and then subject operating curve characterization (ROC) analysis was performed using SPSS 22.0 software. Specifically, the state variable of the pancreatic cancer plasma sample was set to "1", the state variable of the healthy human plasma sample was set to "0", the "analysis" - "ROC graph" was clicked, the values of the test variable and the state variable were specified, the value of the state variable was set to 1, and the "smaller test result was selected to represent more definite test", the ROC analysis result was obtained, the Δct at the maximum about the mount index (sensitivity+specificity-1) was selected as the cut-off value, and the average AUC value, sensitivity and specificity value were obtained, as shown in table 11, and the ROC curves of the respective regions were shown in fig. 1.

Table 11 Performance of blood samples for detecting pancreatic cancer in region 3 to region 12

Destination area	Sensitivity of	Specificity (specificity)	AUC values	Cut-off value
					Zone 3	75.3％	92.2％	0.838	14.98
Zone 4	79.2％	94.1％	0.856	14.96
					Zone 5	85.7％	97.1％	0.920	12.92
Zone 6	83.1％	94.1％	0.887	12.85
					Zone 7	79.2％	91.2％	0.852	14.98
Zone 8	76.6％	91.2％	0.842	14.61
					Region 9	80.5％	94.1％	0.868	14.89
Region 10	88.3％	95.1％	0.915	14.94
					Region 11	83.1％	94.1％	0.889	14.85
Region 12	76.6％	92.2％	0.848	14.98

As can be seen from table 11, the performance of the pancreatic cancer blood samples in the regions 3 to 7 was good. Overall, all the subregions have a sensitivity of greater than 75% for differentiating pancreatic cancer blood samples, a specificity of diagnosis of greater than 91% and an area under ROC curve (AUC) value of greater than 0.83. Specifically, the diagnostic performance of the region 5 and the region 10 is optimal, and the AUC value of the ROC curve is more than 0.9, wherein the sensitivity of the region 5 for diagnosing pancreatic cancer blood samples is 85.7%, and the specificity is 97.1%; the sensitivity of the region 10 for diagnosing pancreatic cancer blood samples was 88.3% and the specificity was 95.1%. As can be seen, the methylation level of the TRIM15 gene in the region of chr6:30171742-30172465 can be used for effectively distinguishing pancreatic cancer blood samples from normal samples.

Example 3

The data used in this example was used as the test set.

1. Sample collection

68 blood samples were collected from patients diagnosed with pancreatic cancer by tissue biopsy, and 88 blood samples were also collected from healthy persons, each sample having a volume of greater than 8mL. All blood samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.

2. Extraction, transformation and purification of sample DNA were as in example 2.

qMSP reaction and analysis of results

The qMSP reaction was performed as described in example 2, using the bisulfite converted sample DNA as template. And calculating the delta Ct value of each sample in each subarea, and judging the methylation state of the sample in the subarea according to the delta Ct value. The specific judgment standard is as follows: if the delta Ct value of a certain sample is smaller than or equal to the cut-off value (the cut-off value of each region as shown in table 11), determining that the sample is methylation positive in the region, namely, determining that pancreatic cancer is positive; if the delta Ct value of a certain sample is larger than the cut-off value, the sample is methylation negative, namely pancreatic cancer negative is judged. The sensitivity and specificity of diagnosing pancreatic cancer blood samples by using a certain subarea are calculated according to the methylation state of the samples in the subarea. Sensitivity is the proportion of methylation positive samples in cancer patient samples, and specificity is the proportion of methylation negative samples in healthy human samples.

TABLE 12 Performance of diagnosing pancreatic cancer blood samples Using the cut-off values of regions 3 to 12

As can be seen from the data in table 12, in the test sample, the sensitivity range of detecting the blood sample of the pancreatic cancer patient in the region 3 to the region 12 is 73.53% -86.76%, the specificity range of detecting the healthy human blood sample is 92.05% -97.73%, and the diagnostic performance of the visible region 3 to the region 12 in the test sample is similar to the diagnostic performance of the visible region 3 to the region 12 in the training sample. In conclusion, methylation levels of the TRIM15 gene subregions (region 3 to region 12) can be used to effectively diagnose pancreatic cancer.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples merely represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. The scope of the patent is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted as illustrative of the contents of the claims.

Claims

1. A test agent for diagnosing pancreatic cancer, comprising an agent capable of specifically detecting the methylation level of a target region in a sample of a subject, said target region comprising the full length or a partial region of Chr6:30171742-30172465, with reference to grch 38.p14.

2. The detection reagent according to claim 1, wherein the target region includes one or more of region 1 and region 2,

the region 1 is a Chr6:30171779-30172465 positive strand;

the region 2 is the Chr6:30171742-30172444 negative strand.

3. The detection reagent of claim 1, wherein the target region comprises one or more of regions 3-12:

the region 3 is a Chr6:30171780-30171930 positive strand;

the region 4 is a Chr6:30171845-30172007 positive strand;

the region 5 is Chr6:30172016-30172123, positive strand;

the region 6 is Chr6:30172107-30172226, positive strand;

the region 7 is Chr6:30172340-30172463, positive strand;

the region 8 is the Chr6:30172289-30172444 negative strand;

the region 9 is Chr6:30172197-30172309, negative strand;

the region 10 is Chr6:30172090-30172190, negative strand;

The region 11 is Chr6:30171924-30172044, negative strand;

the region 12 is the Chr6:30171783-30171879 negative strand.

4. A detection reagent according to any one of claims 1 to 3, wherein the reagent effects detection of the methylation level of the target region by one or more of the following methods:

5. A detection reagent according to any one of claims 1 to 3, wherein the reagent comprises a primer pair for detecting the methylation level of the target region; or further comprises a detection probe for detecting the target region.

6. The detection reagent according to claim 5, wherein the reagent comprises a pair of methylated primers and a pair of unmethylated primers for detecting the methylation level of the region 1 and/or the region 2:

7. The detection reagent according to claim 5, wherein the reagent comprises a primer pair for detecting methylation level of one or more of regions 3 to 12 and a corresponding detection probe:

8. The test reagent of claim 1, wherein the type of subject sample comprises a blood sample, a tissue sample, or a cell sample.

9. A kit for diagnosing pancreatic cancer, comprising the detection reagent according to any one of claims 1 to 8.

10. The kit of claim 9, further comprising at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a nucleic acid purification reagent, a PCR reaction reagent, a sequencing reagent, and a quality control.

11. Use of an agent capable of specifically detecting the methylation level of a target region in a sample of a subject, said target region comprising the full length or a partial region of Chr6:30171742-30172465, with reference to grch38.p14, in the manufacture of a diagnostic product for pancreatic cancer.