CN117265110A

CN117265110A - Kit for detecting lung squamous carcinoma and application thereof

Info

Publication number: CN117265110A
Application number: CN202311227948.6A
Authority: CN
Inventors: 李书杨; 万慧; 阮彦添; 梁嘉琳; 袁雨文; 王青
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2023-09-22
Filing date: 2023-09-22
Publication date: 2023-12-22

Abstract

The invention belongs to the field of biological medicine, and in particular relates to a kit for detecting lung squamous carcinoma and application thereof. The kit provided by the invention can be used for detecting the methylation level of the target region of the LINC00391 gene in a sample, carrying out high-sensitivity and high-specificity detection on a lung squamous carcinoma tissue sample and a plasma sample, has good detection effects on lung squamous carcinomas of different pathological stages such as stage I, stage II, stage III and stage IV, provides a biomarker for detecting the lung squamous carcinoma, and is beneficial to early detection of the lung squamous carcinoma.

Description

Kit for detecting lung squamous carcinoma and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a kit for detecting lung squamous carcinoma and application thereof.

Background

Lung cancer is the most common cancer in the world and is also the leading cause of cancer death. Lung squamous cell carcinoma (luc) is a common pathological type of non-small cell lung cancer, accounting for about 30% of all lung cancers. Lung squamous carcinoma is common in men, elderly, and patients with a history of smoking, and mainly occurs in the central airways. The total survival rate of patients with early stage lung squamous carcinoma is only 63-79% in 5 years.

The development and progression of squamous cell lung carcinoma is a multi-factor and multi-genetic variation accumulation process, in which amplification or mutation of oncogenes and silencing and loss of function of tumor suppressor genes caused by genetic variation and epigenetic abnormalities play an important role in the development and progression of squamous cell lung carcinoma. Epigenetic gene is changed and regulated by modification of DNA methylation, histones and the like, and the epigenetic gene participates in development differentiation and functional metabolism of organisms. Different from gene mutation, the progressive phenotype change caused by epigenetic change can be reversed under certain conditions, and the characteristic opens up a new way for preventing and treating some diseases, especially tumors, especially abnormal hypermethylation of CpG island in the cancer suppressor gene promoter region and abnormal change of gene expression and function caused by abnormal histone modification, and can be used as an epigenetic marker and a target point for molecular diagnosis of tumors. Therefore, it is of great importance to explore early diagnostic markers for squamous cell lung carcinoma. In order to improve the accuracy of lung squamous carcinoma diagnosis, it is imperative to find new lung squamous carcinoma markers.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a kit for detecting lung squamous carcinoma and application thereof, so as to solve the technical problems that the prior art has insufficient diagnosis means for lung squamous carcinoma, the sensitivity and specificity for detecting lung squamous carcinoma are to be improved, and biomarkers with excellent detection effects for lung squamous carcinoma in different pathological stages are lacked.

To achieve the above object, the present invention provides a use of a reagent for detecting lung squamous carcinoma, comprising a first reagent for detecting methylation level of a CpG site of a target region in a LINC00391 gene, in the preparation of a lung squamous carcinoma diagnostic product; the lung squamous carcinoma diagnostic product includes one or more of a kit, a chip and a sequencing library.

The invention also provides a kit for detecting lung squamous carcinoma, which comprises a first reagent for detecting methylation level of CpG sites of a target region in LINC00391 gene.

Preferably, the target region of the LINC00391 gene is selected from the full length or partial region of the forward strand of Ch13: 94702749-94702940 using GRCh38.p14 as the reference genome.

Preferably, the first reagent comprises a pair of methylation primers for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand; the methylation primer pair comprises a first methylation primer pair shown in SEQ ID NO. 7-8 and/or a second methylation primer pair shown in SEQ ID NO. 11-12.

Preferably, the primer pairs further comprise a non-methylated primer pair for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 forward strand.

Further preferably, the first reagent comprises at least one combination of:

a first methylation primer pair shown in SEQ ID NOS.7-8 and a first unmethylation primer pair shown in SEQ ID NOS.9-10;

a second pair of methylated primers shown in SEQ ID NOS.11-12 and a second pair of unmethylated primers shown in SEQ ID NOS.13-14.

Preferably, the kit further comprises a second reagent for detecting the methylation level of the CpG site of the target region in the SOX2 gene.

Preferably, the target region of the SOX2 gene is selected from the full length or partial region of the negative strand of Ch3: 181704394-181704509 using GRCh38.p14 as the reference genome.

Further preferably, the second reagent comprises a third pair of methylation primers for detecting the methylation level of the full length or partial region of the Chr3:181704394-181704509 negative strand; the nucleotide sequence of the third methylation primer pair is shown as SEQ ID NO. 15-16.

Preferably, the second reagent further comprises a third pair of unmethylated primers for detecting the methylation level of the full length or partial region of the Chr3:181704394-181704509 negative strand; the nucleotide sequence of the third unmethylated primer pair is shown as SEQ ID NO. 17-18.

Preferably, the first and second reagents further comprise detection probes for the target region; the kit comprises a combination of at least one of the methylation primer pairs with a detection probe of the target region as follows:

A first methylation primer pair shown in SEQ ID NO. 7-8 and a first detection probe shown in SEQ ID NO. 19;

a second methylation primer pair shown in SEQ ID NO. 11-12 and a second detection probe shown in SEQ ID NO. 20;

a third methylation primer pair shown in SEQ ID NOS.15-16 and a third detection probe shown in SEQ ID NO. 21.

Preferably, the kit further comprises one or more of a DNA extraction reagent, a DNA purification reagent, a methylation conversion reagent, an amplification reagent, a methylation primer pair of an internal reference gene, a detection probe of an internal reference gene, and a quality control product.

Preferably, the 5 'end of the detection probe of the target region and the detection probe of the reference gene comprises a fluorescence reporting group, and the 3' end comprises a fluorescence quenching group.

In general, the above technical solutions conceived by the present invention have the following beneficial effects compared with the prior art:

(1) The kit for detecting the lung squamous carcinoma has excellent detection effects on a lung squamous carcinoma tissue sample and a plasma sample by detecting the methylation level of a target region of a LINC00391 gene in the sample, provides a biomarker for detecting the lung squamous carcinoma, and is beneficial to early detection of the lung squamous carcinoma.

(2) The kit provided by the invention has good detection sensitivity and specificity for lung squamous carcinoma in different pathological stages such as stage I, stage II, stage III, stage IV and the like, and can effectively distinguish lung squamous carcinoma patients from healthy people. In a preferred embodiment, the sensitivity of the kit for detecting the stage I, stage II, stage III and stage IV lung squamous carcinoma plasma samples can reach 79.4%, 88.5%, 93.3% and 100% respectively by detecting the methylation level of the target region of the LINC00391 gene and the target region of the SOX2 gene in the sample, and the specificity of the kit for detecting the healthy human plasma samples can reach 90%.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The term "diagnosis" refers to determining the health status of a subject, and encompasses detecting the presence or absence of a disease, responding to a therapeutic regimen, assessing risk of recurrence, assessing risk and extent of cancerous lesions, prognostic assays, and the like. In some cases, the term "diagnosis" refers to the use of a single factor in determining, validating or confirming a clinical state of a patient. In some embodiments, "detecting" lung squamous carcinoma refers to detecting the presence or absence of a disease, i.e., determining whether a subject has lung squamous carcinoma.

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced by any means, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby regulating gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "biomarker" or "marker" refers to a biochemical marker, such as a protein, DNA or RNA, that can label changes in or potentially occurring to the structure or function of a system, organ, tissue, cell, and subcellular, and has a very broad range of uses. Biomarkers can be used for disease diagnosis, for judging disease stage or for evaluating the safety and effectiveness of new drugs or new therapies in a target population. Screening biomarkers for disease screening and early diagnosis can greatly improve the clinical treatment effect of patients.

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified. "primer pair" refers to a group of an upstream primer and a downstream primer.

The term "bisulfite sequencing (Bisulfite Sequencing PCR, BSP)" is the conversion of unmethylated cytosines to uracil by bisulfite treatment of genomic DNA, with uracil being converted to thymine in subsequent PCR reactions, and methylated cytosines being unable to deaminate and being retained at the completion of the reaction; and designing primers in a non-methylation region for PCR amplification, cloning and sequencing the amplified PCR product, comparing the measured sequence with the original sequence, counting methylation sites and the number, and analyzing the methylation degree.

The term "methylation-specific PCR" is one of the most sensitive experimental techniques currently studied for methylation, and a minimum of about 50pg of DNA methylation can be found. After the single-stranded DNA is subjected to bisulfite conversion, all unmethylated cytosines are deaminated to uracil, and methylated cytosines in CpG sites are kept unchanged, so that two pairs of primers aiming at methylated and unmethylated sequences are respectively designed, and the methylated and unmethylated DNA sequences can be distinguished through PCR amplification. In the present disclosure, methylation primers are added when performing real-time quantitative methylation-specific PCR, and if the Ct value meets the requirement (e.g., ct.ltoreq.38 in a tissue sample), it indicates that the target sequence is methylated.

The term "methylation specific fluorescent quantitative PCR (qMSP)" is an experimental technique combining fluorescent quantitative PCR technology and methylation specific PCR technology. In the technology, proper primer pairs are designed based on sequence differences of DNA in different methylation states after bisulfite conversion, so that methylated sequences and unmethylated sequences are distinguished, but the final detection index of the qMSP is a fluorescent signal, so that a fluorescent probe or a fluorescent dye is required to be added in addition to a methylation detection primer in a qMSP reaction system. Compared with the traditional methylation specific PCR technology, the qMSP detection DNA methylation level has higher sensitivity and specificity, is more suitable for detecting trace amounts of DNA fragments with abnormal methylation mixed in the DNA of patients in early cancer, does not need gel electrophoresis detection, and is simpler and more convenient to operate.

The term "TaqMan probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

The term "AUC" is an abbreviation for "area under the curve". Specifically, it refers to the area under the Receiver Operating Characteristic (ROC) curve. ROC curves are graphs of true positive versus false positive rates for different possible cut points of a diagnostic test. Depending on the trade-off between sensitivity and specificity of the selected cut point (any increase in sensitivity will be accompanied by a decrease in specificity). The area under the ROC curve (AUC) is a measure of the accuracy of the diagnostic test (the larger the area the better; the best value is 1; the random test will have the ROC curve lying on the diagonal with an area of 0.5).

The invention provides application of a reagent for detecting lung squamous carcinoma in preparing a lung squamous carcinoma diagnosis product, wherein the reagent comprises a first reagent for detecting methylation level of CpG sites of a target region in a LINC00391 gene.

In some embodiments, the target region of the LINC00391 gene is selected from the full length or partial region of the forward strand of Ch13: 94702749-94702940 using GRCh38.p14 as the reference genome.

In some embodiments, the first reagent comprises a pair of methylation primers for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand. In a preferred embodiment, the methylation primer pair comprises a first methylation primer pair of SEQ ID NOS.7-8, and/or a second methylation primer pair of SEQ ID NOS.11-12.

In some embodiments, the first reagent further comprises a pair of unmethylated primers for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand. In a preferred embodiment, the unmethylated primer pair includes a first unmethylated primer pair as shown in SEQ ID NOS.9-10 and/or a second unmethylated primer pair as shown in SEQ ID NOS.13-14.

In some embodiments, the first reagent further comprises a detection probe for a target region of the LINC00391 gene. In a preferred embodiment, the first reagent comprises at least one of the following methylation primer pairs in combination with a detection probe of the target region:

a second methylation primer pair of SEQ ID NO. 11-12 and a second detection probe of SEQ ID NO. 20.

In some embodiments, the above-described reagents further comprise a second reagent for detecting the methylation level of a CpG site of a target region in the SOX2 gene.

In some embodiments, the target region of the SOX2 gene is selected from the full length or partial region of the negative strand of Ch3: 181704394-181704509 using GRCh38.p14 as the reference genome.

In some embodiments, the second reagent comprises a third methylation primer pair for detecting the methylation level of a full length or partial region of the Chr3:181704394-181704509 negative strand. In a preferred embodiment, the nucleotide sequences of the third methylation primer pair are shown in SEQ ID NOS.15-16.

In some embodiments, the second reagent further comprises a third unmethylated primer pair for detecting the methylation level of a full length or partial region of the Chr3:181704394-181704509 negative strand. In a preferred embodiment, the nucleotide sequences of the third unmethylated primer pair are shown as SEQ ID NOS.17-18.

In some embodiments, the second reagent further comprises a detection probe for a target region of the SOX2 gene. In a preferred embodiment, the second reagent comprises a third methylation primer pair of SEQ ID NOS.15-16 and a third detection probe of SEQ ID NO. 21.

In some embodiments, the lung squamous carcinoma diagnostic product described above includes one or more of reagents, kits, chips, and sequencing libraries. Alternatively, the agent may be in the form of a lyophilized powder, solution, suspension, emulsion, or the like.

It should be noted that the lung squamous carcinoma diagnostic product provided by the present invention is not limited to the above-mentioned reagents for detecting lung squamous carcinoma, and products which can meet the requirements of diagnosis or auxiliary diagnosis of lung squamous carcinoma are all within the scope of the present invention.

In some embodiments, the primer pairs further comprise unmethylated primer pairs for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand.

In a preferred embodiment, the first reagent comprises at least one of the following combinations:

The inventor of the application finds that the methylation level of the region in a lung squamous carcinoma tissue sample is obviously higher than that of a normal sample, the region is used as a lung squamous carcinoma marker, and by detecting the methylation level of the whole or partial region of the region in the sample, a lung squamous carcinoma patient and a healthy person can be effectively distinguished, whether the lung squamous carcinoma exists in a subject or whether the lung squamous carcinoma exists or not is judged, and a reference is provided for the detection of the lung squamous carcinoma. Further experiments have found that when the target region of the LINC00391 gene is combined with the target region of the SOX2 gene, the methylation level of the target region combination is detected, and the sensitivity and specificity of detecting lung squamous cell carcinoma are improved in some region combinations compared with those of detecting the target region of a single gene.

In some embodiments, the kit further comprises a second reagent for detecting the methylation level of the CpG site of the target region in the SOX2 gene.

It is to be noted that, if one primer set has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.) or more sequence identity with the nucleotide sequence shown in the primer set (first methylated primer set, first unmethylated primer set, second methylated primer set, second unmethylated primer set, third unmethylated primer set) and the primer set has a certain lung squamous carcinoma diagnosis function (the specificity or sensitivity is reduced, slightly increased, or greatly increased, etc.) as compared with the primer set of the present application, the primer set is also within the scope of the present invention.

In some embodiments, the first reagent and the second reagent further comprise detection probes for the target region. In a preferred embodiment, the kit comprises a combination of at least one of the methylation primer pairs described below with a detection probe of the target region:

In some embodiments, the kit further comprises one or more of a DNA extraction reagent, a DNA purification reagent, a methylation conversion reagent, an amplification reagent, a methylation primer pair of a reference gene, a detection probe of a reference gene, and a quality control.

In some embodiments, the methylation conversion reagent is used to deaminate unmethylated cytosines in DNA to uracil while methylated cytosines remain unchanged. The methylation converting reagent is not particularly limited in the present invention, and any reagent reported in the prior art for achieving conversion of cytosine to uracil may be used, such as one or more of hydrazine salt, bisulfate (e.g., sodium bisulfate, potassium bisulfate, ammonium bisulfate) and bisulfites (e.g., sodium metabisulfite, potassium bisulfate, calcium bisulfate, cesium bisulfate, ammonium bisulfite, etc.).

In some embodiments, the amplification reagents include, but are not limited to, amplification buffers, dNTPs, DNA polymerase, and Mg ²⁺ One or more of the following.

In some embodiments, the reference gene may be, but is not limited to ACTB. In an alternative specific example, the nucleotide sequence of the methylation primer pair of the reference gene ACTB is shown as SEQ ID NO. 22-23, and the nucleotide sequence of the detection probe of the reference gene ACTB is shown as SEQ ID NO. 24. It will be appreciated that in other embodiments, other reference genes may be selected, and that the methylation primer pairs and detection probes of the reference genes may be designed accordingly.

In some embodiments, the quality control comprises a positive control and a negative control, wherein the positive control comprises a methylated lung squamous carcinoma marker, and is used for monitoring the detection performance of the reagent in the kit; negative control refers to a lung squamous carcinoma marker that does not contain methylation therein, and is used to monitor whether the experiment is contaminated.

In some embodiments, the 5 'end of the detection probe of the target region and the detection probe of the reference gene comprises a fluorescence reporter group, the 3' end comprises a fluorescence quenching group, and the fluorescence reporter groups of the probes are independently selected from any one of FAM, VIC, HEX, NED, ROX, TET, JOE, CY and CY 5; the fluorescence quenching group of each probe is independently selected from any one of TAMRA, MGB, BHQ, BHQ, BHQ2 and BHQ 3. Examples of the fluorescent reporter group and the fluorescent quencher group of each probe each independently include, but are not limited to, those listed above.

In some embodiments, the test sample of the above kit includes, but is not limited to, a composition of organs, tissues, cells and/or body fluids isolated from a subject. In some embodiments, the sample may be a tissue or a body fluid sample, and further, the tissue includes lung tissue; the body fluid includes blood, plasma, serum, extracellular fluid, interstitial fluid, lymph fluid, etc., and also includes sputum, urine, saliva, feces, etc. Further, in an embodiment of the present invention, the sample to be measured is a plasma sample.

The invention also provides a method for detecting lung squamous carcinoma by detecting methylation level of a target region in a sample, comprising the steps of: 1) Extracting the DNA of a plasma sample of a subject and treating the DNA with a methylation conversion reagent; 2) Taking the converted and purified sample DNA as a template, adding a primer pair and a detection probe for detecting the methylation level of a target region and other components of a kit, and performing PCR reaction to obtain a Ct value of an amplified target region in the sample; 3) Judging whether the plasma sample is a lung squamous carcinoma positive sample according to a difference value (delta Ct) between the Ct value of the amplified target region and the Ct value of the amplified internal reference gene in the sample.

Based on the present disclosure, one skilled in the art can detect the methylation level of a lung squamous carcinoma marker (target region) in the above-mentioned sample by any technique known in the art, and diagnose lung squamous carcinoma by any technique falling within the scope of the present invention. The above-described method for detecting methylation of lung squamous carcinoma markers in a sample using the kit may be, but is not limited to, methylation-sensitive random primer polymerase chain reaction (MS AP-PCR), methylation-sensitive single nucleotide primer extension (MS-SNuPE), methylation-specific PCR (qMSP), methylation-sensitive DNA restriction enzyme analysis, restriction enzyme-based sequencing, restriction enzyme-based microarray analysis, joint bisulfite restriction analysis (COBRA), methylation CpG island amplification (MCA), methylation CpG island amplification and microarray (MCAM), hpaII small fragment enrichment by ligation-mediated PCR (HELP), bisulfite Sequencing (BSP), bisulfite microarray analysis, methylation-specific pyrophosphate sequencing, HELP sequencing (HELP-Seq), TET-assisted pyridine borane sequencing (TAPS), gal hydrolysis and ligation adapter-dependent PCR (GLAD-PCR), methylation DNA immunoprecipitation sequencing (meiip-Seq) or methylation DNA immunoprecipitation-microarray analysis (mep-p-mp), and magneto-restriction enzyme-based magneto-blotting using a magneto-resistive array.

The method provided by the invention can be used for diagnosing lung squamous carcinoma with high sensitivity and high specificity in a low invasiveness, thereby leading to early treatment and prognosis improvement, and further monitoring disease aversion, monitoring treatment of surgical treatment and radiotherapy and effectiveness of treatment of chemotherapy. It should be understood that the results obtained by the kit for detecting lung squamous carcinoma described in the present application are merely intermediate results of diagnosis of lung squamous carcinoma or indicate possibility or risk of lung squamous carcinoma of the subject, and it is also necessary to combine clinical manifestations of the individual and other physiological indexes to finally draw a conclusion as to whether lung squamous carcinoma is suffered or not.

It is to be understood that the above terminology and related definitions are for the purpose of explanation only and are not intended to be limiting. Any method and material similar or equivalent to those described may be used in the present application. The preferred methods and materials described herein are illustrative only and should not be construed as limiting the scope of the present application. Unless otherwise indicated, the starting materials and reagents used in the following examples are commercially available or may be prepared by methods known in the art.

The following describes the above technical scheme in detail with reference to specific embodiments.

Example 1 design of primers and probes for Lung squamous carcinoma marker detection region

The invention provides an isolated polynucleotide SEQ ID NO.1, SEQ ID NO.1 and SEQ ID NO.4 combination as lung squamous carcinoma markers, wherein the SEQ ID NO.1 is positioned in a target region (physical position is chr13:94702749-94702940 positive strand) of a LINC00391 gene, and the SEQ ID NO.4 is positioned in a target region (physical position is chr3:181704394-181704509 negative strand) of a SOX2 gene. The nucleotide sequence has multiple methylation sites, and occurs at C-5 position of cytosine, the product is called 5-methylcytosine (5-mC), wherein the sequence of SEQ ID NO.1 has 16 methylation sites from 5'-3', the sequence of SEQ ID NO.4 has 14 methylation sites from 5'-3', and all methylation sites are usedAnd (5) identifying.

The "C" in the double strand of DNA is converted to "U" after the bisulfite or bisulfite treatment of the above polynucleotide molecule, and the "U" is converted to "T" by subsequent PCR, but the bisulfite does not allow the above conversion of the "C" of the DNA which has been methylated. Thus, the polynucleotide molecules obtained after bisulfite or bisulfite treatment of SEQ ID NO.1 include SEQ ID NO.2 (fully methylated sequence) and SEQ ID NO.3 (unmethylated sequence), and the polynucleotide molecules obtained after bisulfite or bisulfite treatment of SEQ ID NO.4 include SEQ ID NO.5 (fully methylated sequence) and SEQ ID NO.6 (unmethylated sequence), the specific information of which is given in Table 1.

TABLE 1 target region of LINC00391 gene and target region of SOX2 gene

When designing primers based on bisulfite treated polynucleotide molecules, the original DNA sequence is first entered and the program will show 2 sequences: one is the original DNA sequence that was input; the other is a sulfurized DNA sequence, all unmethylated "C" are converted to "T" except for 5 methylcytosine (5 mC) on CpG islands, and primers are designed based on the converted sequence.

Two pairs of primers need to be designed for BSP, one pair being for bisulfite treated methylated sequences; the other pair is directed to bisulfite treated unmethylated sequences, where methylated primers specifically amplify only methylated sequences and unmethylated primers specifically amplify only unmethylated sequences. According to the design principle of the primers, the polynucleotide sequences SEQ ID NO.2 and SEQ ID NO.3 are used as templates to design primer pairs (comprising a first primer pair and a second primer pair), wherein the first primer pair comprises a methylation primer pair shown by SEQ ID NO.7 and SEQ ID NO.8 and a non-methylation primer pair shown by SEQ ID NO.9 and SEQ ID NO.10, and an amplification product of the first primer pair comprises CpG sites (the physical positions are the forward chains of Chr13: 94702756-94702816) of 02-09 numbers in SEQ ID NO. 1; the second primer pair comprises a methylation primer pair shown in SEQ ID NO.11 and SEQ ID NO.12 and a non-methylation primer pair shown in SEQ ID NO.13 and SEQ ID NO.14, and the amplification product of the second primer pair comprises CpG sites of 10-16 (the physical position is the forward strand of Chr13: 94702821-94702934) in SEQ ID NO. 1. The polynucleotide sequences SEQ ID NO.5 and SEQ ID NO.6 are taken as templates to design a primer pair (third primer pair), wherein the third primer pair comprises a methylation primer pair shown by SEQ ID NO.17 and SEQ ID NO.18 and a non-methylation primer pair shown by SEQ ID NO.19 and SEQ ID NO.20, and an amplification product of the third primer pair comprises 01-12 CpG sites (physical positions are the negative strand of Chr3: 181704400-181704500) in SEQ ID NO. 4. Specific information of the first primer pair, the second primer pair and the third primer pair is shown in Table 2.

TABLE 2 nucleotide sequences of the first, second, third primer pairs

The first detection probe (SEQ ID NO. 19) and the second detection probe (SEQ ID NO. 20) are designed by taking the polynucleotide sequence SEQ ID NO.2 as a template, and respectively form a first primer probe combination and a second primer probe combination with the methylation primer pairs SEQ ID NO. 7-SEQ ID NO.8 and SEQ ID NO. 11-SEQ ID NO. 12. A third detection probe (SEQ ID NO. 21) is designed by taking the polynucleotide sequence SEQ ID NO.5 as a template, and is combined with the methylation primer pair SEQ ID NO. 15-SEQ ID NO.16 to form a third primer probe. Specific information of the primer probe combinations is shown in Table 3. And (3) artificially synthesizing the primer pair and the probe for standby.

TABLE 3 primer probe combinations

Example 2 analysis of Lung squamous carcinoma markers based on Sanger sequencing Performance of Lung squamous carcinoma tissue samples

The performance of lung squamous carcinoma tissue samples was tested by analyzing lung squamous carcinoma markers using Sanger sequencing. The method comprises the following specific steps:

1. sample collection

In this example, 48 cases of cancer tissue samples and 48 cases of paracancerous tissue samples were collected for clinical diagnosis of squamous lung carcinoma, which were formalin-fixed and paraffin-embedded, and the collection of all samples had been approved by the ethics committee, and all volunteers signed informed consent prior to sample collection.

2. Extraction of tissue sample DNA

For paraffin-embedded tissue samples, QIAamp DNA FFPE Tissue Kit (56404) was used to extract genomic DNA from the tissue samples, and the specific procedure was performed according to the kit instructions.

3. Bisulphite conversion

The extracted DNA was bisulphite converted using the DNA conversion reagent of the Living technologies GmbH of Wuhan Ai Misen (Ehan mechanical arm 20200843), followed by purification of the converted DNA for subsequent experiments, see kit instructions for specific procedures.

PCR amplification and Sanger sequencing

The target region in the tissue sample was amplified using the PCR method and Sanger sequencing was performed. Firstly, preparing a PCR reaction system (see Table 4), taking a sample DNA after bisulphite conversion as a template, and simultaneously adding SYBR Green PCR Mix, a methylation primer pair and a non-methylation primer pair of a target region (see Table 2) and upstream and downstream primers of an internal reference gene ACTB: AAGGTGGTTGGGTGGTTGTTTTG (SEQ ID NO. 22), AATAACACCCCCACCCTGC (SEQ ID NO. 23), PCR amplification was performed according to the reaction procedure shown in Table 5, and finally the amplified product was sent to Sanger sequencing.

TABLE 4 SYBR Green PCR reaction System

Component (A)	Dosage (mu L)
		SYBR Green PCR Mix	17.5
Methylation primer pair upstream primer (10. Mu.M)	0.5
		Methylation primer pair downstream primer (10. Mu.M)	0.5
Unmethylated primer pair upstream primer (10. Mu.M)	0.5
		Unmethylated primer pair downstream primer (10. Mu.M)	0.5
ACTB upstream primer (10 mu M)	0.5
		ACTB downstream primer (10. Mu.M)	0.5
Template DNA	5
		Ultrapure water	Supplement to 50

TABLE 5 SYBR Green PCR reaction procedure

5. Analysis of results

Analysis of the sequencing peak pattern was based on the methylation status of key CpG sites of pyrosequencing. Specifically, methylation of cytosine in a CpG nucleotide is classified into two types: i.e., methylated and unmethylated, where methylation is in turn divided into fully methylated and partially methylated, a CpG dinucleotide site is considered partially methylated if the sequencing result of the cytosine at that site reveals both a C and a T at the position of the cytosine. If more than 95% of the C's in CpG dinucleotide sites in an amplicon are methylated, the sample is considered methylated in this region.

Comparing the sequencing result of the amplified product with the pathological result according to the standard, and calculating the methylation state of CpG sites of the amplified product to calculate the sensitivity and the specificity of the target region. Sensitivity = proportion of samples positive for pathology results that detected methylation positive; specificity = proportion of methylation negative samples with negative pathological results. The detection results are shown in Table 6.

TABLE 6 specificity and sensitivity of different CpG sites on tissue samples

Analysis table 6 shows that the first, second and third primer pairs can be used for detecting lung squamous carcinoma tissue samples, the primer pairs can effectively distinguish the lung squamous carcinoma tissue samples from the paracancerous normal tissue samples by detecting the methylation level of the lung squamous carcinoma markers, the detection sensitivity is greater than 91%, the detection specificity is greater than 81%, wherein the sensitivity of the second primer pair for diagnosing the lung squamous carcinoma tissue samples by detecting the methylation level of 10-16 # CpG sites in SEQ ID NO.1 is 93.8%, and the specificity of the paracancerous normal tissue samples is 89.6%.

Example 3 specificity and sensitivity of detection of Lung squamous carcinoma markers on blood samples

The differential methylation sites obtained by screening are evaluated in 30 lung squamous carcinoma plasma samples, 30 healthy human plasma samples and blood cell samples by using a pyrosequencing method, and the specific process is as follows:

1. extraction of DNA samples

The collected blood sample is centrifuged to separate the plasma layer and blood cells for later use. The plasma layer was subjected to plasma cfDNA extraction using a magnetic bead serum/plasma free DNA extraction kit (catalogue number: DP 709) from the company digen biochemical technology (beijing), the volume of plasma used being 1.5mL, see kit instructions for specific procedures. Blood cells the genomic DNA of cells of each sample was extracted using a blood/cell/tissue genomic DNA extraction kit (catalog number: DP 304) from Tiangen Biochemical technology (Beijing) limited, see kit instructions for specific procedures.

2. Bisulphite conversion and purification treatments

The extracted genome DNA of each sample is respectively subjected to bisulphite conversion, the nucleic acid conversion kit is a nucleic acid purification reagent (Huhan mechanical equipment 20200843) of the life technology Co., ltd., wuhan Ai Misen, specific experimental operation is described in the kit instruction, and 30 mu L of purified water is used for eluting after the conversion is completed.

PCR amplification and Sanger sequencing were as in example 2.

4. The results were analyzed as in example 2. The detection results are shown in Table 7.

TABLE 7 sensitivity and specificity of different CpG sites on plasma samples

TABLE 8 specificity of different CpG sites in samples of healthy human blood cells

Target region	Detection of CpG sites	Healthy human blood cell sample (100 cases)
			Target area 1	CpG sites of 02-09 numbers in SEQ ID NO.1	98％(98/100)
Target area 2	CpG sites of 10-16 numbers in SEQ ID NO.1	97％(97/100)
			Target area 3	CpG sites of 01-12 numbers in SEQ ID NO.4	100％(100/100)

As can be seen from table 7, differentiating lung squamous carcinoma patients from healthy persons can achieve non-invasive diagnosis by detecting methylation levels of target regions in plasma samples. The sensitivity and specificity of the target area 1 for detecting the plasma sample are 83.3% and 86.7%, respectively, the sensitivity and specificity of the target area 2 for detecting the plasma sample are 83.3% and 90.0%, respectively, and the sensitivity and specificity of the target area 3 for detecting the plasma sample are 76.7% and 93.3%, respectively.

Target regions hypermethylated in lung squamous carcinoma may be released into plasma cfDNA, thus excluding the target regions from interfering in blood cells. As is clear from Table 8, the specificity of each of target region 1 of LINC00391 gene, target region 2 and target region 3 of SOX2 gene for detecting a healthy human blood cell sample was 97% or more, and the specificity was excellent in the blood cell sample.

Example 4 Performance of qMSP-based analysis of lung squamous carcinoma markers to detect clinical blood samples

1. Sample collection

The present example incorporates 189 blood samples, including 100 healthy human blood samples and 89 lung squamous carcinoma blood samples (34 in stage I, 26 in stage II, 15 in stage III, and 14 in stage IV). The sample collection process was approved by the ethics committee and all subjects signed informed consent. In the implementation, a lung squamous cancer patient is diagnosed by detecting the methylation level of a target area in a subject sample, after blinding the collected sample in the detection process, a test operator performs a test, and a result interpreter compares the obtained detection result with a pathological result (gold standard) according to the interpretation standard to examine the clinical effectiveness of the lung squamous cancer marker.

2. Extraction of sample DNA

Plasma cfDNA extraction was performed using the magnetic bead serum/plasma free DNA (cfDNA) extraction kit (DP 709) from the company of the biochemical technology of the root of the chinese day (beijing), the specific procedure being according to the kit instructions.

3. Bisulphite conversion

The DNA was transformed with the nucleic acid transforming reagent (Ehan apparatus 20200843) from the GmbH of the life sciences of Wuhan Ai Misen, followed by purification of the transformed DNA for subsequent experiments, see kit instructions for specific procedures.

qMSP reaction

Amplifying the methylated DNA template with the methylated primer pair and the TaqMan detection probe in Table 3, not amplifying the unmethylated DNA template, and not causing other nonspecific amplification; in addition, the primer pair has good amplification efficiency, namely, the amplification efficiency of each target region is between 90 and 110 percent. The TaqMan probe used in Table 3 has a fluorescent group at the 5 'end, such as FAM, ROX, VIC, CY, etc., and a fluorescence quenching group at the 3' end, such as TAMRA, BHQ, MGB, etc. The qPCR reaction based on the TaqMan probe can realize simultaneous detection of a plurality of target genes in one reaction system, and at the moment, only the fluorescent reporter groups carried by the 5' -end of each target gene specific detection probe are required to be different. In this example, 2 target genes, namely the target region of the lung squamous carcinoma marker and the internal reference gene ACTB, were detected in each qPCR reaction system, and the ACTB detection probe sequence was GGAGTGGTTTTTGGGTTTG (SEQ ID No. 24). At this time, the TaqMan probe specific to the target region has a ROX as the fluorescent group at the 5 'end and a non-fluorescence quenching group NFQ as the 3' end; the 5 '-end fluorescent group of the ACTB detection probe is VIC, and the 3' -end fluorescent quenching group is BHQ.

The amplification system of qMSP using the bisulfite converted and purified DNA of body fluid sample as a template was shown in table 9 and the amplification procedure was shown in table 10, using the methylation primer pair and the detection probe, respectively. In qPCR reaction of each sample, the amount of the reference gene ACTB needs to be detected for monitoring the sample quality and interpretation of the results. In each PCR reaction plate, besides the experimental hole for detecting the sample to be detected, a positive control hole and a negative control hole are also required to be arranged at the same time. Template for positive control well 10 ³ copies/. Mu.L of plasmid containing the sequence ACTB after transformation and 10 ³ The copies/. Mu.L of plasmid mixture containing the DNA sequence of the target region after complete methylation and bisulfite conversion (equal volume mix), the other components are identical to the experimental tube; the template of the negative control well was TE buffer and the other components were the same as those of the experimental tube.

TABLE 9 qPCR reaction System

/>

TABLE 10 qPCR reaction procedure

After qPCR reaction is finished, a baseline is adjusted (a signal value corresponding to the 3 rd to 15 th cycles is generally set as a baseline level), a threshold value is set, the threshold value is required to be positioned in an exponential amplification period, a straight line crossing the threshold value and being parallel to an X axis is called a threshold line, and the cycle number corresponding to the intersection point of the threshold line and an amplification curve is a Ct value. Analyzing the result of qPCR reaction, requiring (1) no amplification for negative control; (2) the positive control PCR tube has obvious index increasing period, and the Ct value of the target gene of the positive control PCR tube is between 26 and 30; (3) the Ct value of the reference gene ACTB of the sample to be detected is less than or equal to 33. If the positive control, the negative control and the reference gene all meet the requirements, the detection result of the sample to be detected can be analyzed and the result can be interpreted, otherwise, the detection must be carried out again when the experiment is invalid.

5. Interpretation of results

For a plasma sample, the positive judgment value is 45, if the Ct value of amplification by using a certain pair of methylation detection primer pairs and detection probes is less than or equal to 45, the sample is considered to be methylation positive in the amplification region, and the sample is a lung squamous cell carcinoma positive sample; if the Ct value of amplification using a certain pair of methylation detection primers and detection probes is > 45, the sample is considered to be methylation negative in the amplified region, and the sample is a lung squamous carcinoma negative sample.

The performance of diagnosing plasma samples from subjects by detecting methylation levels of a single target region by the qMSP method is shown in table 11.

Table 11 qMSP method for detecting performance of single target area for diagnosing lung squamous carcinoma plasma sample

/>

As can be seen from table 11, the effect of detecting the lung squamous carcinoma plasma sample by detecting the methylation levels of the target region 1 and the target region 2 is excellent, and the AUC values thereof are all larger than 0.919. Target region 1 and target region 2 were from different positions of LINC00391 gene, and the total sensitivity and specificity of the lung squamous carcinoma plasma sample were detected by detecting methylation levels of target region 1 and target region 2 to be substantially equal, the detection sensitivity was 83.1% and the specificity was 91% and 90% respectively, but the detection of different stages of lung squamous carcinoma by target region 1 and target region 2 was still different. The sensitivity of detecting lung squamous carcinoma plasma sample by detecting methylation level of target region 3 is 76.4% lower than target region 1, target region 2; the specificity was 94%, slightly higher than target region 1, target region 2.

For different stage lung squamous carcinoma plasma samples, the sensitivity of detecting the stage I lung squamous carcinoma by detecting the methylation level of the target area 1 and the target area 2 is more than or equal to 73.5%, the sensitivity of detecting the stage II lung squamous carcinoma is more than or equal to 80.8%, the sensitivity of detecting the stage III lung squamous carcinoma is more than or equal to 86.7%, and the sensitivity of detecting the stage IV lung squamous carcinoma is more than or equal to 100%, which are superior to the sensitivity of detecting the stage I, the stage II and the stage III lung squamous carcinoma by the target area 3. As can be seen from Table 11, the kit provided in this embodiment can effectively distinguish lung squamous carcinoma patients from healthy persons, and provides noninvasive or minimally invasive diagnostic products with high detection sensitivity and specificity for lung squamous carcinoma patients.

Example 5 Performance of target region combination detection of clinical blood samples

In view of the fact that the sensitivity of the target area 1 and the target area 2 for detecting lung squamous carcinoma is better than that of the target area 3, the detection performance of combining the target area 1 and the target area 2 with the target area 3 respectively may have a synergistic effect. Thus, applicants further attempted to analyze the performance of target region 1 and target region 3, target region 2 and target region 3 in combination for lung squamous carcinoma using the data of Ct values obtained from the detection of body fluid samples in example 3, but the criteria for positive samples were not the same as for single target region detection when target regions were used in combination for lung squamous carcinoma detection, as follows:

For plasma samples: 1) If the Ct value of the amplified target region is 45 or less, the target region is considered methylation positive, and if the Ct value of the amplified target region is 45 or more, the target region is considered methylation negative. 2) If at least one target area in two target areas in a certain sample to be detected is methylation positive, the sample is a lung squamous carcinoma positive sample; if two target areas in a certain sample to be detected are methylation negative, the sample is a lung squamous carcinoma negative sample. The performance of the target area combination test of a subject's plasma sample is shown in table 12.

Table 12 performance of target region combinations for testing plasma samples from subjects

In Table 12, the total sensitivity of the plasma sample of the patient with lung squamous carcinoma by the target region combination detection can reach 87.6%, and the specificity of the plasma sample of the patient with lung squamous carcinoma can reach 90%. For different stages of lung squamous carcinoma plasma samples, the sensitivity of the target area combined detection of the lung squamous carcinoma plasma samples in the stages I, II, III and IV can reach 79.4%, 88.5%, 93.3% and 100% respectively.

Comparing tables 11 and 12, the total sensitivity of the plasma samples of the lung squamous carcinoma patients detected by the target region combination is improved compared with that of the single target region, and is obviously better than that of the target region 3 (the target region of the SOX2 gene); the specificity of the target region combination detection of healthy human plasma samples is equal to or slightly lower than that of a single target region. The kit provided by the embodiment can improve the detection rate of lung squamous carcinoma patients by detecting the methylation level of the target region combination, thereby improving the survival rate of lung squamous carcinoma patients.

It will be readily appreciated by those skilled in the art that the foregoing description is merely a preferred embodiment of the invention and is not intended to limit the invention, but any modifications, equivalents, improvements or alternatives falling within the spirit and principles of the invention are intended to be included within the scope of the invention.

Claims

1. Use of a reagent for detecting lung squamous carcinoma in the preparation of a lung squamous carcinoma diagnostic product, characterized in that the reagent comprises a first reagent for detecting the methylation level of a CpG site of a target region in the LINC00391 gene; the lung squamous carcinoma diagnostic product includes one or more of a kit, a chip and a sequencing library.

2. A kit for detecting lung squamous carcinoma, comprising a first reagent for detecting the methylation level of a CpG site of a target region in the LINC00391 gene.

3. The kit according to claim 2, wherein the target region of the LINC00391 gene is selected from the group consisting of the full length or partial region of the chr13:94702749-94702940 positive strand, using grch38.p14 as a reference genome;

the first reagent comprises a methylation primer pair for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand; the methylation primer pair comprises a first methylation primer pair shown in SEQ ID NO. 7-8 and/or a second methylation primer pair shown in SEQ ID NO. 11-12.

4. The kit of claim 3, wherein the first reagent further comprises a pair of unmethylated primers for detecting the methylation level of the full length or partial region of the Chr13:94702749-94702940 positive strand;

the first reagent comprises at least one combination of:

5. The kit of claim 2, further comprising a second reagent for detecting the methylation level of the CpG site of the target region in the SOX2 gene.

6. The kit according to claim 5, wherein the target region of the SOX2 gene is selected from the group consisting of the full length or partial region of the negative strand of Ch3: 181704394-181704509 using GRCh38.p14 as a reference genome;

the second reagent comprises a third methylation primer pair for detecting the methylation level of the full length or partial region of the Chr3:181704394-181704509 negative strand; the nucleotide sequence of the third methylation primer pair is shown as SEQ ID NO. 15-16.

7. The kit of claim 6, wherein the second reagent further comprises a third pair of unmethylated primers for detecting the methylation level of the full length or partial region of the chr3:181704394-181704509 negative strand; the nucleotide sequence of the third unmethylated primer pair is shown as SEQ ID NO. 17-18.

8. The kit of claim 3 or 6, wherein the first reagent and the second reagent further comprise detection probes for the target region;

the kit comprises a combination of at least one of the methylation primer pairs with a detection probe of the target region as follows:

9. The kit of claim 2, further comprising one or more of a DNA extraction reagent, a DNA purification reagent, a methylation conversion reagent, an amplification reagent, a methylation primer pair of an internal reference gene, a detection probe of an internal reference gene, and a quality control.

10. The kit according to claim 9, wherein the 5 '-end of the detection probe of the target region and the detection probe of the reference gene comprises a fluorescent reporter group and the 3' -end comprises a fluorescence quenching group.