CN114959030B - Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer - Google Patents
Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer Download PDFInfo
- Publication number
- CN114959030B CN114959030B CN202210542498.9A CN202210542498A CN114959030B CN 114959030 B CN114959030 B CN 114959030B CN 202210542498 A CN202210542498 A CN 202210542498A CN 114959030 B CN114959030 B CN 114959030B
- Authority
- CN
- China
- Prior art keywords
- chr6
- methylation
- region
- detecting
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Abstract
The invention relates to an application of a reagent for detecting HCG9 gene methylation in preparing a product for diagnosing bladder cancer. The detection of HCG9 gene methylation is used for diagnosing bladder cancer, has higher specificity, can effectively improve the detection rate of early bladder cancer, has good stability and high accuracy, is easy for early diagnosis, has lower dependence on the technical level of doctors, has no wound and has good application prospect.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to application of a reagent for detecting HCG9 gene methylation in preparation of a product for diagnosing bladder cancer.
Background
Bladder cancer is the ninth most common malignancy worldwide, and is also the most common urogenital malignancy in men and women, and the incidence of men is more than 4 times higher than women. Bladder cancer includes muscle invasive cancer and non-muscle invasive cancer. Almost 80% of bladder cancers appear as non-muscle invasive diseases. Of these, 60% of bladder cancers are localized to the bladder mucosa, 30% of cancers invade submucosa, and 10% are carcinoma in situ. The 5-year survival rate of bladder cancer is correlated with disease stage at diagnosis, with 5-year survival rates of carcinoma in situ as high as 95.8% and 5-year survival rates of metastatic bladder cancer as low as 4.6%. Thus, accurate and timely diagnosis is critical to prognosis of patients with bladder cancer.
Currently, cystoscopy and urine shed cytology are two major ways of diagnosing bladder cancer, but urine shed cytology is relatively low in sensitivity, and cystoscopy is the gold standard for bladder cancer diagnosis. Although cystoscopy is more sensitive than other current methods, cystoscopy is an invasive procedure, the patient has to suffer, and cystoscopy is affected by urethral stricture, possibly causing urethral perforation, bleeding or infection, etc.
Several non-invasive diagnostic methods have also emerged recently, such as detection of the protein marker Nuclear matrix protein 22 (NMP-22) and Bladder Tumor Antigen (BTA) in urine to diagnose bladder cancer, but with low specificity.
Disclosure of Invention
According to the research of the application, the HCG9 gene is used as a biomarker of bladder cancer, and the defect that the specificity of a traditional detection product to bladder cancer is not high can be improved by detecting the methylation level of the HCG9 gene to diagnose bladder cancer.
Based on this, it is necessary to provide an agent for detecting methylation of HCG9 gene for use in the preparation of a product for diagnosing bladder cancer. In addition, a detection kit with high specificity for diagnosing bladder cancer is also provided.
In one embodiment, with reference to grch38.p13, the reagent is capable of detecting chr6: methylation levels of full length or partial regions of the 29975312 ～ 29975949 region;
in one embodiment, the agent is capable of detecting the methylation level of the full length or partial region of at least one of the following regions:
chr6:29975312 ～ 29975466 plus strand, chr6:29975464 ～ 29975645 plus strand, chr6:29975602 ～ 29975770 plus strand, chr6:29975776 ～ 29975919 plus strand, chr6:29975720 ～ 29975949 minus strand, chr6:29975434 ～ 29975778 minus strand and Chr6:29975313 ～ 29975456.
A kit for detecting bladder cancer, the kit comprising reagents for detecting the methylation level of the HCG9 gene.
In one embodiment, with reference to grch38.p13, the reagent is used to detect chr6: methylation levels of full length or partial regions of the 29975312 ～ 29975949 region;
in one embodiment, the agent is capable of detecting the methylation level of a full length or partial region of at least one of the following regions:
chr6:29975312 ～ 29975466 plus strand, chr6:29975464 ～ 29975645 plus strand, chr6:29975602 ～ 29975770 plus strand, chr6:29975776 ～ 29975919 plus strand, chr6:29975720 ～ 29975949 minus strand, chr6:29975434 ～ 29975778 minus strand and Chr6:29975313 ～ 29975456.
In one embodiment, the kit detects the methylation level of the HCG9 gene by at least one of the following methods: methylation-specific PCR, fluorescent quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, and methylation-sensitive restriction endonuclease.
In one embodiment, the reagent comprises a primer pair;
in one embodiment, the reagent further comprises a detection probe corresponding to the primer.
In one embodiment, the primer pair comprises at least one set of the following primer pairs:
for detecting Chr6: a first primer pair for detecting the methylation level of the plus strand of a full or partial region within the 29975312 ～ 29975466 region for Chr6: a second primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975464 ～ 29975645 for Chr6: a third primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975602 ～ 29975770 for Chr6: a fourth primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975776 ～ 29975919 for Chr6: fifth primer pair for detecting the methylation level of the negative strand of the full or partial region within region 29975720 ～ 29975949 for Chr6: a sixth primer pair for detecting Chr6 for methylation level of the negative strand of the full or partial region within region 29975434 ～ 29975778: a seventh primer pair for methylation level of the negative strand of the full length or partial region within the 29975313 ～ 29975456 region.
In one embodiment, the nucleotide sequence of the first primer pair is set forth in SEQ ID NO: 1-2 or as shown in SEQ ID NO:15 to 16;
and/or, the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 3-4 or as shown in SEQ ID NO:18 to 19;
and/or, the nucleotide sequence of the third primer pair is shown as SEQ ID NO: 5-6 or as shown in SEQ ID NO: 21-22;
and/or, the nucleotide sequence of the fourth primer pair is shown as SEQ ID NO:7 to 8;
and/or, the nucleotide sequence of the fifth primer pair is shown as SEQ ID NO: 9-10 or as shown in SEQ ID NO:24 to 25;
and/or, the nucleotide sequence of the sixth primer pair is shown as SEQ ID NO: 11-12 or as shown in SEQ ID NO:27 to 28;
and/or, the nucleotide sequence of the seventh primer pair is shown as SEQ ID NO: 13-14 or as shown in SEQ ID NO:30 to 31.
In one embodiment, the reagent further comprises a detection probe corresponding to the primer pair, wherein:
and the sequence of SEQ ID NO: 15-16, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 17; and/or, with a sequence as set forth in SEQ ID NO: 18-19, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 20; and/or, with a sequence as set forth in SEQ ID NO: 21-22, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: indicated at 23; and/or, with a sequence as set forth in SEQ ID NO: 24-25, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 26; and/or, with a sequence as set forth in SEQ ID NO: 27-28, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 29; and/or, with a sequence as set forth in SEQ ID NO: 30-31, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 32.
In one embodiment, the kit further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control reagent, a PCR reaction reagent, and a sequencing reagent.
Detailed Description
The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Interpretation of the terms
The term "and/or" includes any and all combinations of one or more of the associated listed items.
The term "bladder cancer" refers to cancers occurring on the mucosa of the bladder, and can be classified into urothelial (transitional) cell carcinoma, squamous cell carcinoma, adenocarcinoma, and some rare small cell carcinomas, mixed-type, carcinoma sarcoma, metastatic carcinoma, etc., according to the tissue type thereof, wherein the urothelial carcinoma accounts for more than 90% of bladder cancers.
The term "diagnosis" includes auxiliary diagnosis, recurrence risk assessment, assessment of risk and extent of cancerous lesions, prognosis, and the like.
The term "gene" refers to a DNA segment encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, including exon and intron sequences, that are involved in gene transcription/translation and transcriptional/translational regulation.
The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.
The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.
The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. For example, in some cases, a comparison may be made based on the Ct value detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.
The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence.
The term "primer pair" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified.
The term "Taqman probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5 'to 3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe, and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.
The term "sanger sequencing", i.e., a generation of sequencing, the reaction system comprises: target fragment, four deoxyribonucleotides (dNTPs), DNA polymerase, primer, etc., and 4 kinds of dideoxyribonucleotides (ddNTPs) marked by different fluorophores are required. Because ddNTP lacks 3' -OH group required for extension, the extended oligonucleotide is selectively terminated at G, A, T or C, and the four optical wavelength signals are converted into computer recognizable electric signals through optical excitation, and the target DNA sequence is judged according to the fluorescence signal of the ddNTP finally doped in the reaction tube.
The research of the application shows that the HCG9 gene can be used as a biomarker for diagnosing bladder cancer, and the bladder cancer is diagnosed by detecting the methylation level of the HCG9 gene, so that the HCG9 gene has higher specificity and can effectively improve the detection rate of early bladder cancer. Furthermore, abnormal methylation of cancer-associated genes usually occurs early in cancer and is relatively stable. Therefore, the bladder cancer diagnosis by detecting the methylation level of the HCG9 gene has good stability, high accuracy and easy early diagnosis. In addition, the product for diagnosing bladder cancer prepared by taking the HCG9 gene as a biomarker has low dependence on the technical level of doctors, is non-invasive and has good application prospect.
Based on the above, an embodiment of the present application provides an application of a reagent for detecting methylation of HCG9 gene in preparing a product for diagnosing bladder cancer.
Specifically, the HCG9 Gene is located on human chromosome 6, in NCBI database, gene ID of HCG9 Gene: 10255.
in some embodiments, the target region (simply "target region") for detecting the methylation level of the HCG9 gene, with grch38.p13 as a reference, is: chr6:29975312 ～ 29975949, full length or partial region.
Optionally, the target region is a full length or partial region Chr6 of at least one of the following regions: 29975312 ～ 29975466, chr6:29975464 ～ 29975604, chr6:29975602 ～ 29975770, chr6:29975776 ～ 29975919, chr6:29975778 ～ 29975949, chr6:29975434 ～ 29975778, chr6:29975313 ～ 29975456, chr6:29975318 ～ 29975431, chr6:29975491 ～ 29975645, chr6:29975633 ～ 29975765, chr6:29975720 ～ 29975823, chr6:29975618 ～ 29975706 and Chr6:29975318 ～ 29975448.
Further, the target region is a full length or partial region of at least one of the following: chr6:29975312 ～ 29975466 plus strand, chr6:29975464 ～ 29975645 plus strand, chr6:29975602 ～ 29975770 plus strand, chr6:29975776 ～ 29975919 plus strand, chr6:29975720 ～ 29975949 minus strand, chr6:29975434 ～ 29975778 minus strand and Chr6:29975313 ～ 29975456.
In one embodiment, the target region is a full length or partial region of at least one of the following: chr6: positive strand within 29975312 ～ 29975466 region, chr6: positive strand within 29975464 ～ 29975604 region, chr6: positive strand within 29975602 ～ 29975770 region, chr6: positive strand within 29975776 ～ 29975919 region, chr6: negative strand within 29975778 ～ 29975949 region, chr6: negative strand within 29975434 ～ 29975778 region, chr6: negative strand within 29975313 ～ 29975456 region, chr6: positive strand within 29975318 ～ 29975431 region, chr6: positive strand within region 29975491 ～ 29975645, positive strand within region Chr6:29975633 ～ 29975765, chr6: negative strand within 29975720 ～ 29975823 region, chr6: negative strand within 29975618 ～ 29975706 region and Chr6: negative strand within region 29975318 ～ 29975448.
Further, the target region is Chr6:29975618 ～ 29975765, full length or partial region. Still further, the target region is Chr6:29975618 ～ 29975706, full length or partial region.
It is understood that DNA on a chromosome is a double-stranded structure consisting of a positive strand and a negative strand. In this context, if the region is not indicated as a positive strand or a negative strand of DNA, it means that the region may be a positive strand of DNA, a negative strand of DNA, or both positive and negative strands of DNA. For example, if region Chr6:29975618 ～ 29975706 is described as "Chr6:29975618 ～ 29975706", then the representation may be Chr6: the plus strand of DNA within the 29975618 ～ 29975706 region may also be Chr6: the negative strand of DNA within the 29975618 ～ 29975706 region can also be Chr6: the positive and negative strands of DNA within the 29975618 ～ 29975706 region. If region Chr6:29975618 ～ 29975706 is described as "Chr6: positive strand within 29975618 ～ 29975706 region "or" Chr6:29975618 ～ 29975706 positive strand ", then Chr6: a plus strand of DNA within the 29975618 ～ 29975706 region; if region Chr6:29975618 ～ 29975706 is described as "Chr6: negative strand within 29975618 ～ 29975706 region "or" Chr6:29975618 ～ 29975706, then Chr6: the negative strand of DNA within the 29975618 ～ 29975706 region. In addition, "Chr6:29975706 ～ 29975618 "also represents Chr6: negative strand of DNA in region 29975618 ～ 29975706.
Based on the above, an embodiment of the present application further provides a kit for detecting bladder cancer, which includes a reagent for detecting the methylation level of the HCG9 gene.
Further, with grch38.p13 as a reference, reagents for detecting the methylation level of the HCG9 gene are capable of detecting chr6: methylation levels in full or partial regions of 29975312 ～ 29975949 regions.
Alternatively, the reagent for detecting the methylation level of the HCG9 gene is capable of detecting the methylation level of a full length or partial region of at least one of the following regions:
chr6:29975312 ～ 29975466, chr6:29975464 ～ 29975604, chr6:29975602 ～ 29975770, chr6:29975776 ～ 29975919, chr6:29975778 ～ 29975949, chr6:29975434 ～ 29975778, chr6:29975313 ～ 29975456, chr6:29975318 ～ 29975431, chr6:29975491 ～ 29975645, chr6:29975633 ～ 29975765, chr6:29975720 ～ 29975823, chr6:29975618 ～ 29975706 and Chr6:29975318 ～ 29975448.
Further, the reagent for detecting the methylation level of the HCG9 gene is capable of detecting the methylation level of a full length or partial region of at least one of the following regions: chr6:29975312 ～ 29975466 plus strand, chr6:29975464 ～ 29975645 plus strand, chr6:29975602 ～ 29975770 plus strand, chr6:29975776 ～ 29975919 plus strand, chr6:29975720 ～ 29975949 minus strand, chr6:29975434 ～ 29975778 minus strand and Chr6:29975313 ～ 29975456.
In one embodiment, the reagent for detecting the methylation level of the HCG9 gene is capable of detecting the methylation level of at least one of the following regions: chr6: positive strand within 29975312 ～ 29975466 region, chr6: positive strand within 29975464 ～ 29975604 region, chr6: positive strand within 29975602 ～ 29975770 region, chr6: positive strand within 29975776 ～ 29975919 region, chr6: negative strand within 29975778 ～ 29975949 region, chr6: negative strand within 29975434 ～ 29975778 region, chr6: negative strand within 29975313 ～ 29975456 region, chr6: positive strand within 29975318 ～ 29975431 region, chr6: positive strand within region 29975491 ～ 29975645, positive strand within region Chr6:29975633 ～ 29975765, chr6: negative strand within 29975720 ～ 29975823 region, chr6: negative strand within 29975618 ～ 29975706 region and Chr6: negative strand within region 29975318 ～ 29975448.
Further, reagents for detecting the methylation level of the HCG9 gene are capable of detecting Chr6: methylation levels in full or partial regions within the 29975618 ～ 29975765 region. Still further, reagents for detecting the methylation level of the HCG9 gene are capable of detecting Chr6: methylation levels in full or partial regions within the 29975618 ～ 29975706 region.
In some embodiments, the reagents for detecting the methylation level of the HCG9 gene comprise a primer pair. Specifically, the primer pair includes at least one of the following primer pairs: for detecting Chr6: a first primer pair for detecting the methylation level of the plus strand of a full or partial region within the 29975312 ～ 29975466 region for Chr6: a second primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975464 ～ 29975645 for Chr6: a third primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975602 ～ 29975770 for Chr6: a fourth primer pair for detecting the methylation level of the plus strand of the full or partial region within region 29975776 ～ 29975919 for Chr6: fifth primer pair for detecting the methylation level of the negative strand of the full or partial region within region 29975720 ～ 29975949 for Chr6: a sixth primer pair for detecting Chr6 for methylation level of the negative strand of the full or partial region within region 29975434 ～ 29975778: a seventh primer pair for methylation level of the negative strand of the full length or partial region within the 29975313 ～ 29975456 region.
In some embodiments, the above-described kit uses sanger sequencing to determine the methylation level of the HCG9 gene. Specifically, the reagent for detecting the methylation level of the HCG9 gene of the kit comprises a primer pair. Further, the primer pair includes at least one set of the following primer pairs:
For detecting Chr6: a first primer pair of the methylation level of the plus strand of the full length or partial region within the 29975312 ～ 29975466 region having the nucleotide sequence set forth in SEQ ID NO:1 to 2; for detecting Chr6: a second primer pair of the methylation level of the plus strand of the full length or partial region within the 29975464 ～ 29975604 region having the nucleotide sequence set forth in SEQ ID NO:3 to 4; for detecting Chr6: a third primer pair of the methylation level of the plus strand of the full length or partial region within the 29975602 ～ 29975770 region, which has the nucleotide sequence set forth in SEQ ID NO:5 to 6; for detecting Chr6: a fourth primer pair of the methylation level of the positive strand of the full length or partial region within the 29975776 ～ 29975919 region, which has a nucleotide sequence as set forth in SEQ ID NO:7 to 8; for detecting Chr6: a fifth primer pair of the methylation level of the negative strand of the full length or partial region within the 29975778 ～ 29975949 region, which has the nucleotide sequence set forth in SEQ ID NO:9 to 10; for detecting Chr6: a sixth primer pair of the methylation level of the negative strand of the full length or partial region within the 29975434 ～ 29975778 region, which has the nucleotide sequence set forth in SEQ ID NO:11 to 12; for detecting Chr6: a seventh primer pair of the methylation level of the negative strand of the full length or partial region within the 29975313 ～ 29975456 region, which has a nucleotide sequence as set forth in SEQ ID NO:13 to 14.
In other embodiments, the above-described kit uses a fluorescent quantitative PCR method to determine the methylation level of the HCG9 gene. Specifically, the reagent for detecting the methylation level of the HCG9 gene of the kit comprises a primer pair and a detection probe corresponding to the primer pair, wherein a fluorescent group is connected to the detection probe.
Further, the primer pair includes at least one set of the following primer pairs:
for detecting Chr6: a first primer pair of the methylation level of the plus strand of the full length or partial region within the 29975318 ～ 29975431 region having the nucleotide sequence set forth in SEQ ID NO:15 to 16; for detecting Chr6: a second primer pair of the methylation level of the plus strand of the full length or partial region within the 29975491 ～ 29975645 region having the nucleotide sequence set forth in SEQ ID NO:18 to 19; for detecting Chr6: a third primer pair of the methylation level of the plus strand of the full length or partial region within the 29975633 ～ 29975765 region, which has the nucleotide sequence set forth in SEQ ID NO: 21-22; for detecting Chr6: a fifth primer pair of the methylation level of the negative strand of the full length or partial region within the 29975720 ～ 29975823 region, which has the nucleotide sequence set forth in SEQ ID NO:24 to 25; for detecting Chr6: a sixth primer pair of the methylation level of the negative strand of the full length or partial region within the 29975618 ～ 29975706 region, which has the nucleotide sequence set forth in SEQ ID NO:27 to 28; for detecting Chr6: a seventh primer pair of the methylation level of the negative strand of the full length or partial region within the 29975318 ～ 29975448 region, which has a nucleotide sequence as set forth in SEQ ID NO:30 to 31.
Further, with a sequence as set forth in SEQ ID NO: 15-16, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 17; and/or, with a sequence as set forth in SEQ ID NO: 18-19, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 20; and/or, with a sequence as set forth in SEQ ID NO: 21-22, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: indicated at 23; and/or, with a sequence as set forth in SEQ ID NO: 24-25, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 26; and/or, with a sequence as set forth in SEQ ID NO: 27-28, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 29; and/or, with a sequence as set forth in SEQ ID NO: 30-31, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 32.
In some embodiments, the kit for determining the methylation level of an HCG9 gene using a fluorescent quantitative PCR method further comprises an internal reference primer pair and an internal reference probe corresponding to the internal reference primer pair. Alternatively, the internal reference primer pair includes an ACTB primer pair designed for the ACTB gene. In an alternative specific example, the nucleotide sequences of the ACTB primer pair are set forth in SEQ ID NO: 33-34, the nucleotide sequence of the reference probe corresponding to the ACTB primer pair is shown as SEQ ID NO: shown at 35. It will be appreciated that in other embodiments, other genes may be selected as reference genes, in which case the reference primer pair and reference probe pair may be designed accordingly.
In an alternative specific example, the detection probe and the reference probe are Taqman probes. Further, the detection probe and the internal reference probe are both connected with a fluorescent group and a quenching group. Alternatively, the fluorescent moiety is located at the 5 'end of the probe and the quenching moiety is located at the 3' end of the probe. Optionally, the detection probe and the reference probe are respectively and independently connected with a fluorescent group selected from one of FAM, HEX, VIC, CY, ROX, texsa Red, JOE and Quasar 705. Of course, when two or more types of probes are present in the same reaction system, the fluorescent groups attached to different probes are different. It will be appreciated that the fluorophores attached to the detection and reference probes are not limited to the above, but may be other fluorophores.
In some embodiments, the kit of any of the above embodiments further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control reagent, a PCR reaction reagent, and a sequencing reagent. Nucleic acid extraction reagents for extracting nucleic acids; methylation converting reagents are used to deaminate unmethylated cytosines in DNA to uracil while methylated cytosines remain unchanged; the quality control reagent is used for quality control; the PCR reaction reagent is used for constructing a PCR amplification reaction system; nucleic acid sequencing reagents are used for sequencing.
In one embodiment, the methylation conversion reagent is a sulfite conversion reagent or an enzymatic conversion reagent.
In one embodiment, the PCR reagent comprises PCR buffer, dNTPs, mgCl 2 And DNA polymerase.
In one embodiment, the quality control reagent includes a positive reference and a negative reference.
It will be appreciated that in other embodiments, the method of detecting the methylation level of the HCG9 gene using the above-described bladder cancer detection kit is not limited to fluorescence quantification and sanger sequencing, but may be other methods, such as bisulfite sequencing, methylation-specific PCR, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, or methylation-sensitive restriction endonuclease.
In some embodiments, suitable samples for the above-described bladder cancer detection kit include, but are not limited to, urine, tissue samples.
Proved by verification, the detection sensitivity of the detection kit for the bladder cancer can reach 90.63%, the specificity can reach 94.87%, and the early diagnosis of the bladder cancer is facilitated.
DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION
The following is a detailed description of specific embodiments. The following examples are not specifically described but do not include other components than the unavoidable impurities. Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples were carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer.
Example 1
Methylation state of HCG9 gene region chr6:29975312 ～ 29975949 based on Sanger sequencing and sensitivity and specificity assessment of method
1. Sample collection
Urine samples of 64 bladder cancer patients diagnosed by pathological examination and 78 healthy people who perform routine physical examination are collected in a certain Wuhan hospital, and the volume of each urine sample collected is more than 50mL. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.
2. Extraction of DNA from urine
The DNA of the urine sample was extracted using the nucleic acid extraction kit (Ehan Instrument No. 20210740) from the Living technologies of Wuhan Ai Misen, as follows.
1) Cleavage binding
A clean 5mL centrifuge tube was prepared, to which 100. Mu.L proteinase K was added. After being mixed uniformly, urine is split into 2mL and added into a tube added with proteinase K, 2mL of splitting combined solution and 20 mu L of magnetic beads are sequentially added, and after being mixed uniformly upside down, the mixture is placed on a square mixing instrument for splitting at room temperature for 30min, and the magnetic beads are kept in a suspension state.
2) Washing
Placing the centrifuge tube on a magnetic rack, and attracting magnetism for 2min until the solution is clarified, and reversing the washing of the residual magnetic beads on the tube cover for several times until the complete attraction of magnetism. Carefully sucking the waste liquid, adding 2mL of washing liquid, uniformly mixing for more than 10 times by vortex, completely dispersing the magnetic beads, sucking magnetism for 2min, reversing the residual magnetic beads on the flushing pipe cover for several times until the complete magnetic suction is achieved after the solution is clarified.
3) Rinsing
Carefully sucking the waste liquid, firstly adding 500 mu L of rinsing liquid to wash the magnetic beads to the bottom, transferring the magnetic bead suspension to a new 2mL centrifuge tube, then adding 500 mu L of rinsing liquid to completely wash the residual magnetic beads on the wall of the 5mL centrifuge tube to the bottom, transferring all the magnetic bead suspension to the 2mL centrifuge tube after instantaneous centrifugation, and carrying out vortex mixing for more than 10 times to completely disperse the magnetic beads, carrying out magnetic attraction for 2min, and reversing the residual magnetic beads on a flushing tube cover for several times until the magnetic attraction is completed after the solution is clarified. The rinsing was repeated once.
4) Elution
Taking down the centrifuge tube, centrifuging briefly to collect residual liquid, placing the centrifuge tube on a magnetic rack, and sucking the residual liquid by using a small gun head after the magnetic attraction is completed. And (5) opening the cover of the centrifuge tube and placing for 5 minutes to enable the surface of the magnetic beads to be matt. Adding 50 μl of TE eluent, gently shaking to disperse the magnetic beads, standing at 56 deg.C for 10min, and taking out at intervals of 3min to make the magnetic beads in suspension.
5) Collecting
Taking out the centrifuge tube, centrifugally collecting the liquid on the tube cover and the tube wall, placing the centrifuge tube on a magnetic rack for attracting magnetism for 1min, and carefully attracting the supernatant to obtain the DNA solution.
3. Urine DNA conversion
Adding 40. Mu.L of the DNA solution obtained in the step 2 to a 200. Mu.L PCR tube, adding 110. Mu.L of the transformation mixture, mixing uniformly, and setting a program in a PCR instrument: 95 ℃ for 10min,64 ℃ for 90min, and 4 ℃ to 8 ℃ for 1h.
4. Urine DNA purification
1) Transferring the conversion product obtained in the step 3 into a 2mL centrifuge tube, adding 600 mu L of binding solution and 10 mu L of magnetic beads, uniformly mixing, standing and combining for 15min, and vibrating and uniformly mixing for 5s every 3min to enable the magnetic beads to be in a suspension state all the time; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed.
2) Adding 600 mu L of rinsing liquid, and uniformly vortex-mixing for 20s to disperse magnetic beads; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed.
3) Adding 800 mu L of desulfurizing agent, vortex mixing for 20s to disperse magnetic beads, standing for 15min at room temperature for desulfurization, and shaking and mixing for 5s every 5min during the desulfurization, so that the magnetic beads are always in a suspension state.
4) Adding 800 mu L of rinsing liquid, and uniformly vortex-mixing for 20s to disperse magnetic beads; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed.
5) Repeating step 4) once.
6) Collecting liquid to the bottom of the tube by short centrifugation, placing the centrifuge tube on a magnetic rack, and carefully sucking out the supernatant; the cover is opened and left at room temperature for about 5 minutes until the surface of the magnetic beads is matt.
7) Adding 20-50 mu L of eluent TE, and swirling to enable the magnetic beads to be fully suspended in the eluent, incubating for 10min at 56 ℃, and uniformly mixing every 3min during the incubation to promote the full elution of nucleic acid.
8) And (3) collecting: the centrifuge tube was briefly centrifuged and placed on a magnetic rack for 2min to transfer the DNA solution to a new centrifuge tube.
PCR amplification and sequencing
The PCR reaction system was prepared according to Table 2 using the DNA of the urine sample obtained in step 4 as a template and degenerate primer pairs in Table 1 as primers (both methylated and unmethylated DNA fragments were amplified) and PCR amplification was performed according to the amplification procedure shown in Table 3 to obtain the respective gene regions of HCG 9. After the end of PCR amplification, the amplified products were Mulberry sequenced using the degenerate primers of Table 1 as sequencing primers, respectively, and the sequencing was carried out by the sequencing company while sequencing from the 5 'and 3' ends.
TABLE 1 sequencing primers for HCG9 Gene regions 1-7
Specific information of regions 1 to 7 of the HCG9 gene in table 1 is as follows:
HCG9 Gene region 1 plus strand (Chr 6:29975312 ～ 29975466) DNA sequence:
GGCCCGCCCTGGAGCTGAGAACACGCGGACTCCAGGGAGAGGACAGGGCTTCAGGGACCCGAGAGCCGCTCTGAGCACCGGGGGATGTGACTGCCTCAGCGGCAGAGCTGGAAGGGCCCTCGAATGCCATTCACAGGAACAGCCCAGGAACCCAG。
HCG9 gene region 2 plus strand (Chr 6:29975464 ～ 29975604) DNA sequence:
CAGGGACTTCAGAAGGGCTGGTTTGTCCGAAAAGTGAGAGGAGGCGGAGGAGAGGTGAGGAGAGCAAGTGCAAGAAGAGACCAGAAAGTGCAGGGGGTGGGGGTGATGCGCGATCCCGAGGAGGACTGAAAAGAGACTGAA。
HCG9 Gene region 3 plus strand (Chr 6:29975602 ～ 29975770) DNA sequence:
GAAAAGCAGGGCTGAGGAGTGGCGGCAACCGGCAGCGTCCAGCTCCCGCACCTCGCTGCACATCGCACCTGAGCCCCGCCGCGACCGCATCGCGCTCGCTGCGACCCATTCAGACCCCCCAGAAACGCCAAGCCGCTCCCGCTCTAGCCGAGGGCTAGAACAATCCTGC。
HCG9 gene region 4 plus strand (Chr 6:29975776 ～ 29975919) DNA sequence:
CAGCCTCCTGAGTAGTTGGGACTACAAGCGAGTGCCACCACGTCCAGCTGTCATTTACCATCTGGTACCAACCCCCATTAGACAATGAACCATCCATGATCACGAACTGTGTCCCTTCCATCTTCGTCAGCTTTAGGAGCATTT。
HCG9 Gene region 5 minus strand (Chr 6:29975949 ～ 29975778) DNA sequence:
TAATCATAGGTGGAGTTCCATTGGGAAAAAAAATGCTCCTAAAGCTGACGAAGATGGAAGGGACACAGTTCGTGATCATGGATGGTTCATTGTCTAATGGGGGTTGGTACCAGATGGTAAATGACAGCTGGACGTGGTGGCACTCGCTTGTAGTCCCAACTACTCAGGAGGC。
HCG9 Gene region 6 minus strand (Chr 6:29975778 ～ 29975434) DNA sequence:
CTGAGGTGGCAGGATTGTTCTAGCCCTCGGCTAGAGCGGGAGCGGCTTGGCGTTTCTGGGGGGTCTGAATGGGTCGCAGCGAGCGCGATGCGGTCGCGGCGGGGCTCAGGTGCGATGTGCAGCGAGGTGCGGGAGCTGGACGCTGCCGGTTGCCGCCACTCCTCAGCCCTGCTTTTCAGTCTCTTTTCAGTCCTCCTCGGGATCGCGCATCACCCCCACCCCCTGCACTTTCTGGTCTCTTCTTGCACTTGCTCTCCTCACCTCTCCTCCGCCTCCTCTCACTTTTCGGACAAACCAGCCCTTCTGAAGTCCCTGGGTTCCTGGGCTGTTCCTGTGAATGGCATT。
HCG9 Gene region 7 minus strand (Chr 6:29975456 ～ 29975313) DNA sequence:
GGGCTGTTCCTGTGAATGGCATTCGAGGGCCCTTCCAGCTCTGCCGCTGAGGCAGTCACATCCCCCGGTGCTCAGAGCGGCTCTCGGGTCCCTGAAGCCCTGTCCTCTCCCTGGAGTCCGCGTGTTCTCAGCTCCAGGGCGGGC。
TABLE 2PCR reaction System
| Component (A) | Dosage (mu L) |
| 10×Taq buffer(Mg 2+ Free) | 5 |
| 25mM Mg 2+ | 4 |
| dNTP Mix(10mM each) | 1 |
| Upstream primer (10. Mu.M) | 1 |
| Downstream primer (10. Mu.M) | 1 |
| Hot Start Taq DNA polymerase | 0.5 |
| Template DNA | 10 |
| Ultrapure water | Supplement to 50 |
TABLE 3PCR amplification procedure
6. Analysis of results
For successfully sequenced sequences, methylation of different CpG sites in each amplicon of each sample was analyzed according to the sequencing peak map. Methylation of cytosine in a CpG dinucleotide is classified into two types, namely unmethylation and methylation, where methylation is classified into complete methylation and partial methylation. If thymine is the result of cytosine sequencing in a CpG dinucleotide, it is unmethylated. If the cytosine sequencing result in a CpG dinucleotide is still cytosine, it is fully methylated. If the cytosine sequencing results in a CpG dinucleotide with both cytosine and thymine (bimodal), it is partially methylated.
If more than 95% of the cytosine in a CpG dinucleotide in an amplicon is methylated, the sample is considered methylation positive in that region of the gene. The number of methylation positives and the number of methylation negatives in each type of sample were calculated, and the ratio of methylation positives to methylation negatives was calculated. Sensitivity is the proportion of methylation positives in samples with positive pathological results. Specificity is the proportion of methylation negative in samples whose pathology results are negative. The methylation status, sensitivity and specificity of HCG9 gene regions 1-7 in urine samples of 64 bladder cancer patients and 78 healthy persons are shown in Table 4.
TABLE 4 sensitivity and specificity of HCG9 Gene regions 1-7 in urine samples
As can be seen from Table 4, the HCG9 gene regions 1 to 7 gave different results in detecting urine samples. Specifically, the sensitivity of the area 3 and the area 6 for detecting urine samples of patients with bladder cancer is higher than 70%, and the specificity of the area for detecting urine samples of healthy people is higher than 88%; the sensitivity and specificity of detecting cancer samples and healthy samples in the other regions than the regions 3 and 6 are not high. In conclusion, the sensitivity and the specificity of detecting urine samples by using the methylation level of the negative strand of HCG9 gene region Chr6:29975434 ～ 29975778 are higher based on the Sanger sequencing method.
Example 2
Methylation state of HCG9 gene Chr6:29975318 ～ 29975823 based on methylation fluorescent quantitative PCR detection and sensitivity and specificity assessment (paraffin tissue sample) of the method
After the DNA of the urine sample is extracted in example 1, the methylation state of the full length or partial region chr6:29975312 ～ 29975949 of the HCG9 gene region is detected by adopting a method combining bisulfite conversion and sanger sequencing, and considering that the method is complex in operation, time-consuming and labor-consuming and severely depends on sequencing companies, in order to improve the value of the kit in clinical application, the embodiment provides a method for detecting the methylation state of each region of the HCG9 gene based on methylation fluorescence quantitative PCR, which can judge the methylation state of the sample according to Ct value, and further judge whether the sample is a cancer sample.
1. Sample collection
64 cancer tissue samples of patients with bladder cancer and 64 corresponding paracancerous tissue samples were collected in a certain Wuhan hospital and confirmed by pathological examination, all of which were formalin-immersed and paraffin-embedded tissue samples. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.
2. Extraction of Paraffin tissue DNA
Tissue DNA was extracted using QIAamp DNA FFPE Tissue Kit (56404) and specific procedures were performed according to the kit instructions.
3. Conversion of bisulphite
The genome of the sample extracted in the step 2 is subjected to bisulphite conversion and purification, and the nucleic acid conversion kit is a nucleic acid conversion reagent (Ehan mechanical equipment 20200843) of the life technology limited company of Wuhan Ai Misen, and specific experimental operation is described in the specification of the kit.
4. Methylation quantitative PCR reaction
The sample DNA obtained in the step 3 after bisulfite conversion was used as a template, and the primer and probe in Table 5 were used to prepare a reaction system according to the formulation of Table 6, and a methylation quantitative PCR reaction was performed using a hot-start DNA polymerase under the conditions shown in Table 7. Each PCR reaction can detect the methylation level of one region of HCG9 gene in a certain sample, namely, a reaction tube is added with a detection primer and a probe corresponding to the target gene region, and meanwhile, a detection primer and a probe of an internal reference gene ACTB are also added. The probe of the detection target area is a Taqman probe, the reporter group at the 5 'end is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the ACTB probe is VIC, and the quenching group at the 3' end is BHQ1.
Table 5 detection primer and probe sequences for HCG9 Gene regions 8-13
The HCG9 gene regions 8 to 13 shown in table 5 and below are specifically as follows:
the forward base sequence of region 8 is as follows (5 'to 3'):
CCCTGGAGCTGAGAACACGCGGACTCCAGGGAGAGGACAGGGCTTCAGGGACCCGAGAGCCGCTCTGAGCACCGGGGGATGTGACTGCCTCAGCGGCAGAGCTGGAAGGGCCCT. The combination of the primer and probe of region 8 allows detection of methylation of cytosine at positions of region 8 forward strands Chr6:29975335, chr6:29975337, chr6:29975371, chr6:29975378, chr6:29975390 and Chr6: 29975411.
The forward base sequence of region 9 is as follows (5 'to 3'):
CGAAAAGTGAGAGGAGGCGGAGGAGAGGTGAGGAGAGCAAGTGCAAGAAGAGACCAGAAAGTGCAGGGGGTGGGGGTGATGCGCGATCCCGAGGAGGACTGAAAAGAGACTGAAAAGCAGGGCTGAGGAGTGGCGGCAACCGGCAGCGTCCAGCT. The combination of the primer and probe of region 9 can detect methylation of cytosine at positions of the forward strands of region 9, chr6:29975491, chr6:29975508, chr6:29975572, chr6:29975574, chr6:29975580, chr6:29975624, chr6:29975631 and Chr6: 29975637.
The forward base sequence of region 10 is as follows (5 'to 3'):
GCAGCGTCCAGCTCCCGCACCTCGCTGCACATCGCACCTGAGCCCCGCCGCGACCGCATCGCGCTCGCTGCGACCCATTCAGACCCCCCAGAAACGCCAAGCCGCTCCCGCTCTAGCCGAGGGCTAGAACAAT. The combination of the primer and probe of region 10 allows detection of methylation of cytosine at positions of the forward strands of region 10, chr6:29975637, chr6:29975648, chr6:29975655, chr6:29975678, chr6:29975681, chr6:29975683, chr6:29975687, chr6:29975692, chr6:29975741 and Chr6: 29975750.
The negative strand base sequence of region 11 is as follows (5 'to 3'):
GCTGGACGTGGTGGCACTCGCTTGTAGTCCCAACTACTCAGGAGGCTGAGGTGGCAGGATTGTTCTAGCCCTCGGCTAGAGCGGGAGCGGCTTGGCGTTTCTGG. The combination of the primer and probe of region 11 allows detection of methylation of cytosine at positions of region 11 negative strand Chr6:29975817, chr6:29975805, chr6:29975751, chr6:29975742, chr6:29975736 and Chr6: 29975728.
The negative strand base sequence of region 12 is as follows (5 'to 3'):
GTCGCAGCGAGCGCGATGCGGTCGCGGCGGGGCTCAGGTGCGATGTGCAGCGAGGTGCGGGAGCTGGACGCTGCCGGTTGCCGCCACTC. The combination of the primer and probe of region 12 allows detection of methylation of cytosine at positions of region 12 negative strands Chr6:29975704, chr6:29975699, chr6:29975695, chr6:29975693, chr6:29975688, chr6:29975684, chr6:29975682, chr6:29975679, chr6:29975638, chr6:29975632 and Chr6: 29975625.
The negative strand base sequence of region 13 is as follows (5 'to 3'):
CCTGTGAATGGCATTCGAGGGCCCTTCCAGCTCTGCCGCTGAGGCAGTCACATCCCCCGGTGCTCAGAGCGGCTCTCGGGTCCCTGAAGCCCTGTCCTCTCCCTGGAGTCCGCGTGTTCTCAGCTCCAGGG. The combination of the primer and probe of region 13 allows detection of methylation of cytosine at positions of region 13 negative strands Chr6:29975433, chr6:29975391, chr6:29975379, chr6:29975372, chr6:29975338 and Chr6: 29975336.
TABLE 6PCR reaction System
| Component (A) | Specification of specification | Volume (mu L) |
| Platinum II PCR buffer | 5× | 5 |
| dNTPs | 2.5mM each | 3 |
| Primers for upstream of target gene region | 10μM | 0.5 |
| Primers downstream of the gene region of interest | 10μM | 0.5 |
| Target gene region probe | 10μM | 0.5 |
| ACTB upstream primer | 10μM | 0.5 |
| ACTB downstream primer | 10μM | 0.5 |
| ACTB probe | 10μM | 0.5 |
| Taq enzyme | / | 0.5 |
| DNA of sample to be tested | / | 5 |
| Purified water | / | Supplement to 25 |
TABLE 7PCR amplification procedure
In addition, negative and positive controls: when different areas of the target gene are detected respectively, the negative control and the positive control are detected synchronously. The negative control was purified water. The positive control preparation method comprises the following steps: complete bisulphite corresponding to the amplified region of ACTBThe converted sequence is synthesized artificially and cloned to a vector to form an artificially synthesized plasmid. The bisulfite converted sequences corresponding to the completely methylated HCG9 gene regions 8-13 are artificially synthesized and cloned into vectors to form artificial synthetic plasmids. Positive control of HCG9 Gene regions 8 to 13 was 10 3 Copy/microliter ACTB synthetic plasmid and 10 3 Copy/microliter of synthetic plasmid 1 at regions 8-13: 1, e.g. the positive control in zone 8 is 10 3 Copy/microliter ACTB synthetic plasmid and 10 3 Copy/microliter of region 8 of the synthetic plasmid 1:1 were mixed.
Analysis of PCR results:
1) Ct value reading: after the PCR is completed, a baseline is adjusted, a fluorescent value of a sample before 1-2 cycles in advance in one PCR is set as a baseline value, and a threshold value is set at the inflection point of an S-type amplification curve to obtain the Ct value of each gene of the sample.
2) And (3) quality control: the negative control needs no amplification, the positive control needs obvious index increase period, and the Ct value of the positive control is between 26 and 30. The Ct value of the reference gene of the sample to be detected is less than or equal to 35, and after the negative control, the positive control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.
3) Result analysis and interpretation method: when the Ct value of a certain detection area on a tissue sample is less than or equal to 38, the sample is considered to be detected to be methylated in the area, namely the cancer is positive; if the Ct value of a certain detection area on a tissue sample is greater than 38, the sample is considered to be methylation negative in the detection area, namely cancer negative. The negative and positive of the tissue sample were judged based on Ct values obtained by methylation quantitative PCR experiments, and the results are shown in Table 8.
TABLE 8 sensitivity and specificity of HCG9 Gene regions 8-13 in tissue samples
As can be seen from Table 8, the HCG9 gene regions 8 to 13 have different effects in detecting the bladder cancer tissue sample. Wherein, the sensitivity of the region 10 and the region 12 for detecting the bladder cancer tissue sample is higher than 89%, and the specificity of the tissue sample beside the cancer is higher than 87%; the sensitivity and specificity of detecting cancer tissue samples and paracancerous tissue samples in other areas than areas 10 and 12 is not high. Moreover, the detection effect of the region 12 is slightly better than that of the region 10. Thus, the sensitivity and specificity of distinguishing whether a tissue sample is cancerous or not is higher by the methylation state of the negative strand of HCG9 gene region 12 (Chr 6:29975618 ～ 29975706).
Example 3
Methylation state of HCG9 gene Chr6:29975318 ～ 29975823 is detected based on methylation fluorescence quantitative PCR, and sensitivity and specificity evaluation (urine sample) of the method are carried out, wherein the method comprises the following specific steps:
1. the urine sample collection, urine DNA extraction, transformation and purification steps are the same as in example 1.
2. Methylation fluorescent quantitative PCR reactions were performed on the bisulfite-converted DNA in each urine sample to detect the methylation levels of the HCG9 gene regions 8-13 in each sample, wherein the specific detection method is the same as in example 2. The analysis method of the PCR results is as follows: when the Ct value of a certain detection area on a urine sample is less than or equal to 45, the sample is considered to be detected to be methylated in the area, namely the sample is positive for cancer; if the Ct value of a certain detection area on a urine sample is greater than 45, the sample is considered to be methylation negative in the detection area, namely cancer negative.
3. The negative and positive of the sample were judged based on the Ct value obtained, and the sensitivity and specificity of the sample for detecting urine were calculated, and the results are shown in Table 9.
TABLE 9 sensitivity and specificity of HCG9 Gene regions 8-13 in urine samples
As can be seen from Table 9, the HCG9 gene regions 8 to 13 have different effects in detecting urine samples from patients with bladder cancer and urine samples from healthy persons. Wherein, the sensitivity of the area 10 and the area 12 for detecting the urine sample of the bladder cancer is higher than 85 percent, and the specificity of the area for detecting the urine sample of the healthy person is higher than 89 percent; the other areas than areas 10 and 12 are less sensitive and specific for detecting urine samples from cancer patients and healthy people. In contrast, the detection sensitivity and specificity of HCG9 gene region 12 is higher than region 10. Therefore, based on the methylation fluorescence quantitative PCR method, the methylation state of the HCG9 gene region 12 (negative strand, chr6:29975618 ～ 29975706) can be used for evaluating whether the urine sample of the subject is positive for bladder cancer, and the detection effect is better.
The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.
The above examples merely represent a few embodiments of the present invention, which facilitate a specific and detailed understanding of the technical solutions of the present invention, but are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. It should be understood that, based on the technical solutions provided by the present invention, those skilled in the art can obtain technical solutions through logical analysis, reasoning or limited experiments, which are all within the scope of protection of the appended claims. The scope of the patent of the invention should therefore be determined with reference to the appended claims, which are to be construed as in accordance with the doctrines of claim interpretation.
Sequence listing
<110> Wuhan Ai Misen life technologies Co., ltd
<120> use of reagent for detecting methylation of HCG9 gene in preparation of product for diagnosing bladder cancer
<160> 35
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ggttcgtttt ggagttgaga ata 23
<210> 2
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gggctaaatt cctaaactat tcctata 27
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gtagggattt tagaagggtt gg 22
<210> 4
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gttcaatctc ttttcaatcc tcc 23
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gaaaagtagg gttgaggagt gg 22
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tgggacaaaa ttattctaac cct 23
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gggtagtttt ttgagtagtt ggg 23
<210> 8
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gggggaaata ctcctaaaac taac 24
<210> 9
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
taattatagg tggagtttta ttggg 25
<210> 10
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
ggacctccta aataattaaa actacaa 27
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ttgaggtggt aggattgttt tagt 24
<210> 12
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
aataccattc acaaaaacaa ccc 23
<210> 13
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
gggttgtttt tgtgaatggt att 23
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
acccgcccta aaactaaaaa c 21
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
ttttggagtt gagaatacgc g 21
<210> 16
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
aaaacccttc caactctacc g 21
<210> 17
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
tcgagagtcg ttttgagtat cgggg 25
<210> 18
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
cgaaaagtga gaggaggcg 19
<210> 19
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
aactaaacgc taccgattac cg 22
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
ggggtgatgc gcgatttcga 20
<210> 21
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
gtagcgttta gttttcgtat ttcg 24
<210> 22
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
attattctaa ccctcgacta aaacg 25
<210> 23
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
atttgagttt cgtcgcgatc gtatc 25
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
gttggacgtg gtggtattcg 20
<210> 25
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
ccaaaaacgc caaaccg 17
<210> 26
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
gggttttcgg ttagagcggg ag 22
<210> 27
<211> 16
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
tgtcgtagcg agcgcg 16
<210> 28
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
aaataacgag aaccgacaac g 21
<210> 29
<211> 15
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
atgcggtcgc ggcgg 15
<210> 30
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
tttgtgaatg gtattcgagg g 21
<210> 31
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
ccctaaaact taaaacacgc g 21
<210> 32
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
cggtgtttag agcggttttc gg 22
<210> 33
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
aaggtggttg ggtggttgtt ttg 23
<210> 34
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
aataacaccc ccaccctgc 19
<210> 35
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
ggagtggttt ttgggtttg 19
Claims (6)
1. Use of an agent for detecting methylation level in the preparation of a product for diagnosing bladder cancer; with grch38.p13 as a reference, the reagent is capable of detecting Chr6: the methylation level of the negative strand in the 29975618-29975706 region;
the reagent comprises a primer pair and a detection probe corresponding to the primer pair;
the nucleotide sequence of the primer pair is shown as SEQ ID NO: 27-28;
the nucleotide sequence of the detection probe corresponding to the primer is shown as SEQ ID NO: 29.
2. A kit for detecting bladder cancer, comprising reagents for detecting the methylation level of the region of claim 1;
the reagent comprises a primer pair and a detection probe corresponding to the primer pair;
the nucleotide sequence of the primer pair is shown as SEQ ID NO: 27-28;
the nucleotide sequence of the detection probe corresponding to the primer is shown as SEQ ID NO: 29.
3. The kit of claim 2, wherein the kit detects the methylation level of the HCG9 gene by at least one of the following methods: methylation-specific PCR, fluorescent quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, and methylation-sensitive restriction endonuclease.
4. The kit of claim 2, further comprising at least one of a nucleic acid extraction reagent and a methylation conversion reagent.
5. The kit according to claim 4, wherein the methylation reagent is a sulfite reagent or an enzymatic reagent.
6. The kit according to any one of claims 2 to 5, wherein the sample to which the kit is applied comprises urine or a tissue sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210542498.9A CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210542498.9A CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114959030A CN114959030A (en) | 2022-08-30 |
| CN114959030B true CN114959030B (en) | 2023-08-01 |
Family
ID=82984093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210542498.9A Active CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114959030B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604563A (en) * | 2021-06-02 | 2021-11-05 | 武汉艾米森生命科技有限公司 | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2675290A1 (en) * | 2007-01-23 | 2008-07-31 | Centre For Addiction And Mental Health | Dna methylation changes associated with major psychosis |
| US9670551B2 (en) * | 2007-11-30 | 2017-06-06 | Genomictree, Inc. | Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene |
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| CN109415771A (en) * | 2016-07-08 | 2019-03-01 | 哈鲁曼有限公司 | The determination method of colorectal cancer initiation potential |
| CN110872631B (en) * | 2019-12-26 | 2021-08-10 | 广州市基准医疗有限责任公司 | DNA methylation biomarker combination, detection method and kit |
-
2022
- 2022-05-18 CN CN202210542498.9A patent/CN114959030B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604563A (en) * | 2021-06-02 | 2021-11-05 | 武汉艾米森生命科技有限公司 | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114959030A (en) | 2022-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113621704B (en) | Reagent and kit for detecting and diagnosing liver cancer | |
| CN109652541B (en) | Methylation-modification-based tumor marker STAMP-EP6 | |
| CN114891886B (en) | Nucleic acid product, kit and application for diagnosing bladder cancer | |
| CN114959030B (en) | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer | |
| CN109988844B (en) | Tumor marker STAMP-EP7 based on methylation modification and application thereof | |
| CN115786502B (en) | Use of an agent for detecting the methylation level of a target region for the preparation of a diagnostic product for bladder cancer | |
| CN115094139B (en) | Application of reagent for detecting methylation level in preparation of bladder cancer diagnosis product and bladder cancer diagnosis kit | |
| WO2014078913A1 (en) | A method of detecting methylation | |
| CN114941029B (en) | Biomarker, nucleic acid product and kit for liver cancer | |
| CN115948561B (en) | Reagent and detection kit for esophageal squamous carcinoma diagnosis or auxiliary diagnosis and application thereof | |
| CN111088358B (en) | Colorectal cancer molecular marker combination, application thereof, primer group and detection kit | |
| CN117587124A (en) | Detection reagent and kit for diagnosing pancreatic cancer and application thereof | |
| CN115927610A (en) | Application of reagent for detecting methylation level of target region in FOXO6 gene in preparation of bladder cancer diagnosis product | |
| CN115838799A (en) | Application of reagent for detecting gene methylation in preparation of product for diagnosing colorectal cancer | |
| CN116083586A (en) | Nucleic acid product, kit and application for diagnosing esophageal cancer | |
| CN116287227A (en) | Reagent and kit for diagnosing prostate cancer | |
| CN116179694A (en) | Application of reagent for detecting methylation level in preparation of prostate cancer diagnosis product and prostate cancer diagnosis kit | |
| CN115838798A (en) | Application of reagent for detecting methylation level in preparation of colorectal cancer diagnosis product | |
| CN117248021A (en) | Nucleic acid combination, kit and application for detecting urothelial cancer or precancerous lesions | |
| CN117587125A (en) | Application of reagent for detecting methylation in preparation of pancreatic cancer diagnosis product | |
| CN116516005A (en) | Nucleic acid product for detecting head and neck squamous cell carcinoma, kit and application | |
| CN117327794A (en) | Reagent and kit for detecting benign and malignant lung nodules and application of reagent and kit | |
| CN117106774A (en) | Reagent for detecting methylation level and application of reagent in preparation of HPV negative head and neck squamous cell carcinoma diagnostic product | |
| CN117604095A (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN116676384A (en) | Biomarker for gastric cancer, nucleic acid product and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |