CN116083586A

CN116083586A - Nucleic acid product, kit and application for diagnosing esophageal cancer

Info

Publication number: CN116083586A
Application number: CN202310133651.7A
Authority: CN
Inventors: 周俊; 万康康; 熊杨辉
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-02-22
Filing date: 2023-02-20
Publication date: 2023-05-09
Also published as: CN114854855A

Abstract

The invention relates to a nucleic acid product for diagnosing esophageal cancer, a kit and application thereof. The nucleic acid product and the kit are prepared by detecting the HOXD1 gene Chr2: the methylation level of the 176889800-17689943 region can be used for diagnosing esophageal cancer. The nucleic acid product and the kit for diagnosing the esophageal cancer have higher sensitivity in the application process, can improve the detection rate of the esophageal cancer, improve the detection accuracy, are beneficial to realizing crowd diversion, improve the compliance of endoscopic examination and are beneficial to improving the early diagnosis rate of the esophageal cancer, especially the early esophageal cancer.

Description

Nucleic acid product, kit and application for diagnosing esophageal cancer

The present application claims priority from chinese patent application No. 202210161853.8, entitled "biomarker of esophageal cancer, nucleic acid product and kit" filed on day 22 of 2 months 2022, the entire contents of which are incorporated herein by reference.

Technical Field

The invention relates to the technical field of biology, in particular to a nucleic acid product for diagnosing esophageal cancer, a kit and application thereof.

Background

According to the latest statistics of GLOBOCAN2020, esophageal cancer is a tenth malignancy with a global incidence, and its mortality is the sixth. Although increased survival of esophageal cancer patients was observed in some studies, prognosis of esophageal cancer was relatively poor compared to other cancers, and most studies showed 5-year survival of esophageal cancer patients between 15% -25%. In a group study involving 1033 ESCC patients undergoing surgery, the 5-year survival rates of IA, IB, IIA, IIB, IIIA, IIIB, IIIC and IV patients were 84.9%, 70.9%, 56.2%, 43.3%, 37.9%, 23.3%, 12.9% and 3.4%, respectively (Evaluation of the 7. 7th edition of the TNM classification in patients with resected esophageal squamous cell carcinoma. World J Gastroenterol, 2014). In addition, the survival rate of patients with esophageal cancer with distant organ metastasis at the time of first diagnosis is particularly poor, and a retrospective study shows that these patients have a median survival of only 6 months, with survival rates of 21.1% or 11.8% for 1 year or 2 years, respectively (Analysis of prognostic factors for esophageal squamous cell carcinoma with distant organ metastasis at initial diagnosis. J chip Med Assoc, 2014). These evidences all indicate that early diagnosis and treatment of esophageal cancer can improve survival rate of patients with esophageal cancer.

Currently, endoscopy and pathology biopsy are gold standards for diagnosing early esophageal cancer. The change of the esophageal mucosa can be intuitively observed under an endoscope, the cancer state is evaluated, the lesion image data is shot or recorded, and the focus property, the position, the boundary and the range can be evaluated through methods of dyeing, amplifying and the like, so that the screening and the early diagnosis can be completed in one step. However, endoscope detection relies on hospital hardware equipment and doctor experience, has the disadvantages of invasiveness, low patient compliance and the like, and the screening amount of domestic endoscopes is far lower than the screening requirement of people with high incidence of Chinese esophageal cancer. In addition, although there are kits for diagnosing esophageal cancer using tumor markers, the sensitivity of these kits has yet to be improved.

Disclosure of Invention

Based on this, it is necessary to provide a nucleic acid product for diagnosing esophageal cancer, a detection kit and use thereof, so as to solve the problems of low sensitivity, low specificity and medical resource shortage of the traditional detection method for esophageal cancer.

In a first aspect, the present invention provides a nucleic acid product for diagnosing esophageal cancer, using grch38.p13 as a reference genome, for detecting the HOXD1 gene Chr2: methylation levels in the 176889800 to 17689943 region.

In some embodiments of the invention, the nucleic acid product achieves a gene Chr2 for HOXD1 by one or more of the following methods: detection of methylation level of 176889800 to 17689943 region: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

In some embodiments of the invention, the nucleic acid product comprises a nucleic acid sequence for detecting the HOXD1 gene Chr2: a methylation detection primer pair and a non-methylation detection primer pair for detecting the methylation level of a region from 176889800 to 17689943.

In some embodiments of the invention, the nucleotide sequences of the methylation detection primer pair are set forth in SEQ ID NO: 1-SEQ ID NO:2, the nucleotide sequence of the unmethylation detection primer pair is shown as SEQ ID NO: 3-SEQ ID NO: 4.

In some embodiments of the invention, the nucleic acid product comprises a nucleic acid sequence for detecting the HOXD1 gene Chr2: a 176889800-17689943 region methylation level detection primer pair and a detection probe corresponding to the detection primer pair.

In some embodiments of the invention, the detection probe comprises a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end.

In some embodiments of the invention, the fluorescent reporter group is selected from one of FAM, TET, VIC, JOE, HEX, cy3, cy3.5, cy5, cy5.5, NED, and Texas Red, and the fluorescent quenching group may be one selected from TAMRA, BHQ, and MGB.

In some embodiments of the invention, the nucleotide sequences of the detection primer pair and the detection probe corresponding thereto comprise at least one of the following nucleotide combinations:

nucleotide combination 1 comprising the nucleotide sequence set forth in SEQ ID NO: 1-SEQ ID NO:2 and a detection primer pair as shown in SEQ ID NO: 17;

nucleotide combination 2 comprising the nucleotide sequence as set forth in SEQ ID NO: 11-SEQ ID NO:12 and a detection primer set as set forth in SEQ ID NO: 18;

nucleotide combination 3 comprising the nucleotide sequence set forth in SEQ ID NO: 13-SEQ ID NO:14 and a detection primer set as set forth in SEQ ID NO: 19; and

nucleotide combination 4 comprising the nucleotide sequence set forth in SEQ ID NO: 15-SEQ ID NO:16 and a detection primer set as set forth in SEQ ID NO: 20.

In a second aspect, the invention provides a test kit for diagnosing esophageal cancer, the kit comprising the nucleic acid product described above.

In some embodiments of the invention, the kit further comprises one or more of DNA extraction reagents, methylation conversion reagents, DNA purification reagents, PCR reaction reagents, and quality control.

In some embodiments of the invention, the methylation conversion reagent comprises a bisulphite.

In some embodiments of the invention, the quality control comprises a positive reference, a negative reference, a primer pair for detecting a reference gene, and a probe.

In some embodiments of the invention, the reference gene is ACTB gene, and the nucleotide sequences of the primer pair and probe for detecting the reference gene are as shown in SEQ ID NO: 9-SEQ ID NO:10 and SEQ ID NO: 21.

In a third aspect, the invention provides the use of the nucleic acid product and the detection kit for the preparation of a diagnostic esophageal cancer product.

In some embodiments of the invention, the sample to be tested comprises at least one of a cell line, biopsy tissue, whole blood, isolated blood cells, and plasma.

The invention discloses a nucleic acid product and a detection kit for diagnosing esophageal cancer, which are prepared by detecting HOXD1 gene Chr2: the methylation level of the 176889800-17689943 region can effectively diagnose esophageal cancer, the sensitivity of detecting esophageal cancer tissue samples is up to 100%, the specificity of detecting esophageal cancer by-normal tissue samples is up to 80%, the sensitivity of detecting esophageal cancer patient plasma samples is up to 82.9%, and the specificity of detecting healthy human plasma samples is up to 95.3%. The nucleic acid product and the detection kit have higher diagnosis sensitivity and specificity, and provide a new scheme for minimally invasive operation and screening and diagnosis of esophageal cancer.

Drawings

FIG. 1 is a ROC curve of plasma samples of patients diagnosed with esophageal cancer and healthy humans with nucleotide combinations 1-4.

Description of the embodiments

The present invention will be described more fully hereinafter in order to facilitate an understanding of the invention, which may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The term "and/or" includes any and all combinations of one or more of the associated listed items. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The term "gene" refers to a segment of DNA encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, as well as exon and intron sequences involved in gene transcription/translation and transcriptional/translational regulation.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. In general, DNA methylation refers to the covalent attachment of a methyl group at the 5 th carbon of cytosine in a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, representing both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. For example, in some cases, a comparison may be made based on the Ct value detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., the number of methylated molecules/(the number of methylated molecules+the number of unmethylated molecules). Times.100%, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "CpG island" refers to a region on DNA that is rich in a large number of cytosines and guanines linked by phosphoester linkages. CpG dinucleotides are typically concentrated in the promoter region and exons of human genes. In normal human genomes, cpG sites outside CpG islands are typically methylated, whereas CpG sites in CpG islands are typically in an unmethylated state, a form of methylation that is inherited stably with cell division. When the tumor occurs, the unmethylation degree of CpG sites outside the cancer suppressor gene CpG island is increased, and the CpG sites in the CpG island are in a hypermethylation state, so that the chromosome helix degree is increased, the transcription is inhibited, and the gene expression is deleted.

The HOXD1 (homeobox D1) gene is a member of the Antp homeobox family (Antphomeobox family), encoding a protein with a homeobox DNA binding domain. The HOXD1 gene was located on human chromosome 2 with GRCh38.p13 as a reference. It should also be noted that the location of the site or region referred to herein is referenced to grch 38.p13.

The GSX1 (GShomeobox 1) gene has an enabling sequence-specific double-stranded DNA binding activity. Acting upstream or within the transcriptional upregulation of RNA polymerase II. The HOXD1 gene was located on human chromosome 13 using GRCh38.p13 as a reference genome.

The study of the invention shows that the sensitivity of the HOXD1 gene as a biomarker for diagnosing esophageal cancer tissue samples can reach 100 percent, and the specificity can reach 80 percent; the sensitivity of the GSX1 gene as a biological standard diagnosis esophageal cancer tissue sample is 100 percent, and the specificity is 15 percent. In contrast, detection of methylation levels in specific regions of the HOXD1 gene is more suitable for diagnosis of esophageal cancer. Further, the detection performance of the HOXD1 gene on esophageal cancer is verified by using a plasma sample, and the sensitivity of detecting the methylation level of a specific region of the HOXD1 gene to diagnose the plasma sample of a patient suffering from esophageal cancer is up to 82.9%, and the specificity of detecting the healthy human plasma sample is up to 95.3%.

In some embodiments, the region of interest that detects the methylation level of the HOXD1 gene (simply "HOXD1 region of interest") is a CpG island of the HOXD1 gene. Further, the HOXD1 target area is Chr2: 17689800-17689943. At Chr2: within the region 17619800-17619943 there are 11 CG dinucleotide sites. Still further, esophageal cancer is diagnosed by detecting the methylation level of a target site in a target region of HOXD 1. In an alternative specific example, the target site in the HOXD1 target region is at least one of the following sites: chr2:176189800 Chr2:176189815 Chr2:176189818 Chr2:176189830 Chr2:176189845 Chr2:176189852 Chr2:176189856 Chr2:176189921 Chr2:176189927 Chr2:176189930 and Chr2:176189935.

in some embodiments, the region of interest that detects the methylation level of the GSX1 gene (referred to as "GSX1 target region") is a CpG island of the GSX1 gene. Further, the GSX1 target region is Chr13: 27793590-27793730. At Chr13: the region 27793590-27793730 has 13 CG dinucleotide sites. Still further, esophageal cancer is diagnosed by detecting the methylation level of a target site in a target region of GSX 1. In an alternative specific example, the target site in the GSX1 target region is at least one of the following: chr13:27793604, chr13:27793608, chr13:27793623, chr13:27793643, chr13:27793645, chr13:27793651, chr13:27793673, chr13:27793679, chr13:27793682, chr13:27793687, chr13:27793693, chr13:27793695 and Chr13:27793714.

Based on the above, an embodiment of the present application provides a nucleic acid product for diagnosing esophageal cancer, using grch38.p13 as a reference genome, for detecting the HOXD1 gene Chr2: methylation levels in the 176889800 to 17689943 region.

It will be appreciated that in detecting the methylation level of a target region, detection may be performed for the entire region of the target region, or for a portion of the target region.

In some embodiments, the nucleic acid product achieves the expression of the HOXD1 gene Chr2 by one or more of the following methods: detection of methylation level of 176889800 to 17689943 region: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

In some embodiments, the methylation level of the HOXD1 gene target region is detected by bisulfite sequencing, when the nucleic acid product comprises a sequence for detecting the HOXD1 gene Chr2: a methylation detection primer pair and a non-methylation detection primer pair for detecting the methylation level of a region from 176889800 to 17689943.

In some embodiments, the methylation detection primer pair has a nucleotide sequence set forth in SEQ ID NO: 1-SEQ ID NO:2, the nucleotide sequence of the unmethylation detection primer pair is shown as SEQ ID NO: 3-SEQ ID NO: 4.

In some embodiments, the methylation level of the HOXD1 target region is detected by methylation-specific fluorescent quantitative PCR method, when the nucleic acid product comprises a primer for detecting the HOXD1 gene Chr2: a 176889800-17689943 region methylation level detection primer pair and a detection probe corresponding to the detection primer pair.

In some embodiments, the detection probe contains a fluorescent group at the 5 'end and a fluorescence quenching group at the 3' end.

In some embodiments, the fluorescent reporter group is selected from one of FAM, TET, VIC, JOE, HEX, cy, cy3.5, cy5, cy5.5, NED, and Texas Red, and the fluorescent quenching group may be one selected from TAMRA, BHQ, and MGB. It is understood that the detection of methylation of the target region and the detection of the reference gene may be performed in the same reaction well or in different reaction wells, and the fluorescent group of the detection probe may be selected appropriately according to the actual situation. In an alternative specific example, the detection of methylation of the target region is performed in the same reaction well as the detection of the reference gene, wherein the fluorescent reporter group of the detection probe for methylation of the target region is FAM and the fluorescence quenching group is MGB; the fluorescent reporter group of the detection probe of the reference gene is VIC, and the fluorescent quenching group is BHQ-1.

In some embodiments, the nucleotide sequences of the detection primer pair and the detection probe corresponding thereto comprise at least one of the following nucleotide combinations: nucleotide combination 1 comprising the nucleotide sequence set forth in SEQ ID NO: 1-SEQ ID NO:2 and a detection primer pair as shown in SEQ ID NO: 17;

An embodiment of the present application also provides a test kit for diagnosing esophageal cancer by detecting the HOXD1 gene Chr2: the methylation level of the 176889800-17689943 region is used for diagnosing esophageal cancer, and the detection kit comprises the nucleic acid product in any embodiment.

In one embodiment, the kit includes one or more of a DNA extraction reagent, a methylation conversion reagent, a DNA purification reagent, a PCR reaction reagent, and a quality control.

In particular, methylation conversion reagents are used to deaminate unmethylated cytosines in DNA to uracil while methylated cytosines remain unchanged. In an alternative specific example, the methylation conversion reagent includes bisulfite.

In one embodiment, the PCR reagent comprises PCR buffer, dNTPs, mgCl ₂ And DNA polymerase.

In one embodiment, the quality control comprises a positive reference, a negative reference, a primer pair for detecting a reference gene, and a probe.

In one embodiment, the reference gene is ACTB gene, and the nucleotide sequences of the primer pair and probe for detecting the reference gene are as shown in SEQ ID NO: 9-SEQ ID NO:10 and SEQ ID NO: 21.

An embodiment of the application also provides application of the nucleic acid product and the detection kit in preparing an esophageal cancer diagnosis product.

In one embodiment, the sample to be tested comprises at least one of a cell line, biopsy tissue, whole blood, isolated blood cells, and plasma.

The kit for diagnosing the esophageal cancer uses the HOXD1 gene as a biomarker, and diagnoses the esophageal cancer by detecting the methylation level of the biomarker, and has high sensitivity and high accuracy; the kit is favorable for realizing crowd diversion, improving compliance of endoscopy, and improving early diagnosis rate of esophageal cancer, especially early esophageal cancer by further performing endoscopy and pathological diagnosis on methylation positive samples.

In addition, an embodiment of the present application provides a chip for diagnosing esophageal cancer, on which a reaction unit for detecting methylation level of the HOXD1 gene is provided.

Optionally, the reaction unit is provided with the nucleic acid product of any of the embodiments described above.

In some embodiments, at least one of an extraction unit and a conversion unit is further provided on the chip. Specifically, the extraction unit is used for extracting nucleic acid in the sample to be detected; the conversion unit is used to convert the nucleic acid (unmethylated cytosine to uracil).

The chip for diagnosing the esophageal cancer has the advantages of high sensitivity and high detection rate by taking the HOXD1 gene as a biomarker for diagnosing the esophageal cancer.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The following is a detailed description of specific embodiments. The following examples are not specifically described but do not include other components than the unavoidable impurities. Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples were carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer.

Examples

20 healthy human whole blood samples and 20 esophageal cancer patient plasma samples were collected in a hospital in Zhengzhou, sample information was recorded, and all samples were anonymized. Sample information is shown in table 1.

TABLE 1

1. Extracting DNA;

the genomic DNA of cells of each sample was extracted using a blood/cell/tissue genomic DNA extraction kit (catalog number: DP 304) from Tiangen Biochemical technologies (Beijing) limited, see kit instructions for specific procedures.

2. Bisulphite conversion and recovery

The extracted genome DNA of each sample is respectively subjected to bisulphite conversion, and the nucleic acid conversion kit is a nucleic acid purification reagent (Huhan mechanical preparation 20200843) of the life technology Co., ltd., wuhan Ai Misen, and specific experimental operation is shown in the instruction book of the kit. In the conversion process, unmethylated cytosine (C) is converted to uracil (U), the methylated cytosine is unchanged, uracil (U) is paired with adenine (a) and cytosine (C) is paired with guanine (G) in a subsequent PCR step, thereby achieving differentiation of methylated from unmethylated sequences.

3. PCR reaction

PCR amplification was performed using TaqDNA polymerase with bisulfite converted DNA as template and both methylated and unmethylated primer pairs. The methylated primer pair can amplify the converted methylated template, and the unmethylated primer pair can amplify the converted unmethylated template.

Specifically, the upstream primer sequence of the HOXD1 methylation primer pair is (5 '-3'): CCCCGTTGTAGGTAAATTCGTC (SEQ ID NO: 1), the downstream primer sequence of the HOXD1 methylation primer pair is (5 '-3'): GGGACTATCTCGATACGCCGA (SEQ ID NO: 2);

the upstream primer sequence of the HOXD1 unmethylated primer pair was (5 '-3'): CCCCCGTTGTAGGTAAATTTGTT (SEQ ID NO: 3), the HOXD1 unmethylated primer pair downstream primer sequence is (5 '-3'): CCCCCACTATCTCAATACACCAA (SEQ ID NO: 4).

The upstream primer sequences of the GSX1 methylation primer pair are (5 '-3'): CCCGTAGTAAGAGGATGCGTAC (SEQ ID NO: 5), the downstream primer sequence of the GSX1 methylation primer pair is (5 '-3'): CCCCTCTTCACCTACTTCTCGA (SEQ ID NO: 6); the upstream primer sequence of the GSX1 unmethylated primer pair is (5 '-3'): CCCCGTAGTAAGAGGATGTGTAT (SEQ ID NO: 7), the downstream primer sequence of the GSX1 unmethylated primer pair is (5 '-3'): GGGGGTCTTCACCTACTTCTCAA (SEQ ID NO: 8).

Specifically, PCR for detecting methylation levels of the HOXD1 gene and the GSX1 gene was performed on the same sample, respectively. Namely, only one methylation primer pair and one unmethylation primer pair of a gene (HOXD 1 gene or GSX1 gene) are added into one PCR tube, and simultaneously, an internal reference gene ACTB primer pair is added. The ACTB upstream primer sequence is: AAGGTGGTTGGGTGGTTGTTTTG (SEQ ID NO: 9), the ACTB downstream primer sequence is: AATAACACCCCCACCCTGC (SEQ ID NO: 10), the PCR amplification system of each sample is shown in Table 2.

TABLE 2

The PCR amplification procedure is shown in Table 3.

TABLE 3 Table 3

4. Sequencing and analysis

The PCR products were sent to the sequencing company for Sanger sequencing, and the amplified products of the HOXD1 gene were represented by SEQ ID NO: 1-4, and for amplification products of the GSX1 gene, respectively using SEQ ID NO:5-8, sequencing the primers corresponding to the primers, and analyzing the methylation of each CpG site in each amplicon according to a sequencing peak diagram. Specifically, methylation of cytosine in a CpG nucleotide is classified into two types: i.e., methylated and unmethylated, where methylation is in turn divided into fully methylated and partially methylated, a CpG dinucleotide site is considered partially methylated if sequencing of the cytosine at that site reveals both a C and a T at the position of the cytosine.

If more than 95% of the C's in CpG dinucleotide sites in an amplicon are methylated (i.e., at least 10 are methylated for the HOXD1 gene and at least 12 are methylated for the GSX1 gene), the sample is considered methylated in this region.

The number of methylation positives/negatives in each sample was calculated, and the methylation positive/negative ratio was calculated. Sensitivity = proportion of methylation positives in samples positive for pathological outcome; specificity = proportion of methylation negative in samples whose pathology results are negative. The results are shown in Table 4. It should be noted that, when performing the PCR reaction experiment, the experimenter does not know the pathological information of the sample in advance, and after the PCR reaction is completed, the PCR result is compared with the pathological information, and the sensitivity and specificity data are calculated.

TABLE 4 Table 4

As can be seen from the results of Table 4, both the HOXD1 gene and the GSX1 gene were methylated in 20 cases of esophageal cancer samples, and the methylation positive ratio was 100%, which indicates that the detection sensitivity for 20 cases of esophageal cancer samples was 100% by using the HOXD1 gene or the GSX1 gene as a biomarker; the methylation positive rate of the GSX1 gene in 20 healthy human samples is as high as 85%, which shows that the specificity of the GSX1 gene is 15%; methylation positive rate of the HOXD1 gene in 20 healthy human samples was 20%, which indicates that the specificity was 80%. From this, methylation of the CpG island of the HOXD1 gene is a highly sensitive and highly specific esophageal cancer biomarker. Furthermore, as can be seen from the sample information shown in Table 1, the 20 samples diagnosed as esophageal cancer include 3T 1-phase samples and 2T 2-phase samples, which indicates that methylation of HOXD1 gene and GSX1 gene can be effectively detected even for early esophageal cancer, and the kit can be used as a product for early screening.

Examples

Furthermore, in order to conveniently and rapidly diagnose esophageal cancer by detecting the methylation level of the gene, the embodiment provides a method for diagnosing esophageal cancer by detecting the methylation level of the target gene by a methylation-specific fluorescent quantitative PCR method. The sensitivity of diagnosing esophageal cancer patient tissue samples using the methylation level of the GSX1 gene is as high as 100%, but is not verified again in this example in view of its low specificity.

1. Sample collection

A total of 158 blood samples of patients with esophageal cancer, which are confirmed by pathological tissue biopsy, are collected in a certain hospital, wherein 72 patients with early esophageal cancer, 86 patients with middle and late esophageal cancer, and the patients with early esophageal cancer comprise patients with pathological stages of high-grade neoplasia, ia, ib, IIa and IIb, and the patients with middle and late esophageal cancer comprise patients with pathological stages of III and IV. In addition, 128 blood samples of healthy human patients who underwent regular physical examination in this hospital were collected. All blood samples were collected contending for consent by the volunteers themselves, and all volunteers signed informed consent, all samples were processed anonymously. All samples were collected in this example by ethical committee approval.

2. Extraction of free DNA from plasma samples

After centrifugation of fresh blood samples, a plasma layer was collected and subsequently plasma cfDNA extraction was performed using a magnetic bead serum/plasma free DNA (cfDNA) extraction kit (DP 709) from the company sienna biochemical technology (beijing), according to the kit instructions.

The bisulfite conversion and purification procedure is as in example 1.

Methylation-specific fluorescent quantitative PCR detects the methylation level of the HOXD1 gene.

In addition to the methylation primer pair of SEQ ID NO: 1-SEQ ID NO: in addition to 2, 3 pairs of amplified Chr2 were additionally designed: the methylation detection primer pair of 176889800-17689943 region is used for methylation specific fluorescent quantitative PCR experiments, and the 4 pairs of primer pairs can detect 1% or more of methylated DNA in a sample and can amplify efficiently and specifically. 4 pairs of methylation primers and probe sequences for detecting methylation level of HOXD1 gene are shown in Table 5.

TABLE 5

The methylation-specific fluorescent quantitative PCR method was used to detect the HOXD1 gene Chr2 using the methylation primer pairs and detection probes provided in Table 5, using the bisulfite-converted DNA of each sample as a template: methylation levels in the 176889800 to 17689943 region. Specifically, in one PCR tube, a DNA template of a sample to be detected, any one of the nucleotide combinations 1-4, a primer pair and a detection probe (nucleotide combination 5) for detecting an internal reference gene ACTB, necessary PCR buffer solution, taq enzyme and the like are added. The probes of the detection target area are Taqman probes, the 5 'end of each probe contains a fluorescent group, and the 3' end of each probe is a fluorescence quenching group. Specifically, in Table 5, the fluorescent group at the 5 '-end of the detection probe of the HOXD1 gene target region is ROX, the fluorescent quenching group at the 3' -end thereof is MGB, the fluorescent group at the 5 '-end of the ACTB gene detection probe is VIC, and the fluorescent group at the 3' -end thereofThe quenching group is BHQ1. In the detection of the sample to be detected, positive control and negative control should be set on each PCR plate. Preparation method of positive control DNA template: 10 ³ Copy/microliter of plasmid and 10 of target region of the bisulfite-converted HOXD1 gene ³ The plasmid of ACTB gene after copy/microliter conversion is mixed in equal volume. The template for the negative control was ultrapure water. The PCR reaction system was configured according to the formulation provided in Table 6 and amplified on a fluorescent quantitative PCR instrument according to the amplification procedure shown in Table 7.

TABLE 6

TABLE 7

After the PCR reaction is finished, a base line is adjusted, a threshold line is arranged at the inflection point of the S-shaped amplification curve, and Ct values of different primer pairs and probe combinations for amplifying all samples are obtained. If the Ct values of the HOXD1 gene and the ACTB gene in each PCR reaction plate are between 26 and 30, and no amplification curve appears in the negative control hole, the experiment is normal. If the Ct value of the ACTB gene in a certain sample to be detected is greater than 35, the sample is an abnormal sample, and the sample needs to be detected again or removed.

PCR detection result 2 ^-ΔΔCt ROC analysis is performed by counting sensitivity, specificity and AUC values at maximum about Dent index (Youden's index) when methylation levels of target region of HOXD1 gene are detected by different nucleotide combinations and diagnosis of esophageal cancer is further performed, wherein DeltaDeltaCt= (Ct) _{Target area} -Ct _ACTB ） _{Sample of} -（Ct _{Target area} -Ct _ACTB ） _{Positive control} The results are shown in Table 8 and FIG. 1.

TABLE 8

HOXD1	Sensitivity of	Specificity (specificity)	AUC values
				Nucleotide combination 1	82.9%	95.3%	0.883
Nucleotide combination 2	74.1%	93.7%	0.831
				Nucleotide combination 3	76.6%	96.1%	0.863
Nucleotide combination 4	80.7%	93.7%	0.863

As can be seen from table 8 and fig. 1, the HOXD1 gene Chr2 was detected by qMSP method using different nucleotide combinations: methylation levels of the 176889800-17689943 regions can be used for effectively diagnosing esophageal cancer plasma samples, and diagnostic AUC values of the plasma samples are larger than or equal to 0.831. Specifically, the sensitivity range of the combination of the four detection primer pairs and the detection probes for diagnosing esophageal cancer plasma samples is 74.1% -82.9%, and the specificity of the combination for diagnosing healthy human plasma samples is higher than 93.7%. In addition, the nucleotide combination 1 has the best diagnosis effect, the sensitivity of detecting a cancer sample is 82.9 percent, the specificity of detecting a healthy human sample is 95.3 percent, and the AUC value can reach 0.883.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

Claims

1. A nucleic acid product for diagnosing esophageal cancer, characterized by grch38.p13 as a reference genome, for detecting the HOXD1 gene Chr2: methylation levels in the 176889800 to 17689943 region.

2. The nucleic acid product of claim 1, wherein said nucleic acid product achieves a gene Chr2 for HOXD1 by one or more of the following methods: detection of methylation level of 176889800 to 17689943 region: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

3. The nucleic acid product according to claim 1 or 2, characterized in that it comprises a gene for detecting the HOXD1 gene Chr2: a methylation detection primer pair and a non-methylation detection primer pair for detecting the methylation level of a region from 176889800 to 17689943.

4. The nucleic acid product of claim 3, wherein the methylation detection primer pair has a nucleotide sequence set forth in SEQ ID NO: 1-SEQ ID NO: 2. the nucleotide sequence of the unmethylation detection primer pair is shown as SEQ ID NO: 3-SEQ ID NO: 4. as shown.

5. The nucleic acid product according to claim 1 or 2, characterized in that it comprises a gene for detecting the HOXD1 gene Chr2: a 176889800-17689943 region methylation level detection primer pair and a detection probe corresponding to the detection primer pair.

6. The nucleic acid product of claim 5, wherein the 5 'end of the detection probe comprises a fluorescent moiety and the 3' end of the detection probe comprises a fluorescence quenching moiety.

7. The nucleic acid product of claim 6, wherein the nucleic acid product comprises at least one of the following nucleotide combinations:

nucleotide combination 1 comprising the nucleotide sequence set forth in SEQ ID NO: 1-SEQ ID NO: 2. the detection primer pair is shown as SEQ ID NO: 17. the detection probes shown;

nucleotide combination 2 comprising the nucleotide sequence as set forth in SEQ ID NO: 11-SEQ ID NO: 12. the detection primer pair is shown as SEQ ID NO: 18. the detection probes shown;

nucleotide combination 3 comprising the nucleotide sequence set forth in SEQ ID NO: 13-SEQ ID NO: 14. the detection primer pair is shown as SEQ ID NO: 19. the detection probes shown; and

nucleotide combination 4 comprising the nucleotide sequence set forth in SEQ ID NO: 15-SEQ ID NO: 16. the detection primer pair is shown as SEQ ID NO: 20. the detection probes are shown.

8. A test kit for diagnosing esophageal cancer, comprising the nucleic acid product of any one of claims 1 to 7.

9. The kit of claim 8, further comprising one or more of DNA extraction reagents, methylation conversion reagents, DNA purification reagents, PCR reaction reagents, and quality control.

10. Use of a nucleic acid product according to any one of claims 1 to 7 or a detection kit according to claim 8 or 9 for the preparation of a diagnostic esophageal cancer product.