CN116179694A

CN116179694A - Application of reagent for detecting methylation level in preparation of prostate cancer diagnosis product and prostate cancer diagnosis kit

Info

Publication number: CN116179694A
Application number: CN202211367181.2A
Authority: CN
Inventors: 周谛晗; 董兰兰; 张良禄
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-11-02
Filing date: 2022-11-02
Publication date: 2023-05-30

Abstract

The invention relates to an application of a reagent for detecting methylation level in preparation of a prostate cancer diagnosis product and a prostate cancer diagnosis kit, wherein a target region is selected from one or more of the regions shown in (1) and (2): (1) A region a or a partial region of region a, and (2) a region B or a partial region of region B; with reference to GRCh38.p14, region A is Ch5: 7849790-7850675 and region B is Ch8: 48555940-48556617. The method can diagnose the prostate cancer through the methylation of CpG islands in all or part of the target region, thereby providing a new method for diagnosing the prostate cancer clinically. The kit also has higher sensitivity and specificity, and can effectively improve the detection rate of the prostate cancer.

Description

Application of reagent for detecting methylation level in preparation of prostate cancer diagnosis product and prostate cancer diagnosis kit

Technical Field

The invention relates to the technical field of biomedicine, in particular to application of a reagent for detecting methylation level in preparation of a prostate cancer diagnosis product and a prostate cancer diagnosis kit.

Background

Based on the statistics of the international cancer research institute, the global new cases of prostate cancer in 2018 were estimated to be 127.6 ten thousand cases, and about 35.9 ten thousand patients died from prostate cancer. In recent years, with aging population, diet and lifestyle changes, the onset of prostate cancer is not optimistic.

Currently, clinical diagnostic methods for prostate cancer mainly include digital rectal examination, serum PSA (prostate specific antigen) examination, needle biopsy, imaging examination, and the like. Rectal fingering: by anal palpation of the prostate, it is known whether the prostate is hardened or nodular, which is an invasive examination, relying heavily on physician experience; in addition, the same symptoms can appear in non-cancer diseases such as prostatitis, and the specificity of the method for judging cancer is lower; in addition, the finger examination process is painful for the patient, and the acceptance is low. Serum PSA examination: the normal value of serum PSA is below 4ng/mL, serum prostate specific antigen is an important basis for prostate cancer screening, treatment selection and prognosis judgment, but the detection sensitivity and specificity of serum PSA are low. Aspiration biopsy: the method is the most accurate method for detecting the prostate cancer, but is a invasive detection method, has a certain harm, causes pain to patients and even causes complications, and is high in labor and time cost and not suitable for cancer screening. Imaging examination: for example, by nuclear magnetism, rectal prostate ultrasound and other methods, whether the prostate has abnormal echoes or signals or not is checked, but prostate cancer patients often have no obvious clinical symptoms in early stages, and accurate diagnosis is difficult to perform by only imaging examination. Thus, there is an urgent need to develop new non-invasive diagnostic methods and products for diagnosis or auxiliary diagnosis of prostate cancer.

In view of this, the present application is specifically proposed.

Disclosure of Invention

The main purpose of the embodiment of the application comprises that a reagent for detecting the methylation level of all or part of the region of the Chr5:7849790-7850675 or/and the Chr8:48555940-48556617 is applied to a prostate cancer diagnosis product, so that a new scheme is provided for diagnosing the prostate cancer.

In a first aspect of the present application, there is provided the use of an agent for detecting the methylation level of a target region in the manufacture of a diagnostic product for prostate cancer;

the target region is selected from one or more of the regions shown in (1) and (2):

(1) Region A or a partial region of region A, and

(2) Region B or a partial region of region B;

wherein, with GRCh38.p14 as a reference, the region A is Ch5: 7849790-7850675, and the region B is Ch8: 48555940-48556617.

In some embodiments of the present application, the target area has one or more of the following technical features:

(1) The partial area of the area A is selected from one or more of the following defined areas 1, 2, 3, 4, 5, 6, 7 and 8; and, a step of, in the first embodiment,

(2) The partial area of the area B is selected from one or more of the areas 9, 10, 11, 12 and 13 defined as follows;

Region 1 is the Chr5:7849827-7849981 plus strand,

region 2 is the forward chain of Chr5:7849986-7850142,

region 3 is the forward chain of Chr5:7850214-7850379,

region 4 is the Chr5:7850446-7850597 negative strand,

region 5 is the Chr5:7850302-7850441 negative strand,

region 6 is the Chr5:7850154-7850310 negative strand,

region 7 is the Chr5:7850029-7850179 negative strand,

region 8 is the Chr5:7849849-7850006 negative strand,

region 9 is the Chr8:48556116-48556223 plus strand,

region 10 is the forward strand of Chr8:48556220-48556377,

region 11 is the forward chain of Chr8:48556367-48556446,

region 12 is the Chr8:48556336-48556495 negative strand,

region 13 is the Chr8:48556161-48556326 negative strand. In some embodiments of the present application, the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

In some embodiments of the present application, the reagent comprises a primer pair that detects the methylation level of the target region, or further comprises a detection probe that detects the target region.

In some embodiments of the present application, the reagent comprises a detection primer pair that detects the methylation level of the target region and a detection probe corresponding to the detection primer pair, having one or more of the following features:

the nucleotide sequences of the detection primer pairs for detecting the region 1 are shown as SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 3;

the nucleotide sequences of the detection primer pairs for detecting the region 2 are shown as SEQ ID NO.4 and SEQ ID NO.5, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 6;

the nucleotide sequences of the detection primer pairs for detecting the region 3 are shown as SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 9;

the nucleotide sequences of the detection primer pair for detecting the region 4 are shown as SEQ ID NO.10 and SEQ ID NO.11, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 12;

the nucleotide sequences of the detection primer pairs for detecting the region 5 are shown as SEQ ID NO.13 and SEQ ID NO.14, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 15;

the nucleotide sequences of the detection primer pairs for detecting the region 6 are shown as SEQ ID NO.16 and SEQ ID NO.17, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 18;

The nucleotide sequences of the detection primer pair for detecting the region 7 are shown as SEQ ID NO.19 and SEQ ID NO.20, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 21;

the nucleotide sequences of the detection primer pairs for detecting the region 8 are shown as SEQ ID NO.22 and SEQ ID NO.23, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 24;

the nucleotide sequences of the detection primer pairs for detecting the region 9 are shown as SEQ ID NO.25 and SEQ ID NO.26, and the nucleotide sequences of the corresponding detection probes are shown as SEQ ID NO. 27;

the nucleotide sequences of the detection primer pair for detecting the region 10 are shown as SEQ ID NO.28 and SEQ ID NO.29, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 30;

the nucleotide sequences of the detection primer pair for detecting the region 11 are shown as SEQ ID NO.31 and SEQ ID NO.32, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 33;

the nucleotide sequences of the detection primer pair for detecting the region 12 are shown as SEQ ID NO.34 and SEQ ID NO.35, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 36; and, a step of, in the first embodiment,

the nucleotide sequences of the detection primer pair for detecting the region 13 are shown as SEQ ID NO.37 and SEQ ID NO.38, and the nucleotide sequence of the corresponding detection probe is shown as SEQ ID NO. 39.

In some embodiments of the present application, the reagent further comprises a detection primer pair for detecting a reference gene and a detection probe corresponding to the detection primer pair; optionally, the reference gene comprises an ACTB gene, the nucleotide sequence of a detection primer pair for detecting the ACTB gene is shown as SEQ ID NO.40 and SEQ ID NO.41, and the nucleotide sequence of a corresponding detection probe is shown as SEQ ID NO. 42.

In some embodiments of the present application, the sample detected comprises a cell sample, a tissue sample, or a urine sample.

In a second aspect of the present application there is provided a kit for diagnosing prostate cancer comprising the reagents defined in the first aspect.

In some embodiments of the present application, the diagnostic kit further comprises one or more of sequencing reagents, amplification reagents, reagents for converting unmethylated cytosine bases to uracil, and DNA extraction reagents.

In some embodiments of the present application, the amplification reagents include an amplification buffer, dNTPs, a DNA polymerase, and Mg ²⁺ One or more of the following.

Compared with the prior art, the beneficial effects of the application include:

the inventor of the application finds that the generation of CpG island methylation of all or part of the region can be detected by taking the region of the Chr5:7849790-7850675 or/and the region of the Chr8:48555940-48556617 as a biomarker, so that a novel method for diagnosing the prostatic cancer clinically can be provided. The kit also has higher sensitivity and specificity, and can effectively improve the detection rate of the prostate cancer.

Detailed Description

The present invention will be described in further detail with reference to embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the invention and are not intended to limit the scope of the invention in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present invention may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by those skilled in the art without departing from the spirit of the invention, and equivalents thereof fall within the scope of the present application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the invention, it being understood that the invention may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the invention.

The term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).

The terms "plurality", "plural", "multiple", and the like in the present invention refer to, unless otherwise specified, an index of 2 or more in number. For example, "one or more" means one kind or two or more kinds.

As used herein, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.

The "suitable" in the "suitable combination manner", "suitable manner", "any suitable manner" and the like herein refers to the fact that the technical scheme of the present invention can be implemented, the technical problem of the present invention is solved, and the technical effect expected by the present invention is achieved.

Herein, "preferred", "better", "preferred" are merely to describe better embodiments or examples, and it should be understood that they do not limit the scope of the invention.

In the present invention, "further", "still further", "particularly" and the like are used for descriptive purposes to indicate differences in content but should not be construed as limiting the scope of the invention.

In the present invention, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present invention, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a technical feature being indicated. Moreover, the terms "first," "second," "third," "fourth," and the like are used for non-exhaustive list description purposes only, and are not to be construed as limiting the number of closed forms.

In the present disclosure, the term "cancer" refers to an epithelial malignancy that occurs in the prostate. The prostate cancer is pathologically classified as adenocarcinoma (acinar adenocarcinoma), ductal adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, and adenosquamous carcinoma. Wherein the prostate adenocarcinoma accounts for more than 95 percent.

In the context of the present disclosure, the term "diagnosis" includes aspects of auxiliary diagnosis, risk of recurrence assessment, assessment of risk and extent of cancerous lesions, prognosis, and the like.

The term "gene" refers to a segment of DNA encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, as well as exon and intron sequences involved in gene transcription/translation and transcriptional/translational regulation.

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, both qualitatively and quantitatively. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified.

The term "Taqman probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

Epigenetic studies have found that alterations in DNA methylation levels and patterns are an important cause of tumorigenesis. DNA methylation is closely related to the inactivation of certain oncogenes, and is mainly manifested in the inhibition of expression of oncogenes at the transcriptional level, and is an event occurring in the early stages of prostate cancer. Therefore, the detection of the DNA methylation state of the gene promoter region can be used as a biological index for early diagnosis of prostate cancer. Traditional nucleic acid compositions, kits and detection methods for detecting prostate cancer related gene methylation in urine, such as described in CN113234820a, determine prostate cancer status in a subject by detecting the methylation level of a biomarker gene in a biological sample from the subject. Wherein the biomarker genes are selected from one or more of the following genes: APC, CCND2, CDH1, GSTP1, MCAM, PENK, PITX2, PTGS2, RARB, and RASSF1A. However, the sensitivity of the conventional method for detecting methylation of prostate cancer-associated genes needs to be improved, and new gene targets for detecting methylation need to be found.

First aspect of the present application

The application provides the use of an agent for detecting the methylation level of a target region in the preparation of a diagnostic product for prostate cancer;

(1) Region A or a partial region of region A, and

(2) Region B or a partial region of region B;

region 1 is the Chr5:7849827-7849981 plus strand,

region 2 is the forward chain of Chr5:7849986-7850142,

region 3 is the forward chain of Chr5:7850214-7850379,

region 4 is the Chr5:7850446-7850597 negative strand,

region 5 is the Chr5:7850302-7850441 negative strand,

region 6 is the Chr5:7850154-7850310 negative strand,

region 7 is the Chr5:7850029-7850179 negative strand,

region 8 is the Chr5:7849849-7850006 negative strand,

region 9 is the Chr8:48556116-48556223 plus strand,

Region 10 is the forward strand of Chr8:48556220-48556377,

region 11 is the forward chain of Chr8:48556367-48556446,

region 12 is the Chr8:48556336-48556495 negative strand,

region 13 is the Chr8:48556161-48556326 negative strand.

Optionally, the target region is selected from one or more of region 2, region 3, region 4, region 5, region 7, region 8, region 9, region 10, region 11, region 12 and region 13. Optionally, the target region is selected from one or more of region 5, region 7, region 9 and region 13.

Optionally, the target area is selected from one or more of area 9, area 10, area 11, area 12 and area 13, and area 5. Optionally, the target area is selected from one or more of area 9 and area 13, and area 5.

Optionally, the target area is selected from one or more of area 9, area 10, area 11, area 12 and area 13, and area 7. Optionally, the target area is selected from one or more of area 9, area 10, area 11 and area 13, and area 7. Optionally, the target area is selected from one or more of area 9 and area 13, and area 7.

Optionally, the target area is selected from one or more of area 9 and area 13, and one or more of area 1 to area 8.

Optionally, the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

Optionally, the reagent comprises a primer pair that detects the methylation level of the target region, or further comprises a detection probe that detects the target region.

Optionally, the reagent comprises a detection primer pair for detecting the methylation level of the target region and a detection probe corresponding to the detection primer pair, which has one or more of the following technical characteristics:

Optionally, the reagent further comprises a detection primer pair for detecting the reference gene and a detection probe corresponding to the detection primer pair.

Optionally, the reference gene comprises an ACTB gene, the nucleotide sequence of a detection primer pair for detecting the ACTB gene is shown as SEQ ID NO.40 and SEQ ID NO.41, and the nucleotide sequence of a corresponding detection probe is shown as SEQ ID NO. 42.

Optionally, the sample tested comprises a cell sample, a tissue sample, or a urine sample.

Second aspect of the present application

The present application provides a kit for diagnosing prostate cancer comprising the reagents defined in the first aspect.

Optionally, the diagnostic kit further comprises one or more of sequencing reagents, amplification reagents, reagents for converting unmethylated cytosine bases to uracil, and DNA extraction reagents.

Alternatively, the amplification reagents include an amplification buffer, dNTPs, a DNA polymerase, and Mg ²⁺ One or more of the following.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present invention, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Example 1

The present example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 1, nucleotide combination 1 comprising the nucleotides shown in SEQ ID NO.1-3, the specific sequences being shown in Table 1. The methylation of the forward strand (region 1) of the region of chr5:7849827-7849981bp can be detected by the nucleotide combination 1.

The base sequence of the plus strand of region 1 is as follows (5 '-3'):

GTTTCCCGCGCCCTGGACCATCCGGGCGTAGTCCCGGCAGCAAGGCCTTCTTTCCTTGCTAGCCTGGGCCTGCCGCAGACAGACCCCAGAGGGAGCCGCGCCCAGCCCGCTGGGCGGCCCCGGCTTCCCGCGACCCCCTCCAGACCCTGGGCAGA(SEQ ID NO.43)

the nucleotides shown in SEQ ID Nos. 1-3 can detect methylation of cytosine at positions of the forward strand of the region, which are designated by Chur 5:7849833, chur 5:7849835, chur 5:7849849, chur 5:7849923, chur 5:7849925, chur 5:7849934, chur 5:7849941, and Chur 5: 7849957.

Example 2

The present example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 2, nucleotide combination 2 comprising the nucleotides shown in SEQ ID NO.4-6, the specific sequences being shown in Table 1. The methylation of the forward strand (region 2) of the region of Chr5:7849986-7850142bp can be detected by the nucleotide combination 2.

The base sequence of the positive strand of region 2 is as follows (5 '-3'):

GCGCCCTGCTGTCCCGACAGAGCCACTGTGCTTTTGAGGGATCCTGACACCTAGTGGCTCCCGCTCCCTTCTCCGAAGAGCACCGGGTCCTATCTGAGCATTCCCGCGACTCCCAGCCCCTGATCGCAGCTAAGACACCCATTCGCGCACCCGGCTT(SEQ ID NO.44)

the nucleotides shown in SEQ ID No.4-6 can detect methylation of cytosine at positions of the forward strand of the region, which are designated by Chur 5:7849987, chur 5:7850197, chur 5:7850266, chur 5:7850090, chur 5:7850092, chur 5:7850129, chur 5:7850131, and Chur 5: 7850137.

Example 3

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 3, nucleotide combination 3 comprising the nucleotides shown in SEQ ID NO.7-9, the specific sequences being shown in Table 1. The nucleotide combination 3 can detect methylation of the forward strand (region 3) of the Chr5:7850214-7850379bp region.

The base sequence of the forward strand of region 3 is as follows (5 '-3'):

CGCCTTGGCGGGAGCTCACCCTCCCTGTCTCCCCAGCTGACCCTGCCGCGCCCCCTTCATCTCCGCACGCTCCCACCCGGCCCCCTCCACAGGCTGTCCAGCCCCGCCCCTCGGAACCCACCCCTGGTAGTGAAGCCCTGCCCCCAGGGTCCCTGCCCGAAGGTGC(SEQ ID NO.45)

the nucleotides shown in SEQ ID No.7-9 can detect methylation of cytosine at positions of the forward strand of the region, which are designated by Chur 5:7850214, chur 5:7850222, chur 5:7850318, chur 5:7850325, chur 5:7850371, and Chur 5: 7850379.

Example 4

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 4, nucleotide combination 4 comprising the nucleotides shown in SEQ ID NO.10-12, the specific sequences being shown in Table 1. The methylation of the negative strand (region 4) of the region of chr5:7850446-7850597bp can be detected by this nucleotide combination 4.

The negative strand base sequence of region 4 is as follows (5 '-3'):

GGCGGGGTTACCTTAGGGGAGGCAGCCTGGGGGCGGGGTTCACCTTAGGGACTGGGGCCTTGGGGCAGGGTTCACCTTAGGGGAGGGGGCCTGGGGGCAGGGATGCGCCGCCGGGGACTGGAGAGAGGAGCTCACAACGAGGAGGGGCCCTG(SEQ ID NO.46)

the nucleotides shown in SEQ ID Nos. 10-12 detect methylation of cytosine at positions Chr5:7850595, chr5:7850492, chr5:7850488, chr5:7850486, and Chr5:7850460 on the negative strand of the region.

Example 5

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 5, nucleotide combination 5 comprising the nucleotides shown in SEQ ID NO.13-15, the specific sequences being shown in Table 1. This nucleotide combination 5 detects methylation of the negative strand of the Chr5:7850302-7850441bp region (region 5).

The base sequence of the minus strand of region 5 is as follows (5 '-3'):

GCTGCACCGCTAGGGATCGGGGACAGAGCTCACAGAGTAGAGGGGCCCTAGAGGAGGAGCGCACCTTCGGGCAGGGACCCTGGGGGCAGGGCTTCACTACCAGGGGTGGGTTCCGAGGGGCGGGGCTGGACAGCCTGTGG(SEQ ID NO.47)

the nucleotides shown in SEQ ID Nos. 13-15 allow the methylation of cytosine at positions Chr5:7850432, chr5:7850421, chr5:7850327, and Chr5:7850320 on the negative strand of this region to be detected.

Example 6

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 6, nucleotide combination 6 comprising the nucleotides shown in SEQ ID NOS.16-18, the specific sequences being shown in Table 1. The nucleotide combination 6 can detect methylation of the negative strand (region 6) of the Chr5:7850154-7850310bp region.

The negative strand base sequence of region 6 is as follows (5 '-3'):

CAGCCTGTGGAGGGGGCCGGGTGGGAGCGTGCGGAGATGAAGGGGGCGCGGCAGGGTCAGCTGGGGAGACAGGGAGGGTGAGCTCCCGCCAAGGCGCCTGGGCCCCAAAGAGTACAGCTCAGGCGACTACCAGTGTCAGCTGAACCCCTGGGACGAG(SEQ ID NO.48)

the nucleotides shown in SEQ ID Nos. 16-18 allow the methylation of cytosine at positions Chr5:7850293, chr5:7850283, chr5:7850279, and Chr5:7850157 on the negative strand of this region to be detected.

Example 7

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 7, nucleotide combination 7 comprising the nucleotides shown in SEQ ID NO.19-21, the specific sequences being shown in Table 1. This nucleotide combination 7 detects methylation of the negative strand of the Chr5:7850029-7850179bp region (region 7).

The negative strand base sequence of region 7 is as follows (5 '-3'):

AGTGTCAGCTGAACCCCTGGGACGAGGATGTGGGAGAAGCCGGGTGCGCGAATGGGTGTCTTAGCTGCGATCAGGGGCTGGGAGTCGCGGGAATGCTCAGATAGGACCCGGTGCTCTTCGGAGAAGGGAGCGGGAGCCACTAGGTGTCAGG(SEQ ID NO.49)

the nucleotides shown in SEQ ID Nos. 19-21 allow the methylation of cytosine at positions Chr5:7850094, chr5:7850092, and Chr5:7850049 on the negative strand of this region to be detected.

Example 8

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 8, nucleotide combination 8 comprising the nucleotides shown in SEQ ID NOS.22-24, the specific sequences being shown in Table 1. The nucleotide combination 8 can detect methylation of the negative strand (region 8) of the Chr5:7849849-7850006bp region on the GNGT1 gene.

The negative strand base sequence of region 8 is as follows (5 '-3'):

CTCTGTCGGGACAGCAGGGCGCTCTTTCTGCCCAGGGTCTGGAGGGGG

TCGCGGGAAGCCGGGGCCGCCCAGCGGGCTGGGCGCGGCTCCCTCTGGGGTCTGTCTGCGGCAGGCCCAGGCTAGCAAGGAAAGAAGGCCTTGCTGCCGGGACTACGCCCGG(SEQ ID NO.50)

the nucleotides shown in SEQ ID Nos. 22-24 allow the methylation of cytosine at positions Chr5:7850002, chr5:7849989, chr5:7849927, chr5:7849925, chr5:7849863, chr5:7849855, and Chr5:7849851 on the negative strand of the region.

Example 9

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 9, nucleotide combination 9 comprising the nucleotides shown in SEQ ID NO.25-27, the specific sequences being shown in Table 1. The nucleotide combination 9 can detect methylation of the forward strand (region 9) of the Chr8:48556116-48556223bp region.

The base sequence of the plus strand of region 9 is as follows (5 '-3'):

CATTTCCCCGGTCGGTCATTAGCGCGCGCTCTCCCCGCGCCCAGGGTGCCCCCGTGCCCAGGGTGCCCCCGCCCGGCGCCTCCGCGGTCCCCTCCCGCGCGCACCTTT(SEQ ID NO.51)

the nucleotides shown in SEQ ID Nos. 25-27 can detect methylation of cytosine at positions of the forward strand of the region, which are designated by Ch8: 48556124, ch8: 48556128, ch8: 48556138, ch8: 48556185, ch8: 48556189, ch8: 48556192, ch8: 48556198, ch8: 48556200, ch8: 48556225, and Ch8: 48556240.

Example 10

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 10, nucleotide combination 10 comprising the nucleotides shown in SEQ ID NOS.28-30, the specific sequences being shown in Table 1. The nucleotide combination 10 detects methylation of the forward strand of the Chr8:48556220-48556377bp region (region 10).

The base sequence of the positive strand in region 10 is as follows (5 '-3'):

CTTTCCGAGTGCCAGTGGGGCGGCCCCGAGACCGCAATTGCTCTGGCCCGGATTGACGAGCCTCCGATGCCCATTTACTGCGCGCGGCAGCCACTCTGGAGCCGCGGCACATCTGGATGGAGTCAGCTGCCTAGCGCCAGGGGCCAGCACGGCCCAGC(SEQ ID NO.52)

the nucleotides shown in SEQ ID Nos. 28 to 30 can detect methylation of cytosine at positions of the forward strand of the region, which are designated by Ch8: 48556211, ch8: 48556213, ch8: 48556215, ch8: 48556300, ch8: 48556302, ch8: 48556304, ch8: 48556354 and Ch8: 48556369.

Example 11

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 11, nucleotide combination 11 comprising the nucleotides shown in SEQ ID NOS.31-33, the specific sequences being shown in Table 1. The nucleotide combination 11 can detect methylation of the forward strand (region 11) of the Chr8:48556367-48556446bp region.

The base sequence of the positive strand in region 11 is as follows (5 '-3'):

CACGGCCCAGCCAGCGGAGCGCGGCGGTGAGCGCTAGGGAGGCCGGCGCCCGGGCCGCCTCCGCGGCCGACCCCCTGTCC(SEQ ID NO.53)

the nucleotides shown in SEQ ID Nos. 31-33 can detect methylation of cytosine at positions of the forward strand of the region, which are designated as Chr8:48556381, chr8:48556386, chr8:48556398, chr8:48556410, chr8:48556413, chr8:48556417, chr8:48556428, chr8:48556430, and Chr8: 48556434.

Example 12

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 12, nucleotide combination 12 comprising the nucleotides shown in SEQ ID NOS.34-36, the specific sequences being shown in Table 1. The nucleotide combination 12 can detect methylation of the negative strand (region 12) of the Chr8:48556336-48556495bp region.

The negative strand base sequence of region 12 is as follows (5 '-3'):

TGTTCTCGCAGAGCCGCTGTGTTTACATCAGGAAATCCTGCTCGGGTGGGGACAGGGGGTCGGCCGC

GGAGGCGGCCCGGGCGCCGGCCTCCCTAGCGCTCACCGCCGCGCTCCGCTGGCTGGGCCGTGCTGGCCCCTGGCGCTAGGCAGCTGACTCCAT(SEQ ID NO.54)

the nucleotides shown in SEQ ID Nos. 34-36 allow the methylation of cytosine at positions Chr8:48556489, chr8:48556481, chr8:48556414, chr8:48556411, chr8:48556399, chr8:48556392, and Chr8:48556355 on the negative strand of the region.

Example 13

This example provides a kit for diagnosis or auxiliary diagnosis of prostate cancer, comprising nucleotide combination 13, nucleotide combination 13 comprising the nucleotides shown in SEQ ID NO.37-39, the specific sequences being shown in Table 1. The nucleotide combination 13 can detect methylation of the negative strand (region 13) of the Chr8:48556161-48556326bp region.

The negative strand base sequence of region 13 is as follows (5 '-3'):

CCGCGGCTCCAGAGTGGCTGCCGCGCGCAGTAAATGGGCATCGGAGGCTCGTCAATCCGGGCCAGAGCAATTGCGGTCTCGGGGCCGCCCCACTGGCACTCGGAAAGGTGCGCGCGGGAGGGGACCGCGGAGGCGCCGGGCGGGGGCACCCTGGGCACGGGGGCAC(SEQ ID NO.55)

the nucleotides shown in SEQ ID Nos. 37-39 allow the methylation of cytosine at positions Chr8:48556325, chr8:48556323, chr8:48556285, chr8:48556277, chr8:48556269, and Chr8:48556169 on the negative strand of the region.

Table 1 primer and probe sequences for each target Gene region

/>

TABLE 2 modes of combination of different compositions

/>

Example 14

The performance of diagnosing prostate cancer tissue samples using the individual regions of Table 1 and the combinations of regions of Table 2 was analyzed using the methylation fluorescent quantitative PCR method.

The inventors have found that by detecting the methylation level of a composition selected from any region of Chr5:7849790-7850675 and any region of Chr8:48555940-48556617 in a prostate cancer tissue sample, a prostate cancer tissue sample can be effectively distinguished from a normal paracancerous tissue sample, and a specific detection procedure is shown below.

1. Collection of tissue samples

A total of 87 cancer tissue samples of the prostate cancer patient and 87 corresponding paracancerous normal tissue samples were collected, all of which were formalin-immersed, paraffin-embedded. All tissue samples were approved by the ethics committee, all volunteers signed informed consent, and all tissue samples were anonymized.

2. Extraction of sample DNA

DNA was extracted from the tissue samples using QIAamp DNA FFPE Tissue Kit (Cat: 56404), and the specific procedure was performed according to the kit instructions.

3. Transformation of sample DNA

The kit for the transformation and purification of the sample DNA is a nucleic acid transformation reagent (Ehan mechanical preparation 20200843) of the life technology limited company of Wuhan Ai Misen, and the specific operation steps are as follows: adding 40 mu L of the extracted DNA solution into a 200 mu L PCR tube, adding 110 mu L of the transformation mixed solution, uniformly mixing, and placing into a PCR instrument, wherein the procedures are as follows: 95℃for 10min,64℃for 90min and 4℃for 1h.

4. Purification of sample DNA

1) Transferring the conversion product into a 2mL centrifuge tube, adding 600 mu L of binding solution and 10 mu L of magnetic beads, uniformly mixing, standing and combining for 15min, and vibrating and uniformly mixing every 3min for 5s to enable the magnetic beads to be in a suspension state all the time; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed. 2) Adding 600 mu L of rinsing liquid, and uniformly vortex-mixing for 20s to disperse magnetic beads; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed. 3) Adding 800 mu L of desulfurizing agent, vortex mixing for 20s to disperse magnetic beads, standing for 15min at room temperature for desulfurization, and shaking and mixing for 5s every 5min during the desulfurization, so that the magnetic beads are always in a suspension state. 4) Adding 800 mu L of rinsing liquid, and uniformly vortex-mixing for 20s to disperse magnetic beads; after brief centrifugation, the tube was placed on a magnetic rack and after complete adsorption of the beads (about 1 min), the supernatant was carefully removed. 5) Repeating step 4) once. 6) Collecting liquid to the bottom of the tube by short centrifugation, placing the centrifuge tube on a magnetic rack, and carefully sucking out the supernatant; the cover was opened and left at 25℃for about 5 minutes until the surface of the beads became matt. 7) Adding 30 μl of TE eluent, and vortexing to make the magnetic beads fully suspended in the eluent, incubating at 56 deg.C for 10min, and vortexing uniformly every 3min to promote nucleic acid full elution. 8) The centrifuge tube was briefly centrifuged and placed on a magnetic rack for 2min to transfer the DNA solution to a new centrifuge tube.

5. Methylation fluorescent quantitative PCR reaction

In order to ensure that the amplification efficiency of the fluorescent quantitative PCR reaction is between 95% and 105%, and no nonspecific amplification and primer dimer are present, a plurality of pairs of primer pairs for the methylation fluorescent quantitative PCR reaction are designed by taking the sequences of Chr5:7849790-7850675 and Chr8:48555940-48556617 after bisulfite conversion as templates respectively. And then verifying the primer pairs, amplifying target fragments by using a SYBR Green PCR system, screening 8 pairs of primer pairs for amplifying partial regions of the Chur 5:7849790-7850675 and 5 pairs of primer pairs for amplifying partial regions of the Chur 8:48555940-48556617 which meet the requirements through analysis of a dissolution curve and a standard curve, and designing corresponding Taqman detection probes for each pair of primers for the Taqman PCR reaction system. The nucleotide sequences of the respective primer pairs and probes and the target regions detected by the primers and probes are shown in Table 1.

Negative and positive controls: when the PCR reaction is performed to detect the sample, the negative control and the positive control should be detected simultaneously, and the DNA template of the negative control tube is TE buffer solution. The preparation method of the DNA template of the positive control tube comprises the following steps: artificially synthesizing the sequence which corresponds to the ACTB gene amplified region and is subjected to complete conversion by bisulphite, and cloning the sequence onto a vector to form an artificially synthesized plasmid; artificially synthesizing target regions shown as SEQ ID NO.1-13, and cloning to the carrier And (3) forming the artificially synthesized plasmid. If only methylation level of a single region is detected, the positive control DNA template is 10 ³ Copy/microliter of synthetic plasmid containing post-transformation ACTB, 10 ³ Copying/microliter of artificially synthesized plasmid containing a detection region, and mixing the two at a ratio of 1:1; if the methylation level of the composition is measured according to Table 2, the positive control DNA template is 10 ³ Copy/microliter of synthetic plasmid containing post-transformation ACTB, 10 ³ Copy/microliter of a synthetic plasmid containing a region of interest and 10 ³ Copy/microliter of the synthetic plasmid containing the other target region, and mixing the three in a ratio of 1:1:1.

Ct value reading: after the PCR is completed, a baseline is adjusted, a fluorescence value before a minimum Ct value of a sample in one PCR is advanced by 1-2 cycles is set as a baseline value, and a threshold value is set at the inflection point of an S-type amplification curve to obtain Ct values of all genes of the sample.

And (3) quality control: the negative control needs no amplification, the positive control needs obvious index increase period, and the Ct value of each gene of the positive control is between 26 and 30. The Ct value of the reference gene of the sample to be detected is less than or equal to 35, and after the negative control, the positive control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.

Analysis of PCR results

And judging the methylation level of the sample to be tested according to the Ct value detected by each target area. For a tissue sample, if the Ct value of a certain region is amplified to be less than or equal to 38, the region in the tissue sample is considered to be methylation positive, and if the Ct value of a certain region is amplified to be more than 38, the region in the tissue sample is considered to be methylation negative.

When detecting a single region, if the tissue sample to be detected is methylation positive in the region, the sample is a cancer positive sample, and if the tissue sample to be detected is methylation negative in the region, the sample is a cancer negative sample.

When the detection areas are combined, if at least one area of the tissue sample to be detected in the area combination is methylation positive, the tissue sample to be detected is a cancer positive sample, and if each area of the tissue sample to be detected in the area combination is methylation negative, the tissue sample to be detected is a cancer negative sample.

The results of diagnosing sensitivity and specificity of the prostate cancer tissue sample, the paracancerous tissue sample by detecting the methylation level of a single region in region 1-region 13 using the methylation fluorescent quantitative PCR detection method are shown in Table 3; the results of diagnosing the sensitivity and specificity of the prostate cancer tissue sample, the paracancestral tissue sample by detecting the methylation level of the combination of the region 5, the region 7 and any one of the regions 9 to 13, or the combination of the region 9, the region 13 and any one of the regions 1 to 8, respectively, are shown in Table 4.

TABLE 3 methylation status in tissue samples for region 1-region 13 and sensitivity and specificity of diagnosis

TABLE 4 methylation status of region combinations in tissue samples and sensitivity and specificity of diagnosis

As can be seen from Table 3, the methylation levels of regions 1-13 were examined individually to distinguish between prostate cancer tissue samples and paracancerous normal tissue samples, and the sensitivity of these regions for detecting prostate cancer tissue samples ranged from 66.67% to 83.91%, with the sensitivities of regions 5, 7, 9, 13 being above 80%.

As can be seen from Table 4, the sensitivity of diagnosing a prostate cancer tissue sample was high under the condition that the methylation level of the combination of the detection region 5, the detection region 7 and any one of the regions 9 to 13, or the methylation level of the combination of the detection region 9, the detection region 13 and any one of the regions 1 to 8, respectively. The sensitivity of the detection of the combination of the regions 5 and 7 and the regions 9 and 13 is higher, the sensitivity of the detection of the prostate cancer tissue sample by using the methylation level of the combination of the regions ranges from 86.21% to 88.05%, and the specificity of the detection of the prostate cancer tissue sample in the paracancerous tissue is not lower than 89.66%.

Example 15

The performance of the urine sample of the prostate cancer patient is analyzed by using a methylation fluorescent quantitative PCR method.

In order to achieve a noninvasive test, the inventors found that by detecting the methylation level of a combination of any region selected from the group consisting of Chr5:7849790-7850675 and any region selected from the group consisting of Chr8:48555940-48556617 in a urine sample from a prostate cancer patient, a prostate cancer patient can be effectively distinguished from a healthy person, and a specific test procedure is shown below.

1. Urine sample collection

Urine samples of 186 prostate cancer patients diagnosed by pathological examination and 195 healthy people who perform routine physical examination are collected, and in addition, 80 urine samples of common urinary system benign diseases (including prostatic hyperplasia, urinary tract infection, glandular cystitis, kidney stones, hydronephrosis and the like) are also collected. All urine samples collected had a volume of greater than 10mL. All urine samples were approved by the ethics committee, all volunteers signed informed consent, and all urine samples were anonymized.

2. Sample DNA extraction

The DNA of the urine sample was extracted using the nucleic acid extraction kit (Ehan Instrument No. 20210740) from the Living technologies of Wuhan Ai Misen, as follows.

1) Cleavage binding

A clean 5mL centrifuge tube was prepared, to which 100. Mu.L proteinase K was added. And after uniformly mixing the urine sample, taking 2mL to a centrifuge tube which is ready for proteinase K, sequentially adding 2mL of a lysis binding solution and 20 mu L of magnetic beads, uniformly mixing the mixture upside down, and then placing the mixture on a uniformly mixing instrument for lysis at 25 ℃ for 30min, so as to keep the magnetic beads in a suspension state.

2) Washing

Placing the centrifuge tube on a magnetic rack, and attracting magnetism for 2min until the solution is clarified, and reversing the washing of the residual magnetic beads on the tube cover for several times until the complete attraction of magnetism. Carefully sucking the waste liquid, adding 2mL of washing liquid, uniformly mixing for more than 10 times by vortex to completely disperse the magnetic beads, sucking magnetism again for 2min until the solution is clear, and reversing the residual magnetic beads on the flushing pipe cover for several times until the complete magnetic suction is achieved.

3) Rinsing

Carefully sucking the waste liquid, firstly adding 500 mu L of rinsing liquid to wash the magnetic beads to the bottom, transferring the magnetic bead suspension to a new 2mL centrifuge tube, then adding 500 mu L of rinsing liquid to completely wash the residual magnetic beads on the wall of the 5mL centrifuge tube to the bottom, transferring all the magnetic bead suspension to the 2mL centrifuge tube after instantaneous centrifugation, and carrying out vortex mixing for more than 10 times to completely disperse the magnetic beads, carrying out magnetic attraction for 2min, and reversing the residual magnetic beads on a flushing tube cover for several times until the magnetic attraction is completed after the solution is clarified. The rinsing was repeated once.

4) Elution

Taking down the centrifuge tube, centrifuging briefly to collect residual liquid, placing the centrifuge tube on a magnetic rack, and sucking the residual liquid by using a small gun head after the magnetic attraction is completed. And (5) opening the cover of the centrifuge tube and placing for 5 minutes to enable the surface of the magnetic beads to be matt. 50. Mu.L of TE (Tris-EDTA buffer solution, TE buffer) is added, the magnetic beads are dispersed by gentle shaking, the mixture is placed at 56 ℃ for eluting for 10min, and the mixture is taken out by gentle shaking every 3min, so that the magnetic beads are in a suspension state.

5) DNA solution was collected

Taking out the centrifuge tube, centrifugally collecting the liquid on the tube cover and the tube wall, placing the centrifuge tube on a magnetic rack for attracting magnetism for 1min, and carefully attracting the supernatant to obtain the DNA solution.

3. The sample DNA was transformed and purified in the same manner as in example 14.

4. The detection method of methylation fluorescent quantitative PCR was the same as in example 14.

Since the effect of distinguishing between a cancer tissue sample and a normal tissue sample is better by detecting the methylation level of the region combination in the region 1-region 13 (see Table 4), in this example, the methylation level of the detection region combination in the urine sample is selected.

5. Methylation fluorescent quantitative PCR result analysis

Reading of Ct values, quality control, and the like example 14.

PCR result analysis and interpretation method: for a urine sample, if the Ct value of the urine sample to be detected in a certain detection area is less than or equal to 45, the sample is considered to be methylation positive in the area, and if the Ct value of the urine sample to be detected in a certain detection area is more than 45, the urine sample is considered to be methylation negative in the area. In the process of combining the detection areas, if at least one area of the urine sample to be detected in the composition is methylation positive, the urine sample is a cancer positive sample, and if each area of the urine sample to be detected in the composition is methylation negative, the urine sample is a cancer negative sample.

The sensitivity and specificity of urine samples from prostate cancer patients, healthy persons, and patients with benign urinary system disease are shown in table 5 by simultaneously detecting the methylation level of the combination of region 5, region 7, and any one of regions 9-13, or the combination of region 9, region 13, and any one of regions 1-8, respectively, using the methylation fluorescent quantitative PCR assay method.

TABLE 5 methylation status of region combinations in urine samples and sensitivity and specificity of diagnosis

As can be seen from Table 5, the methylation fluorescent quantitative PCR method is effective in diagnosing benign prostatic cancer patients, healthy individuals and urinary system patients under the condition that the methylation level of the region combination of the region 5 and the region 7 with any one of the regions 9 to 13 or the methylation level of the region combination of the region 9 and the region 13 with any one of the regions 1 to 8 is detected simultaneously, wherein the sensitivity of diagnosing benign prostatic cancer patients is high and the specificity of diagnosing benign prostatic cancer patients in healthy individuals and urinary system benign diseases is not lower than 95.38% and 93.73% when the region 5 and the region 7 are combined with the region 9 and the region 13 respectively. It follows that the methylation level using region combinations A, E, F, J is optimal for diagnostic performance.

The above examples find a non-invasive, highly sensitive, highly specific method for prostate cancer diagnosis, and provide detection reagents and kits for noninvasive diagnosis of prostate cancer based on urine samples. Using the method of methylation fluorescent quantitative PCR with GRch38.p14 as the reference genome, the test sample was judged to be a prostate cancer positive sample by detecting the methylation level of a composition selected from any region of Chr5:7849790-7850675 and any region of Chr8:48555940-48556617 in a urine sample.

The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above-described embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.

The above examples merely represent a few embodiments of the present invention, which facilitate a specific and detailed understanding of the technical solutions of the present invention, but are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Further, it is understood that various changes and modifications of the present invention may be made by those skilled in the art after reading the above teachings, and equivalents thereof fall within the scope of the present application. It should also be understood that, based on the technical solutions provided by the present invention, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent of the invention should therefore be determined with reference to the appended claims, which are to be construed as in accordance with the doctrines of claim interpretation.

Claims

1. Use of a reagent for detecting the methylation level of a target region in the preparation of a diagnostic product for prostate cancer;

(1) Region A or a partial region of region A, and

(2) Region B or a partial region of region B;

2. The use according to claim 1, wherein the target area has one or more of the following technical features:

region 1 is the Chr5:7849827-7849981 plus strand,

region 2 is the forward chain of Chr5:7849986-7850142,

region 3 is the forward chain of Chr5:7850214-7850379,

region 4 is the Chr5:7850446-7850597 negative strand,

region 5 is the Chr5:7850302-7850441 negative strand,

region 6 is the Chr5:7850154-7850310 negative strand,

region 7 is the Chr5:7850029-7850179 negative strand,

Region 8 is the Chr5:7849849-7850006 negative strand,

region 9 is the Chr8:48556116-48556223 plus strand,

region 10 is the forward strand of Chr8:48556220-48556377,

region 11 is the forward chain of Chr8:48556367-48556446,

region 12 is the Chr8:48556336-48556495 negative strand,

region 13 is the Chr8:48556161-48556326 negative strand.

3. The use according to claim 2, wherein the reagent enables detection of the methylation level of the target region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

4. The use according to claim 2 or 3, wherein the reagent comprises a primer pair for detecting the methylation level of the target region, or further comprises a detection probe for detecting the target region.

5. The use according to claim 4, wherein the reagent comprises a pair of detection primers and a detection probe corresponding to the pair of detection primers for detecting the methylation level of the target region, characterized by one or more of the following features:

6. The use according to claim 5, wherein the reagent further comprises a pair of detection primers for detecting a reference gene and a detection probe corresponding to the pair of detection primers; optionally, the reference gene comprises an ACTB gene, the nucleotide sequence of a detection primer pair for detecting the ACTB gene is shown as SEQ ID NO.40 and SEQ ID NO.41, and the nucleotide sequence of a corresponding detection probe is shown as SEQ ID NO. 42.

7. The use according to any one of claims 1 to 3 and 5 to 6, wherein the sample detected comprises a cell sample, a tissue sample or a urine sample.

8. A kit for diagnosing prostate cancer, comprising the reagent as defined in any one of claims 1 to 7.

9. The kit of claim 8, further comprising one or more of a sequencing reagent, an amplification reagent, a reagent that converts unmethylated cytosine bases to uracil, and a DNA extraction reagent.

10. The kit for diagnosing prostate cancer according to claim 8 or 9, wherein the amplification reagent comprises an amplification buffer, dNTPs, DNA polymerase and Mg ²⁺ One or more of the following.