CN111440863B - Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent - Google Patents
Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent Download PDFInfo
- Publication number
- CN111440863B CN111440863B CN201910045367.8A CN201910045367A CN111440863B CN 111440863 B CN111440863 B CN 111440863B CN 201910045367 A CN201910045367 A CN 201910045367A CN 111440863 B CN111440863 B CN 111440863B
- Authority
- CN
- China
- Prior art keywords
- methylation
- kazn
- colorectal cancer
- gene
- degree
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention belongs to the field of gene diagnosis, and in particular relates to application of a KAZN gene detection reagent in preparation of colorectal cancer prognosis diagnosis reagent and a colorectal cancer prognosis diagnosis reagent/kit. The present inventors have found that methylation of the KAZN gene as a representative marker can distinguish hypermethylated colorectal cancer cases with high risk of recurrence. Based on the optimal cutoff values determined in the independent training queues, all genes that are the two classification variables have the value of independently predicting disease-free survival in the training queues and the validation queues.
Description
Technical Field
The invention belongs to the field of gene diagnosis, and in particular relates to application of a KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent and a colorectal cancer prognosis diagnosis reagent/kit.
Background
Colorectal cancer (Colorectal cancer, CRC) is common worldwide and remains the third leading cause of cancer-related death, with 39% of patients presenting with stage I-II disease. Surgery for radical cure is the standard method of treating patients with stage I-II colorectal cancer. However, the recurrence rate of post-operative fatal disease in these patients is 20-25%. In general, the clinical pathological factors currently used for the risk of early CRC stratification include T4 lesions, poor histological differentiation, ileus, perforated tumors, less than 12 lymphadenoctomy. However, these risk factors do not clearly distinguish between patients at high or low risk of disease recurrence. Thus, there is a need to increase prognostic and predictive value for current risk stratification systems, which can be achieved through the use of validated molecular markers.
In many human cancers, cpG island hypermethylation of tumor suppressor genes is used to develop biomarkers, such as WRN, MLH1 and CpG island methylation phenotypes (CpG island methylator phenotype, CIMP) with the accumulation of aberrant epigenetic changes in the progression of tumorigenesis. However, cpG islands in promoters represent only a small part of the methylation group, cpG open ses located widely in the genome also exhibit significantly wide variation in CRC patients, but have not been used for molecular markers.
Some studies have analyzed DNA methylation profiles in CRC, and their potential clinical relevance was detected using a Infinium HumanMethylation K (HM 450) chip. However, HM450 lacks coverage of the genome of the CpG open ses and reference genes and therefore the value of this method to screen for molecular markers is limited. Recently issued Infinium MethylationEPIC (EPIC) chips, new probes were designed specifically for these areas. Compared with the HM450 chip, the vast majority (78.2% of 413,745) of the newly added probes in the EPIC chip are located in CpG open ses. This provides a valuable tool for screening more clinically significant CpG sites.
Disclosure of Invention
The invention aims to provide an application of a methylation detection reagent of a colorectal cancer tumor marker in preparing a colorectal cancer prognosis diagnosis reagent.
It is another object of the present invention to provide a molecular marker for predicting colorectal cancer recurrence.
It is another object of the present invention to provide a prognostic diagnostic reagent for colorectal cancer.
It is a further object of the present invention to provide a method for detecting the genomic methylation of KAZN.
The above object of the present invention is achieved by the following technical means:
in one aspect, the invention provides the use of KAZN gene detection reagents in the preparation of colorectal cancer diagnostic reagents/kits.
In a preferred embodiment, the diagnostic reagent/kit is a diagnostic reagent/kit for prognostic use of colorectal cancer.
The present invention also found that there was a positive correlation between hypermethylation of KAZN gene and RNA expression.
That is, as an alternative embodiment, it is likely that low expression of the gene may also be used for prognostic diagnosis of colorectal cancer.
In one embodiment, the KAZN gene detection reagent is a reagent for detecting the expression level of KAZN gene, preferably a reagent for detecting the expression level of KAZN gene mRNA.
As another embodiment, the KAZN gene detection reagent is KAZN gene methylation detection reagent.
The KAZN gene detection reagent is a sequence for detecting the KAZN gene modified by a conversion reagent.
As a preferred embodiment, the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulfite;
as one embodiment, the conversion reagent is selected from bisulphite.
The present invention first discovered and systematically validated the genomic methylation of KAZN as a representative marker, and can distinguish hypermethylated CRC cases with high risk of recurrence.
The detection regions of the detection reagent for KAZN gene methylation are CpG open ses and genomic regions of the KAZN gene.
As a preferred embodiment, the sequence of the detection region of the detection reagent for methylation of the KAZN gene is SEQ ID NO:1, the specific sequence is as follows:
TGTAGCAGACAATACCGTCCAGATCCTCTTAGATCCCTTCAAGCCTTTTCTTGTGCACCA [ CG ] CTTGCCTGCCTTGGTGTGCTTCTGATTTCAGCATCCTGCATTGTGGCTCCTCTTCCAGGA. Wherein the detection site is CG in brackets.
The inventors have conducted intensive studies to obtain DNA methylation profiles at CpG open ses and the genome associated with early colorectal cancer recurrence. The study found that there were few recurrent specific differential methylation sites (differential methylation position, DMP) in CpG islands and promoters, but many in CpG open ses and genome. Tumor-specific DMP, on the contrary, has been widely reported to be located mainly in CpG islands and gene promoter regions. In the discovery cohort of the present invention, recurrence-specific DMP did not overlap with tumor-specific DMP. However, in previous studies, tumor-specific DMP is widely used to develop models for prognosis prediction.
The detection reagent contains a DNA chip.
As an alternative embodiment, in the detection of methylation of KAZN gene by the detection reagent, the methylation degree is high, and the risk of colorectal cancer recurrence is high; low methylation, the risk of colorectal cancer recurrence is low.
As a preferred embodiment, the KAZN gene methylation degree of the threshold value of 61.3% -66.51%.
As a more preferable embodiment, the threshold value of the methylation degree of the KAZN gene is 63.5% -66.45%.
As a further preferable embodiment, the threshold value of the methylation degree of the KAZN gene is 65.5% -66.4%.
As a most preferred embodiment, the threshold value of the methylation degree of the KAZN gene is 66.39%.
In the invention, the detection sample of the detection reagent is tissue.
In addition, these new methylation markers can also be studied in other clinical samples, including stool and blood samples, to investigate their broader clinical use in predicting early recurrence.
As a preferred embodiment, the detection sample of the detection reagent is a tissue.
In a more preferred embodiment, the test sample of the test reagent is intestinal mucosal tissue.
In another aspect, the present invention provides a colorectal cancer prognostic diagnostic reagent/kit comprising a KAZN gene methylation detection reagent.
As a preferred embodiment, the kit further comprises a transforming reagent.
As a preferred embodiment, the reagent/kit contains reagents for detecting the sequence of the KAZN gene modified with a transforming reagent.
As a more preferred embodiment, the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulfite.
As a most preferred embodiment, the conversion reagent is selected from the group consisting of bisulfites.
As an alternative embodiment, the reagent/kit further comprises a pair of oligonucleotide Taqman probes for detecting methylation of the KAZN gene.
As a more preferred embodiment, the probe is a probe comprising a probe specifically binding to CG and a probe specifically binding to TG.
As a further preferred embodiment, the probe is as set forth in SEQ ID NO: 2. SEQ ID NO: 3.
As a preferred embodiment, the reagent/kit further contains primers for detecting methylation of the KAZN gene.
As a more preferred embodiment, the primer is selected from the group consisting of SEQ ID NO: 4. SEQ ID NO: 5.
As an alternative embodiment, the reagent/kit further comprises one or more of DNA polymerase, dNTPs, mg2+ ions and buffer.
As a preferred embodiment, the reagent/kit contains DNA polymerase, dNTPs, mg2+ ions and buffer.
In another aspect, the present invention provides a colorectal cancer prognostic diagnostic reagent/kit comprising a reagent for detecting the expression level of KAZN gene.
As a preferred embodiment, the reagent/kit contains a reagent for detecting the mRNA expression level of the KAZN gene.
In another aspect, the invention provides a chip for prognosis of colorectal cancer, comprising a solid support and a probe for methylation of the KAZN gene immobilized on the solid support.
In yet another aspect, the invention provides a prognostic colorectal cancer diagnostic system comprising:
a detection member: the detection component is used for detecting the methylation degree of KAZN genes of a diagnosis object;
and a result judgment means: the result judging component is used for outputting a methylation percentage parameter PMR or a disease risk result according to the result of the methylation degree of the KAZN gene detected by the detecting component.
As a preferred embodiment, the disease risk result is one or more of the likelihood of disease, or probability of disease, or disease type.
As a preferred embodiment, the percent methylation parameter PMR is methylation/(methylation+unmethylation). Times.100.
As a further preferred embodiment, the methylation percentage parameter pmr=methylation fluorescence value/(methylation fluorescence value+unmethylation fluorescence value) ×100.
As a still further preferred embodiment, the methylation percentage parameter pmr=100/(1+1/2) -ΔCT ) Δct = CT methylated fluorescence-CT unmethylated fluorescence.
As a preferred embodiment, the detection component is one or more of an ultra-micro spectrophotometer, a real-time fluorescence quantitative PCR instrument and an ultra-high sensitivity chemiluminescence imaging system.
As a preferred embodiment, the result judging means includes an input module, an analysis module, and an output module; the input module is used for inputting the methylation degree of the KAZN gene; the analysis module is used for analyzing the possibility or risk value of recurrence of the colorectal cancer after cure or the colorectal cancer of healthy people according to the methylation degree of the KAZN gene; the output module is used for outputting the analysis result of the analysis module.
As a preferred embodiment, the analysis module is used to analyze the likelihood or risk value of recurrence of colorectal cancer after healing.
As a preferred embodiment, the methylation level of the KAZN gene is the methylation level of the CG locus of the KAZN genomic region in the sample.
As a preferred embodiment, the diagnostic sample of the diagnostic system is tissue, stool or blood.
As a more preferred embodiment, the diagnostic sample of the diagnostic system is tissue.
As a most preferred embodiment, the diagnostic sample of the diagnostic system is intestinal mucosal tissue.
As a preferred embodiment, in the result judging means, when the methylation degree of the KAZN gene is high, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high; when the degree of methylation of the KAZN gene is low, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is low.
As a further preferred embodiment, in the structural judgment means, when the degree of methylation of KAZN gene is higher than the threshold value of 61.3% -66.51%, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high; when the methylation degree of the KAZN gene is lower than a threshold value of 61.3-66.51%, judging that the colorectal cancer recurs after healing or the colorectal cancer of healthy people is low in risk of suffering from the colorectal cancer;
as a more preferred embodiment, in the structural judgment means, when the methylation degree of the KAZN gene is higher than the threshold value of 63.5% -66.45%, the risk of recurrence of colorectal cancer after cure or colorectal cancer of healthy subjects is judged to be high; when the methylation degree of the KAZN gene is lower than the threshold value of 63.5% -66.45%, the recurrence of colorectal cancer after cure or the low risk of colorectal cancer of healthy people is judged.
As a still further preferred embodiment, in the structural judgment means, when the methylation degree of the KAZN gene is higher than the threshold value of 65.5% -66.4%, it is judged that the risk of recurrence of colorectal cancer after cure or the colorectal cancer of healthy subjects is high; when the methylation degree of the KAZN gene is lower than the threshold value of 65.5% -66.4%, the recurrence of colorectal cancer after cure or the low risk of colorectal cancer of healthy people is judged.
As a most preferred embodiment, in the structural judgment means, when the degree of methylation of KAZN gene is higher than the threshold 66.39%, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high; when the degree of methylation of the KAZN gene is below the threshold 66.39%, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is low.
In the present invention, the colorectal cancer described above is preferably stage I-II colorectal cancer.
The invention has the beneficial effects that:
1. most methylation prognosis-based markers used in the prior art target CpG islands. This may be one of the reasons that markers found in the past are highly heterogeneous in different queues. The present invention has found DNA methylation profiles at CpG open ses or the genome associated with early recurrence. Predictive models based on CpG open sea or genomic methylation can better predict early relapse in CRC patients.
2. The research of the invention discovers and systematically verifies that the methylation of the KAZN genome can be used as a marker for recurrence after early CRC radical surgery, and the methylation of the KAZN gene can be used as a representative marker to distinguish hypermethylated colorectal cancer cases with high recurrence risk. Based on the optimal cutoff values determined in the independent training queues, all genes that are the two classification variables have the value of independently predicting disease-free survival in the training queues and the validation queues.
Drawings
FIG. 1 is a schematic diagram of the sequences of detection regions of the KAZN gene, the FHIT gene and the SGIP1 gene after bisulphite treatment, primers, probes and CpG sites to be detected.
FIG. 2 comparison of KAZN gene with other genes or indicators in the prognostic diagnosis of colorectal cancer:
detection of kazn methylation in predicting patient prognosis;
detection of CIMP phenotype in predicting prognosis of patient;
less than 12 total T4 lesions, tumor ileus or perforations or lymph node biopsies of stage C-e.ii colorectal cancer, in the detection of prognosis of early colorectal cancer;
F-H value comparison of molecular typing KRAS mutation, BRAF mutation and high microsatellite instability in predicting early colorectal cancer prognosis;
FIG. 3. Value of KAZN gene in prognosis diagnosis of colorectal cancer compared to FHIT and SGIP1 genes in predicting early colorectal cancer prognosis.
FIG. 4 there is a positive correlation between DNA methylation and mRNA expression of three candidate genes in colon cancer cells after treatment with the DNA methylation inhibitor 5-aza-2' -deoxyytidine.
Detailed Description
The technical solution of the present invention is further illustrated by the following specific examples, which do not represent limitations on the scope of the present invention. Some insubstantial modifications and adaptations of the invention based on the inventive concept by others remain within the scope of the invention.
The term "diagnostic reagent/kit" may be a diagnostic reagent or a diagnostic kit.
"prognosis" refers to predicting the likely course and outcome of a disease, predicting the likelihood of disease recurrence.
Genome: a gene is the entire nucleotide sequence required to produce a polypeptide chain or functional RNA, and the genome, i.e., the major portion of the gene, generally refers to the entire nucleotide sequence of a gene from which the promoter region (typically the 2000bp region upstream and downstream of the transcription initiation site) is removed.
CpG island: the distribution of CpG dinucleotides in the human genome is very heterogeneous, with CpG remaining at or above normal frequencies in certain sections of the genome. CpG islands are mainly located in promoter and exon regions of genes, are some regions rich in CpG dinucleotides, and have the length of 300-3000 bp. Typically defined as GC content exceeding 55% and the actual to expected number of CpG dinucleotides ratio greater than 65%, the expected number of CpG dinucleotides calculated as (number C x number G)/sequence length.
Colorectal cancer: colorectal cancer, CRC.
The degree of methylation may be determined in a manner commonly used in the art.
In one embodiment of the invention, the degree of methylation may be calculated or determined in accordance with the following manner. For example, the methylation degree is calculated in the present invention using the following formula: pmr=100/(1+1/2) -ΔCT ) Δct = CT methylated fluorescence-CT unmethylated fluorescence. The methylation ratio or percent methylation Parameter (PMR), i.e. the degree of methylation, occurs in the present invention.
Threshold of methylation degree: the invention uses the threshold value of methylation degree to define the value or the value range of the colorectal cancer recurrence risk, namely, the colorectal cancer recurrence risk is high when the value is higher than the preset threshold value; below a given threshold, colorectal cancer is at low risk of recurrence. The threshold value that appears in the present invention is determined corresponding to the methylation degree calculation method in the above-described one embodiment.
CIMP (CpG island methylator phenotype): refers to the CpG island methylation phenotype.
DMP (differential methylation position): refers to differential methylation sites, i.e., cpG sites where there are significant differences in methylation statistics (q-values) and biology (Δβ) in the two sets of samples.
Statistical analysis
The primary endpoint is disease-free survival (DFS), defined as the time from the day of surgery to the point of recurrent metastasis, cancer-related death, or follow-up cutoff. For each prognostic marker, training cohort patients were assigned the best cutoff value by using the minimum p-value method of R-package 'survivinMisc' into hypermethylated and hypomethylated groups, with highest χ 2 The value (minimum p-value) is defined by Kaplan-Meier survival analysis and Log-rank test. Patients in the validation queue are divided into two groups based on the cutoff values defined in the training queue. Bonferroni correction was used for survival analysis of multiple candidate methylation markers. The prognostic value of candidate molecular markers is also corrected in a multifactorial Cox regression model that contains multiple markers and clinical pathology features. The predictive Cox model is built from estimated regression coefficients generated in a proportional hazards model. The invention also investigated the accuracy of marker prognosis or prediction by time-dependent ROC curve analysis using R-package "survivinvalroc". All statistical tests were done using R software 3.0.1. Statistical significance was set at 0.05.
Example 1 sample Source
Case sample patient characterization
Patients who were pathologically verified to be stage I-II CRC and received surgical resection may be included as a discovery, training or verification cohort of cases. Patients who had previously received any anti-cancer treatment, had a history of any tumor other than CRC, and had substantial degradation of the DNA sample were excluded.
First, 45 cases of fresh frozen tumor tissue and paracancerous normal tissue were collected in stage I-II CRC patients and analyzed on whole genome methylation chips. Patients with less than 12 lymph node resection assays were excluded from ileus or perforation, vascular or neurological aggression. Depending on age, sex, TNM stage, date of surgery (±5 years) and tumor location, the group of 45 patients contained 21 patients with recurrence in the follow-up and 24 patients who achieved survival without recurrence of tumor in the paired follow-up. These 45 patients consisted of a discovery cohort for finding molecular markers. Samples were obtained from the sixth hospital affiliated with the university of guangzhou mountain from 1 month 6 to 30 months 2011. For training set analysis, a retrospective study was performed on 174 formalin-fixed, paraffin-embedded (FFPE) phase I-II CRC samples collected at the university of middle mountain, guangzhou, from 1 st 2000 to 30 th 2011, attached to the first and sixth hospitals. These patients form a training cohort from which the best predictive model is determined and validated. To further independently verify the determined prognostic markers and models, retrospective analysis was performed using 267 histologically confirmed FFPE tissue DNA of stage I-II CRC patients collected at the university of guangzhou tumor center and the southern hospitals of southern medical science, guangzhou, at 1 month 6 to 30 month 2012.
In general, all patients were staged according to the TNM staging criteria and follow-up and treatment according to NCCN guidelines. Tumor marker prognostic study recommendation (Recommendations for Tumor Marker Prognostic Studies, REMARK) criteria were used to evaluate prognostic markers. The study was approved by the institute of university of chinese institutional review board and all patients had signed written informed consent.
Detailed clinical pathology features of the training and independent validation cohorts were found by sample analysis as shown in table 1. 486 patients received surgical resection and histological examination were negative resection margin. Median follow-up time was 77 months (quartile range IQR 54-102), with 98 out of 486 (20.1%) patients experiencing tumor recurrence during follow-up. In the discovery cohort, 21 relapsed and 24 paired non-relapsing patients were similar in clinical and demographic characteristics with a median follow-up time of 58 months (table 2).
Table 1 baseline characteristics of different cohorts of patients
Table 2 finds baseline characteristics of relapsed and non-relapsing CRC patients in cohorts
EXAMPLE 2 methylation detection of the KAZN Gene
The level of methylation of gene CpG sites was detected using qMSP.
The gene detected: KAZN;
comparison genes: FHIT, SGIP1.
1. Quantitative methylation-specific PCR
Genomic DNA was extracted and bisulphite modified using QIAamp DNA Mini Kit (Qiagen, 51306) and EZ DNA methylation kit (Zymo Research, D5002).
Quantitative methylation specific PCR (quantitative methylation-specific PCR, qMSP) was used to detect the CpG sites to be detected in the genome or CpG open sea in different queues to assess and verify their relationship to the prognosis of CRC patients.
In this assay, bisulfite-converted genomic DNA is amplified using primers and a pair of oligonucleotide probes covering the CpG sites to be tested, each of which is linked at its 5 'end to a fluorescent reporter dye 6FAM or VIC (specifically binding to the methylated and unmethylated sites, respectively) and at its 3' end to a quencher-MGB group (MGB-NFQ).
For three sites to be tested in the KAZN, FHIT and SGIP1 genome, the present invention designed three sets of primers and probes specific for the present invention, as shown in table 3. The probe covers only a single CpG dinucleotide, so that the methylation level of a single CpG can be measured.
Fluorescent signals in the PCR reactions were detected by a Applied Biosystems QuantStudio Flex real-time PCR system. The methylation ratio (methylation percentage parameter PMR) of the CpG sites to be tested of each sample is equal to methylation signal/(methylation signal+unmethylation signal). Times.100, and when specifically calculated, the following formula is used: pmr=100/(1+1/2) -ΔCT ) Δct=ct methylation fluorescence-CT unmethylated fluorescence;
a20 uL reaction system was used, which included 500nM primer, 150nM probe, dATP, dCTP, dGTP and 200nM,2.25mM MgCl2,0.75U HotStar Taq enzyme dTTP, 1 XPCR buffer. The reaction conditions are as follows: first 15 minutes at 95℃and then 50 cycles of 30 seconds at 94℃and 1 minute at 56-60℃and 1 minute at 72 ℃.
2. Genetic locus information
(1)ID:cg06887407
UCSC_RefGene_Name:KAZN
UCSC_RefGene_Accession:NM_201628；NM_015209
chr:chr1
pos:15086357
strand:+
Relation_to_Island:OpenSea
UCSC_RefGene_Group:Body
Bisulfite pretreatment pre-sequence:
SEQ ID NO：1
TGTAGCAGACAATACCGTCCAGATCCTCTTAGATCCCTTCAAGCCTTTTCTTGTGCACCA[CG]CTTGCCTGCCTTGGTGTGCTTCTGATTTCAGCATCCTGCATTGTGGCTCCTCTTCCAGGA
as shown in FIG. 1, the sequence of the detection region of the KAZN gene after bisulphite treatment, primers, probes and CpG sites to be detected are all marked in the figure.
(2)ID:cg05704547
UCSC_RefGene_Name:FHIT
UCSC_RefGene_Accession:NM_002012
chr:chr3
pos:60067722
strand:+
Relation_to_Island:OpenSea
UCSC_RefGene_Group:Body
Bisulfite pretreatment pre-sequence:
SEQ ID NO：40
ATGAGTTCACTGCATTGTCTACTTATCTGTTTTTGTAATTTCAACTTTTATTTTTGATTT[CG]GGGTGCACATGTGGGTTTGTTCCATAGGTATATTGCATGATGCTCATGTTTGGGGTATGA
as shown in FIG. 1, the sequence of the FHIT gene detection region after bisulphite treatment, the primers, probes and CpG sites to be detected are all marked in the figure.
(3)ID:cg05971061
UCSC_RefGene_Name:SGIP1
UCSC_RefGene_Accession:NM_032291
chr:chr1
pos:66998484
strand:+
Relation_to_Island:N_Shore
UCSC_RefGene_Group:TSS1500
Bisulfite pretreatment pre-sequence:
SEQ ID NO：41
TAGGCTGCCCTGCCCTTTTCTTCCTTCGCTGTCTGAGCTTTCTTGAAGGGAACCAAGGGT[CG]TAGATCCCCCAGGGCTGGGCCCTTCTGAAAGGCTCCATGGTCTCTGGAGAGCAGTCAGGT
as shown in FIG. 1, the sequence of the SGIP1 gene detection region after bisulphite treatment, primers, probes and CpG sites to be detected are all marked in the figure.
TABLE 3 primer and probe sequences
/>
/>
Example 3 detection of the methylation degree of the KAZN Gene in tumor tissues of colorectal cancer patients
As shown in Table 4 below, in the tumor tissues of 8 cases of colorectal cancer patients at stage I-II, the methylation degree of the KAZN gene was examined in the same manner as in example 2, and methylation was determined to be high at a methylation ratio of 66.39% or higher and low at a methylation ratio of less than 66.39%. From the results in table 4, KAZN hypermethylated colorectal cancer patients have a significantly higher risk of recurrence than hypomethylated patients.
TABLE 4 detection results of methylation degree of KAZN Gene
Example 4 comparison of the KAZN Gene with other genes or indicators in the prognostic diagnosis of colorectal cancer
In the following experiments (1) and (2), the test samples were from 441 patients suffering from colorectal cancer at stage I-II in the same batch.
(1) Comparison with CpG Island Methylation Phenotype (CIMP)
CpG island methylation phenotype (CpG Island Methylator Phenotype, CIMP) is a type of colorectal cancer with different clinical and molecular characteristics, and CIMP is currently used as a molecular marker for prognosis and chemosensitivity of colorectal cancer, and is more widely used in Western countries. The invention adopts the international general technical flow, uses the fluorescent quantitative methylation specificity PCR technology to detect the methylation levels of CACNA1G, IGF, NEUROG1, RUNX3 and SOCS1 genes, and determines the CIMP state of the sample. ([ 1]. Shiovitz S, bertagoli MM, renfro LA, et al CpG island methylator phenotype is associated with response to adjuvant irinotecan-based therapy for stage III colon cancer. Gastroenterology.2014.147 (3): 637-45; [2]. Weisenberger DJ, simmond KD, campan M, et al CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet.2006.38 (7): 787-93.). The primers and probes are shown in Table 3. The results are expressed by the methylation percentage parameter, greater than 4% defined as methylated, less than 4% defined as unmethylated, 3 to 5 genes methylation determined to be CIMP positive, and 0 to 2 genes methylation determined to be CIMP negative.
The present invention compares the value of KAZN methylation (test method is the method in example 2) with the CIMP phenotype in predicting patient prognosis in 441 patients with stage I-II colorectal cancer. The proportion of colorectal cancer patients with CIMP phenotype (cimp+) in the chinese population (17/441,3.8%) was significantly lower than 10-15% of the western population reported in the literature (1]Jia M,Jansen L,Walter V,et al.No association of CpG island methylator phenotype and colorectal cancer survival:population-based student. Br J cancer 2016.115 (11): 1359-1366; [2]Shiovitz S,Bertagnolli MM,Renfro LA,et al.CpG island methylator phenotype is associated with response to adjuvant irinotecan-based therapy for stage III colon cancer. Gastroenterology.2014.147 (3): 637-45), but was approximately comparable to the BRAF mutation rate in the chinese population, which was substantially consistent with its positive rate. The experimental results of the present invention are shown in fig. 2A, 2B, where the CIMP phenotype predicts significantly lower value of risk for long-term recurrence than KAZN methylation (HR 1.09vs.2.37, p=0.880 vs. < 0.001).
The results indicate that KAZN single gene methylation is used to predict recurrence risk in early colorectal cancer patients, superior to the CIMP phenotype consisting of five gene methylation.
(2) Comparison with clinical pathological risk factors and classical molecular typing
The prior literature reports that less than 12T 4 lesions, tumor ileus or perforations or lymph node biopsies of stage II colorectal cancer are high risk factors for tumor recurrence, metastasis and death. However, there is controversy that these clinical pathological factors have inconsistent results from one cohort to another (Zhang JX, song W, chen ZH, et al Prognosptic and predictive value of a microRNA signature in stage II colon cancer: a microRNA expression analysis.Lancet Oncol.2013.14 (13): 1295-306.). Thus, the present invention further compares the value of KAZN gene methylation with its value in predicting early colorectal cancer prognosis. In 441 patients with stage I-II colorectal cancer, as shown in FIGS. 2A, 2C, 2D, and 2E, less than 12 total tumor ileus or perforations or lymph node biopsies were significantly less valuable than KAZN methylation in predicting the risk of distant recurrence.
KRAS mutations, BRAF mutations and high microsatellite instability (high-level microsatellite instability, MSI-H) are the most common molecular typing used in clinical diagnosis and treatment of colorectal cancer. Thus, the present invention also compares the methylation of KAZN genes with their prognostic value. As shown in FIGS. 2A, 2F, 2G, and 2H, the predicted value of these molecular types was significantly lower than KAZN methylation.
(3) Comparison with FHIT and SGIP1 genes
The present invention compares the value of KAZN methylation with FHIT, SGIP1 methylation in predicting patient prognosis in 174 and 267 patients with stage I-II colorectal cancer. Wherein the methylation test method is the same as in example 2.
In the training and validation cohorts, the methylation level of three candidate CpG sites was detected using qMSP. In the training cohort, all candidate genes were split into hypermethylated or hypomethylated groups based on the cutoff value determined by the least p method in Kaplan-Meier analysis. In the validation queue, patients are divided into two groups according to the cutoff values defined in the training queue.
As shown in fig. 3, methylation of all three genes was significantly correlated with patient disease-free survival in the first cohort; KAZN remained significantly associated with patient disease-free survival in the second independent cohort, while FHIT and SGIP1 were not statistically significant.
Thus, KAZN methylation as a molecular marker predicts better reproducibility of the risk of distant recurrence in early colorectal cancer patients.
The present invention also found that there was a positive correlation between DNA methylation and mRNA expression of three candidate genes following treatment with the DNA methylation inhibitor 5-aza-2' -deoxyytidine in colon cancer cells. As shown in FIG. 4, it was shown that these genomic methylation may play a role in gene expression.
Sequence listing
<110> university of Zhongshan affiliated sixth Hospital
Sun Yat-Sen University
<120> application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent
<160> 41
<170> SIPOSequenceListing 1.0
<210> 2
<211> 122
<212> DNA
<213> Homo sapiens
<400> 2
tgtagcagac aataccgtcc agatcctctt agatcccttc aagccttttc ttgtgcacca 60
cgcttgcctg ccttggtgtg cttctgattt cagcatcctg cattgtggct cctcttccag 120
ga 122
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
amttaaggta ggtaagcgtg gmgbn 25
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
vcaaggtagg taagtgtggt gtmgbn 26
<210> 4
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ttggaagagg agttataatg taggatgttg 30
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cctcttaaat cccttcaaac cttttcttat 30
<210> 6
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
attcgatgag tttattgtat tgtttattta tttg 34
<210> 7
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
tcatacccca aacataaaca tcataca 27
<210> 8
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
amtgatttcg gggtgtatam gbn 23
<210> 9
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
vctttgattt tggggtgtat mgbn 24
<210> 10
<211> 31
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
tttagagatt atggagtttt ttagaagggt t 31
<210> 11
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tcataaacta ccctaccctt ttcttcctt 29
<210> 12
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
amgttttggg ggatttacga mgbn 24
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
vcgttttggg ggatttatga mgbn 24
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
ttttttcgtt tcgcgtttag gt 22
<210> 15
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
ctcgaaacga cttcgccg 18
<210> 16
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
amaaataacg ccgaatccga caaccgabh 29
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gagcggtttc ggtgtcgtta 20
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
ccaactcgat ttaaaccgac g 21
<210> 19
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
amccctctac cgtcgcgaac ccgabh 26
<210> 20
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
cgtgtagcgt tcgggtattt gta 23
<210> 21
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
cgataattac gaacacactc cgaat 25
<210> 22
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
amcgataacg acctcccgcg aacataaabh 30
<210> 23
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
cgttcgatgg tggacgtgt 19
<210> 24
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
gacgaacaac gtcttattac aacgc 25
<210> 25
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
amcgcacgaa ctcgcctacg taatccgbh 29
<210> 26
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
gcgtcgagtt cgtgggtatt t 21
<210> 27
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
ccgaaaccat cttcacgcta a 21
<210> 28
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
amacaattcc gctaacgact atcgcgcabh 30
<210> 29
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
ggttaggtat agtggtttat atttgtaatt ttagta 36
<210> 30
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
attaactaaa ctaatcttaa actcctaacc tca 33
<210> 31
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
amcctacctt aacctcccmg bn 22
<210> 32
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
ggagcgagat ccctccaaaa t 21
<210> 33
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
ggctgttgtc atacttctca tgg 23
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
gaagccggac agactgtgaa 20
<210> 35
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
tgaaagtaga cccgcagagc 20
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
gagtgtgcgc gtgaaggag 19
<210> 37
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
ctttggtaga gccgggttcc 20
<210> 38
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 38
cctctgtcat ctccgacgca 20
<210> 39
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 39
ggactgtcgc cgttgcag 18
<210> 40
<211> 122
<212> DNA
<213> Homo sapiens
<400> 40
atgagttcac tgcattgtct acttatctgt ttttgtaatt tcaactttta tttttgattt 60
cggggtgcac atgtgggttt gttccatagg tatattgcat gatgctcatg tttggggtat 120
ga 122
<210> 41
<211> 122
<212> DNA
<213> Homo sapiens
<400> 41
taggctgccc tgcccttttc ttccttcgct gtctgagctt tcttgaaggg aaccaagggt 60
cgtagatccc ccagggctgg gcccttctga aaggctccat ggtctctgga gagcagtcag 120
gt 122
Claims (33)
- The application of the KAZN gene detection reagent in preparing colorectal cancer prognosis diagnosis reagent or kit, wherein the KAZN gene detection reagent is KAZN gene methylation detection reagent.
- 2. The use according to claim 1, wherein the KAZN gene detection reagent is a reagent for detecting a sequence of a KAZN gene modified with a conversion reagent.
- 3. The use according to claim 2, wherein the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulphite.
- 4. The use according to claim 2, wherein the conversion reagent is selected from bisulphites.
- 5. The use according to claim 1, wherein the detection region of the detection reagent for methylation of the KAZN gene is the cpgolenseas or genomic region of the KAZN gene.
- 6. The use according to claim 1, wherein the sequence of the detection region of the KAZN gene-methylated detection reagent comprises the sequence of SEQ ID NO:1, and a sequence shown in 1.
- 7. The use according to claim 1, wherein the detection reagent comprises a DNA chip.
- 8. The use according to claim 1, wherein in the detection of methylation of the KAZN gene, the degree of methylation is high and the risk of colorectal cancer recurrence is high; when the degree of methylation is low, the risk of colorectal cancer recurrence is low.
- 9. The use according to claim 8, wherein the KAZN gene methylation level has a threshold value of 61.3% to 66.51%.
- 10. The use according to claim 8, wherein the threshold value for the degree of methylation of the KAZN gene is 63.5% to 66.45%.
- 11. The use according to claim 8, wherein the threshold value for the degree of methylation of the KAZN gene is 65.5% to 66.4%.
- 12. The use according to claim 8, wherein the threshold value for the methylation degree of the KAZN gene is 66.39%.
- 13. The use according to claim 1, wherein the test sample of the test agent is tissue, stool or blood.
- 14. The use of claim 13, wherein the test sample is tissue.
- 15. The use of claim 13, wherein the test sample is intestinal mucosal tissue.
- 16. A prognostic colorectal cancer diagnostic system, said diagnostic system comprising:a detection member: the detection component is used for detecting the methylation degree of KAZN genes of a diagnosis object;and a result judgment means: the result judging component is used for outputting a methylation percentage parameter PMR or a disease risk result according to the result of the methylation degree of the KAZN gene detected by the detecting component.
- 17. The diagnostic system of claim 16, wherein the disease risk outcome is one or more of a probability of a disease, or a type of disease.
- 18. The diagnostic system of claim 16, wherein the percent methylation parameter PMR is methylation/(methylation+unmethylation) ×100.
- 19. The diagnostic system of claim 16, wherein the methylation percentage parameter PMR = methylation fluorescence value/(methylation fluorescence value + unmethylation fluorescence value) ×100.
- 20. The diagnostic system of claim 16, wherein the methylation percentage parameter PMR = 100/(1+1/2) -ΔCT ) Δct = CT methylated fluorescence-CT unmethylated fluorescence.
- 21. The diagnostic system of claim 16, wherein the detection means is one or more of an ultra-micro spectrophotometer, a real-time fluorescent quantitative PCR instrument, and an ultra-high sensitivity chemiluminescent imaging system.
- 22. The diagnostic system of claim 16, wherein the result determination means comprises an input module, an analysis module, and an output module; the input module is used for inputting the methylation degree of the KAZN gene; the analysis module is used for analyzing the possibility or risk value of recurrence of the colorectal cancer after cure or the colorectal cancer of healthy people according to the methylation degree of the KAZN gene; the output module is used for outputting the analysis result of the analysis module.
- 23. The diagnostic system of claim 22, wherein the analysis module is configured to analyze a likelihood or risk value for recurrence of colorectal cancer after healing.
- 24. The diagnostic system of claim 16, wherein the degree of methylation of the KAZN gene is the degree of methylation of CG sites in a genomic region of the KAZN gene in the sample.
- 25. The diagnostic system of claim 16, wherein the diagnostic sample of the diagnostic system is a tissue, stool or blood sample.
- 26. The diagnostic system of claim 16, wherein the diagnostic sample of the diagnostic system is tissue.
- 27. The diagnostic system of claim 16, wherein the test sample of the diagnostic system is intestinal mucosal tissue.
- 28. The diagnostic system according to claim 16, wherein the outcome determination means determines that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high when the degree of methylation of the KAZN gene is high; when the degree of methylation of the KAZN gene is low, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is low.
- 29. The diagnostic system of claim 28, wherein the outcome determination means determines that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high when the degree of KAZN gene methylation is higher than a threshold value of 61.3% to 66.51%; when the methylation degree of the KAZN gene is lower than the threshold value of 61.3% -66.51%, the recurrence of colorectal cancer after cure or the low risk of colorectal cancer of healthy people is judged.
- 30. The diagnostic system of claim 28, wherein the outcome determination means determines that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high when the degree of methylation of the KAZN gene is higher than a threshold value of 63.5% to 66.45%; when the methylation degree of the KAZN gene is lower than the threshold value of 63.5% -66.45%, the recurrence of colorectal cancer after cure or the low risk of colorectal cancer of healthy people is judged.
- 31. The diagnostic system of claim 28, wherein the outcome determination means determines that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high when the degree of KAZN gene methylation is higher than a threshold value of 65.5% to 66.4%; when the methylation degree of the KAZN gene is lower than the threshold value of 65.5% -66.4%, the recurrence of colorectal cancer after cure or the low risk of colorectal cancer of healthy people is judged.
- 32. The diagnostic system of claim 28, wherein the outcome determination means determines that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is high when the degree of KAZN gene methylation is higher than a threshold 66.39%; when the degree of methylation of the KAZN gene is below the threshold 66.39%, it is judged that the risk of recurrence of colorectal cancer after cure or colorectal cancer in healthy subjects is low.
- 33. The use according to any one of claims 1 to 15, or the diagnostic system according to any one of claims 16 to 32, wherein said colorectal cancer is stage I-II colorectal cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910045367.8A CN111440863B (en) | 2019-01-17 | 2019-01-17 | Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910045367.8A CN111440863B (en) | 2019-01-17 | 2019-01-17 | Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111440863A CN111440863A (en) | 2020-07-24 |
| CN111440863B true CN111440863B (en) | 2023-08-01 |
Family
ID=71626673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910045367.8A Active CN111440863B (en) | 2019-01-17 | 2019-01-17 | Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111440863B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501306A (en) * | 2020-12-28 | 2021-03-16 | 深圳市海普洛斯生物科技有限公司 | Kit for CpG island methylation phenotype detection and application thereof |
| CN116162709A (en) * | 2022-05-19 | 2023-05-26 | 上海爱谱蒂康生物科技有限公司 | NMIBC prognosis prediction model, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014062218A1 (en) * | 2012-10-16 | 2014-04-24 | University Of Southern California | Colorectal cancer dna methylation markers |
| WO2018008740A1 (en) * | 2016-07-08 | 2018-01-11 | 有限会社ハヌマット | Method for judging onset possibility of large bowel cancer |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2698436A1 (en) * | 2012-08-14 | 2014-02-19 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Colorectal cancer markers |
-
2019
- 2019-01-17 CN CN201910045367.8A patent/CN111440863B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014062218A1 (en) * | 2012-10-16 | 2014-04-24 | University Of Southern California | Colorectal cancer dna methylation markers |
| WO2018008740A1 (en) * | 2016-07-08 | 2018-01-11 | 有限会社ハヌマット | Method for judging onset possibility of large bowel cancer |
Non-Patent Citations (1)
| Title |
|---|
| Huichuan Yu等.Novel Assay for Quantitative Analysis of DNA Methylation at Single-Base Resolution.Clinical Chemistry.2019,第65卷(第5期),1-10. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111440863A (en) | 2020-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102686744B (en) | Method for detecting the methylation of colon-cancer-specific methylation marker genes for colon cancer diagnosis | |
| US9850540B2 (en) | Method for detecting lung cancer using lung cancer-specific methylation marker gene | |
| AU2004237861B2 (en) | Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients | |
| US20180258487A1 (en) | Composite biomarkers for non-invasive screening, diagnosis and prognosis of colorectal cancer | |
| US20170121775A1 (en) | Detection and Prognosis of Lung Cancer | |
| JP2016500521A (en) | Gastric polyp and gastric cancer detection method using gastric polyp and gastric cancer-specific methylation marker gene | |
| US20220307091A1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| US10214778B2 (en) | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro | |
| EP2611943A2 (en) | Methods and compositions for correlating genetic markers with prostate cancer risk | |
| WO2015169857A1 (en) | Breast cancer epigenetic markers useful in anthracycline treatment prognosis | |
| CN111440863B (en) | Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent | |
| US20090186360A1 (en) | Detection of GSTP1 hypermethylation in prostate cancer | |
| US20180223367A1 (en) | Assays, methods and compositions for diagnosing cancer | |
| CN111440866B (en) | Application of DUSP3 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent | |
| EP2450455B1 (en) | Method for determining presence or absence of epithelial cancer-origin cell in biological sample, and kit therefor | |
| CN111440864B (en) | Application of TLE4 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent | |
| CN111440865B (en) | Application of FAT3 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent | |
| EP3775289A1 (en) | Methylation-based biomarkers in breast cancer screening, diagnosis, or prognosis | |
| CN116179694A (en) | Application of reagent for detecting methylation level in preparation of prostate cancer diagnosis product and prostate cancer diagnosis kit | |
| US20090186359A1 (en) | Detecting prostate cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |