CN114959030A - Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer - Google Patents
Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer Download PDFInfo
- Publication number
- CN114959030A CN114959030A CN202210542498.9A CN202210542498A CN114959030A CN 114959030 A CN114959030 A CN 114959030A CN 202210542498 A CN202210542498 A CN 202210542498A CN 114959030 A CN114959030 A CN 114959030A
- Authority
- CN
- China
- Prior art keywords
- chr6
- seq
- primer pair
- methylation
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an application of a reagent for detecting HCG9 gene methylation in preparation of a product for diagnosing bladder cancer. The bladder cancer is diagnosed by detecting HCG9 gene methylation, so that the method has high specificity, can effectively improve the detection rate of early bladder cancer, has high stability and accuracy, is easy for early diagnosis, has low dependence on the technical level of a doctor, is non-invasive and has good application prospect.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of a reagent for detecting HCG9 gene methylation in preparation of a product for diagnosing bladder cancer.
Background
Bladder cancer is the ninth most common malignant tumor worldwide, and is also the most common genitourinary system malignant tumor for men and women, and the incidence rate of men is more than 4 times higher than that of women. Bladder cancer includes muscle-invasive and non-muscle-invasive cancers. Almost 80% of bladder cancers manifest as non-muscle invasive diseases. Of these, 60% of bladder cancers are confined to the bladder mucosa, 30% invade the submucosa, and 10% are carcinoma in situ. The 5-year survival rate of bladder cancer is related to the stage of disease at diagnosis, with 5-year survival rates of carcinoma in situ as high as 95.8%, and 5-year survival rates of metastatic bladder cancer as low as 4.6%. Therefore, accurate and timely diagnosis is crucial for the prognosis of patients with bladder cancer.
Currently, cystoscopy and urine cast-off cytology are two main methods for diagnosing bladder cancer, but the sensitivity of urine cast-off cytology examination is relatively low, and cystoscopy is the gold standard for bladder cancer diagnosis. Although the sensitivity of cystoscopy is higher than other current methods, cystoscopy is an invasive procedure, the patient has to suffer, and cystoscopy is affected by urethral stricture, which may cause urethral perforation, bleeding or infection.
Some non-invasive diagnostic methods, such as detecting protein markers nuclear matrix protein 22(NMP-22) and Bladder Tumor Antigen (BTA) in urine, have been developed recently to diagnose bladder cancer, but the specificity is not high.
Disclosure of Invention
The research of the application shows that the HCG9 gene is used as a biomarker of bladder cancer, and the defect of low specificity of the traditional detection product to the bladder cancer can be improved by detecting the methylation level of the HCG9 gene to diagnose the bladder cancer.
Based on the above, there is a need for an application of a reagent for detecting methylation of HCG9 gene in preparation of a product for diagnosing bladder cancer. In addition, a detection kit with high specificity for diagnosing bladder cancer is also provided.
In one embodiment, the reagent is capable of detecting chr6: (ii) methylation levels in all or part of regions 29975312-29975949;
in one embodiment, the reagent is capable of detecting the methylation level of all or a portion of at least one of the following regions:
chr6: 29975312-29975466, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
A detection kit for bladder cancer, comprising reagents for detecting the methylation level of HCG9 gene.
In one embodiment, the reagent is used for detecting chr6: (ii) methylation levels in all or part of regions 29975312-29975949;
in one embodiment, the reagent is capable of detecting the methylation level of all or a portion of at least one of the following regions:
chr6: 29975312-29975466 plus strand, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
In one embodiment, the kit detects the methylation level of the HCG9 gene by at least one of the following methods: methylation-specific PCR, fluorescent quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution solubility curves, and methylation-sensitive restriction endonuclease.
In one embodiment, the reagents comprise a primer pair;
in one embodiment, the reagent further comprises a detection probe corresponding to the primer pair.
In one embodiment, the primer pair comprises at least one of the following primer pairs:
for detecting Chr6: 29975312-29975466, and a first primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975464-29975645, and a second primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975602-29975770, and a third primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975776-29975919, and a fourth primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975720-29975949, and a fifth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975434-29975778, and a sixth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975313-29975456, and a seventh primer set for the methylation level of the minus strand of the full-length or partial region.
In one embodiment, the nucleotide sequence of the first primer pair is as set forth in SEQ ID NO: 1-2 or as shown in SEQ ID NO: 15-16;
and/or the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 3-4 or as shown in SEQ ID NO: 18-19;
and/or, the nucleotide sequence of the third primer pair is shown as SEQ ID NO: 5-6 or as shown in SEQ ID NO: 21 to 22;
and/or, the nucleotide sequence of the fourth primer pair is shown as SEQ ID NO: 7-8;
and/or the nucleotide sequence of the fifth primer pair is shown as SEQ ID NO: 9-10 or as shown in SEQ ID NO: 24-25;
and/or, the nucleotide sequence of the sixth primer pair is shown as SEQ ID NO: 11-12 or as shown in SEQ ID NO: 27 to 28;
and/or, the nucleotide sequence of the seventh primer pair is shown as SEQ ID NO: 13-14 or as shown in SEQ ID NO: 30 to 31.
In one embodiment, the reagent further comprises a detection probe corresponding to the primer pair, wherein:
and the sequence is shown as SEQ ID NO: 15-16, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 17 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 18-19, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 20 is shown in the figure; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 21-22, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 23 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: the nucleotide sequence of the detection probe corresponding to the primer pair shown in 24-25 is shown as SEQ ID NO: 26 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 27-28, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 29 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 30-31, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 32.
In one embodiment, the kit further comprises at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control reagent, a PCR reaction reagent, and a sequencing reagent.
Detailed Description
In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Interpretation of terms
The term "and/or" includes any and all combinations of one or more of the associated listed items.
The term "bladder cancer" refers to a cancer occurring on the mucous membrane of the bladder, and is classified into urothelial (transitional) cell carcinoma, squamous cell carcinoma, glandular cell carcinoma, and some rare small cell carcinoma, mixed type, carcinosarcoma, or metastatic carcinoma, etc. according to its tissue type, wherein urothelial cancer accounts for more than 90% of the bladder cancer.
The term "diagnosis" includes the aspects of auxiliary diagnosis, evaluation of risk of recurrence, evaluation of risk and degree of canceration, prognosis, etc.
The term "gene" refers to a segment of DNA encoding a polypeptide chain of amino acids, which includes sequences located in coding and non-coding regions, including exon and intron sequences, involved in the regulation of gene transcription/translation and transcription/translation.
The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.
The term "methylation" is a form of chemical modification of DNA that alters the genetic appearance without altering the DNA sequence. DNA methylation refers to the covalent attachment of a methyl group at the cytosine position 5 of a genomic CpG dinucleotide, under the influence of DNA methyltransferase. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.
The term "methylation level" refers to whether or not a cytosine in one or more CpG dinucleotides in a DNA sequence is methylated or the frequency/ratio/percentage of methylation, and represents both qualitative and quantitative concepts. In practical application, different detection indexes can be adopted to compare DNA methylation levels according to actual conditions. For example, in some cases, comparisons can be made based on Ct values detected for the samples; in some cases, the proportion of gene methylation in the sample, i.e., the number of methylated molecules/(the number of methylated molecules + the number of unmethylated molecules) × 100, may be calculated and then compared; in some cases, statistical analysis and integration of each index are also required to obtain a final judgment index.
The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a target gene or a region thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer depends on many factors, including temperature, source of primer, and method used, among others. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25 or more nucleotides, but may contain fewer nucleotides, depending on the complexity of the target sequence.
The term "primer pair" refers to a pair of primers that can hybridize to a double strand of a target DNA molecule or to regions of the target DNA molecule flanking a nucleotide sequence to be amplified.
The term "Taqman probe" refers to a stretch of oligonucleotide sequence comprising a 5 'fluorescent group and a 3' quencher group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quencher in the vicinity of the fluorophore. During amplification, if the probe binds to the amplified strand, the 5 'to 3' exonuclease activity of the DNA polymerase (e.g., Taq enzyme) digests the probe and the fluorescent group is away from the quencher and its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescent signal also has a synchronous exponential growth process as the target fragment every PCR cycle.
The term "sanger sequencing" is a one-generation sequencing whose reaction system comprises: target fragment, four kinds of deoxyribonucleotides (dNTPs), DNA polymerase, primer, etc., and 4 kinds of dideoxyribonucleotides (ddNTPs) labeled with different fluorophores. Because the ddNTP lacks 3' -OH group required for extension, the extended oligonucleotide is selectively terminated at G, A, T or C, four light wavelength signals are converted into electric signals which can be identified by a computer through light excitation, and the target DNA sequence is judged according to the fluorescent signal of the finally doped ddNTP in the reaction tube.
The research of the application shows that the HCG9 gene can be used as a biomarker for diagnosing the bladder cancer, the bladder cancer can be diagnosed by detecting the methylation level of the HCG9 gene, the specificity is high, and the detection rate of early bladder cancer can be effectively improved. In addition, abnormal methylation of cancer-associated genes usually occurs in early stages of cancer and is relatively stable. Therefore, the bladder cancer diagnosis by detecting the methylation level of the HCG9 gene has good stability and high accuracy, and is easy to diagnose at an early stage. In addition, the product for diagnosing bladder cancer, which is prepared by using the HCG9 gene as a biomarker, has low dependence on the technical level of doctors, no wound and good application prospect.
Based on the above, one embodiment of the present application provides an application of a reagent for detecting methylation of HCG9 gene in preparation of a product for diagnosing bladder cancer.
Specifically, the HCG9 Gene is located on human chromosome 6, and in the NCBI database, the Gene ID of the HCG9 Gene: 10255.
in some embodiments, the target region for detecting the methylation level of HCG9 gene (referred to as "target region") with reference to grch38.p13 is: chr6: 29975312-29975949, in whole or in part.
Optionally, the target region is a full or partial region Chr6 of at least one of: 29975312-29975466, Chr6: 29975464-29975604, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975778-29975949, Chr6: 29975434-29975778, Chr6: 29975313-29975456, Chr6: 29975318-29975431, Chr6: 29975491-29975645, Chr6: 29975633-29975765, Chr6: 29975720-29975823, Chr6: 29975618-29975706 and Chr6: 29975318-29975448.
Further, the target region is a full length or partial region of at least one of the following regions: chr6: 29975312-29975466, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
In one embodiment, the target region is a full length or partial region of at least one of: chr6: 29975312-29975466 region, Chr6: 29975464-29975604 region, Chr6: 29975602-29975770 region, Chr6: 29975776-29975919 region, Chr6: negative strand in region 29975778-29975949, Chr6: negative strand in region 29975434-29975778, Chr6: negative strand in region 29975313-29975456, Chr6: 29975318-29975431 region, Chr6: positive strand in 29975491-29975645 region, positive strand in Chr6: 29975633-29975765 region, Chr6: 29975720-29975823 region, Chr6: 29975618-29975706 region and Chr6: 29975318-29975448.
Further, the target region is Chr6: 29975618-29975765, in whole or in part. Still further, the target region is Chr6: 29975618-29975706, in whole or in part.
It is understood that the DNA on the chromosome is a double-stranded structure composed of a plus strand and a minus strand. In this context, a region, if it is not specified as a positive strand or a negative strand of DNA, means either a positive strand or a negative strand of DNA of the region or both of the positive and negative strands of DNA of the region. For example, if the region Chr6: 29975618-29975706 are described as "Chr 6: 29975618-29975706 ", it may be Chr6: the positive strand of DNA in the region 29975618-29975706 may be any of Chr6: 29975618-29975706, and Chr6: 29975618-29975706 in the region of DNA positive and negative two strands. If the region Chr6: 29975618-29975706 are described as "Chr 6: the positive strand "or" Chr6 in the region 29975618-29975706: 29975618-29975706 ", Chr6: a positive strand of DNA in the region 29975618-29975706; if the region Chr6: 29975618-29975706 are described as "Chr 6: the negative strand "or" Chr6 in the region 29975618-29975706: 29975618-29975706, Chr6:29975618 to 29975706 in the negative strand of DNA. In addition, "Chr 6: 29975706-29975618' also denotes Chr6:29975618 to 29975706 region.
Based on the above, one embodiment of the present application further provides a bladder cancer detection kit, which comprises a reagent for detecting the methylation level of the HCG9 gene.
Further, with reference to grch38.p13, the reagent for detecting the methylation level of HCG9 gene was able to detect chr6: the methylation level of the whole or partial region of regions 29975312-29975949.
Alternatively, the reagent for detecting the methylation level of the HCG9 gene can detect the methylation level of the full length or partial region of at least one of the following regions:
chr6: 29975312-29975466, Chr6: 29975464-29975604, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975778-29975949, Chr6: 29975434-29975778, Chr6: 29975313-29975456, Chr6: 29975318-29975431, Chr6: 29975491-29975645, Chr6: 29975633-29975765, Chr6: 29975720-29975823, Chr6: 29975618-29975706 and Chr6: 29975318-29975448.
Further, the reagent for detecting the methylation level of the HCG9 gene can detect the methylation level of the full length or partial region of at least one of the following regions: chr6: 29975312-29975466, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
In one embodiment, the reagent for detecting the methylation level of the HCG9 gene is capable of detecting the methylation level of at least one of: chr6: 29975312-29975466 region, Chr6: 29975464-29975604 region, Chr6: 29975602-29975770 region, Chr6: 29975776-29975919 region, Chr6: negative strand in region 29975778-29975949, Chr6: negative strand in region 29975434-29975778, Chr6: negative strand in region 29975313-29975456, Chr6: 29975318-29975431 region, Chr6: positive strand in 29975491-29975645 region, positive strand in Chr6: 29975633-29975765 region, Chr6: negative strand in region 29975720-29975823, Chr6: 29975618-29975706 region and Chr6: 29975318-29975448.
Further, the reagent for detecting the methylation level of HCG9 gene was able to detect Chr6: 29975618-29975765 full length or partial region methylation level. Further, the reagent for detecting the methylation level of HCG9 gene was able to detect Chr6: 29975618-29975706 full length or partial region methylation level.
In some embodiments, the reagents for detecting the methylation level of the HCG9 gene comprise a primer pair. Specifically, the primer pair includes at least one of the following primer pairs: for detecting Chr6: 29975312-29975466, and a first primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975464-29975645, and a second primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975602-29975770, and a third primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975776-29975919, and a fourth primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975720-29975949, and a fifth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975434-29975778, and a sixth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975313-29975456, and a seventh primer set for the methylation level of the minus strand of the full-length or partial region.
In some embodiments, the kit described above employs sanger sequencing to determine the methylation level of the HCG9 gene. Specifically, the reagent for detecting the methylation level of the HCG9 gene of the kit comprises a primer pair. Further, the primer pair includes at least one of the following primer pairs:
for detecting Chr6: 29975312-29975466, and the nucleotide sequence of the first primer pair is shown as SEQ ID NO: 1-2; for detecting Chr6: 29975464-29975604, and the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 3-4; for detecting Chr6: 29975602-29975770, and the nucleotide sequence of the third primer pair is shown as SEQ ID NO: 5-6; for detecting Chr6: 29975776-29975919, and the nucleotide sequence of the fourth primer pair is shown as SEQ ID NO: 7-8; for detecting Chr6: 29975778-29975949, wherein the nucleotide sequence of the fifth primer pair is shown as SEQ ID NO: 9-10; for detecting Chr6: 29975434-29975778, wherein the nucleotide sequence of the sixth primer pair is shown as SEQ ID NO: 11-12; for detecting Chr6: 29975313-29975456, wherein the nucleotide sequence of the seventh primer pair is shown as SEQ ID NO: 13 to 14.
In other embodiments, the kit described above uses fluorescent quantitative PCR to determine the methylation level of the HCG9 gene. Specifically, the reagent for detecting the methylation level of the HCG9 gene of the kit comprises a primer pair and a detection probe corresponding to the primer pair, wherein the detection probe is connected with a fluorescent group.
Further, the primer pair includes at least one of the following primer pairs:
for detecting Chr6: 29975318-29975431, and the nucleotide sequence of the first primer pair is shown as SEQ ID NO: 15-16; for detecting Chr6: 29975491-29975645, and the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 18-19; for detecting Chr6: 29975633-29975765, and the nucleotide sequence of the third primer pair is shown as SEQ ID NO: 21 to 22; for detecting Chr6: 29975720-29975823, wherein the nucleotide sequence of the fifth primer pair is shown as SEQ ID NO: 24-25; for detecting Chr6: 29975618-29975706, wherein the nucleotide sequence of the sixth primer pair is shown as SEQ ID NO: 27 to 28; for detecting Chr6: 29975318-29975448, wherein the nucleotide sequence of the seventh primer pair is shown as SEQ ID NO: 30 to 31.
Further, the sequence shown in SEQ ID NO: 15-16, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 17 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 18-19, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 20 is shown in the figure; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 21-22, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 23 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: the nucleotide sequence of the detection probe corresponding to the primer pair shown in 24-25 is shown as SEQ ID NO: 26 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 27-28, and the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 29 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 30-31, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 32.
In some embodiments, the kit for determining the methylation level of the HCG9 gene by the fluorescent quantitative PCR method further comprises an internal reference primer pair and an internal reference probe corresponding to the internal reference primer pair. Optionally, the reference primer pair comprises an ACTB primer pair designed for the ACTB gene. In an alternative specific example, the nucleotide sequence of the ACTB primer pair is as set forth in SEQ ID NO: 33-34, and the nucleotide sequence of the internal reference probe corresponding to the ACTB primer pair is shown as SEQ ID NO: shown at 35. It is understood that, in other embodiments, other genes can be selected as the reference gene, and in this case, the reference primer pair and the reference probe are designed correspondingly.
In an alternative specific example, the detection probe and the internal reference probe are Taqman probes. Furthermore, the detection probe and the internal reference probe are both connected with a fluorescent group and a quenching group. Alternatively, the fluorescent group is located at the 5 'end of the probe and the quencher group is located at the 3' end of the probe. Optionally, the detection probe and the internal reference probe are respectively and independently connected with one of FAM, HEX, VIC, CY5, ROX, Texsa Red, JOE and Quasar 705, wherein the fluorescent groups are respectively and independently connected with the internal reference probe and the detection probe. Of course, when two or more probes are present in the same reaction system, the fluorescent groups attached to the different probes are different. It is understood that the fluorescent group attached to the detection probe and the reference probe is not limited to the above, and may be other fluorescent groups.
In some embodiments, the kit of any of the above embodiments further comprises at least one of nucleic acid extraction reagents, methylation conversion reagents, quality control reagents, PCR reaction reagents, and sequencing reagents. The nucleic acid extraction reagent is used for extracting nucleic acid; the methylation conversion reagent is used for converting cytosine without methylation in DNA into uracil by deamination, and methylated cytosine is kept unchanged; the quality control reagent is used for quality control; the PCR reaction reagent is used for constructing a PCR amplification reaction system; nucleic acid sequencing reagents were used for sequencing.
In one embodiment, the methylation conversion reagent is a sulfite conversion reagent or an enzymatic conversion reagent.
In one embodiment, the PCR reaction reagent comprises PCR buffer, dNTP, MgCl 2 And a DNA polymerase.
In one embodiment, the quality control reagent comprises a positive reference substance and a negative reference substance.
It is understood that, in other embodiments, the method of detecting the methylation level of the HCG9 gene by the above-described bladder cancer detection kit is not limited to the fluorometric method and the sanger sequencing method, but may be other methods such as the bisulfite sequencing method, the methylation-specific PCR, the methylation-specific microarray method, the whole genome methylation sequencing method, the pyrosequencing method, the methylation-specific high performance liquid chromatography, the digital PCR method, the methylation-specific high resolution melting curve method, or the methylation-sensitive restriction endonuclease method.
In some embodiments, the above-mentioned bladder cancer detection kit is suitable for samples including, but not limited to, urine and tissue samples.
Proved by verification, the detection sensitivity of the detection kit for the bladder cancer can reach 90.63 percent, the specificity can reach 94.87 percent, and the early diagnosis of the bladder cancer is facilitated.
DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION
The following detailed description is given with reference to specific examples. The following examples are not specifically described, and other components except inevitable impurities are not included. Reagents and instruments used in the examples are all conventional in the art and are not specifically described. The experimental procedures, in which specific conditions are not indicated in the examples, were carried out according to conventional conditions, such as those described in the literature, in books, or as recommended by the manufacturer.
Example 1
Detection of methylation state of HCG9 gene region chr6: 29975312-29975949 based on sanger sequencing and sensitivity specificity evaluation of method
1. Sample collection
Urine samples of 64 bladder cancer patients diagnosed by pathological examination and 78 healthy people subjected to routine physical examination are collected in Wuhan hospital, and the volume of each urine sample is more than 50 mL. All samples were collected under examination and approval by the ethics committee, all volunteers signed informed consent, and all samples were processed anonymously.
2. Extraction of DNA from urine
The urine sample DNA was extracted using nucleic acid extraction kit (Ehan instruments 20210740) from Wuhan Amisen Life technologies, Inc., the specific steps are as follows.
1) Cleavage binding
A clean 5mL centrifuge tube was prepared and 100. mu.L proteinase K was added to it. And uniformly mixing the urine, subpackaging 2mL into a tube added with proteinase K, sequentially adding 2mL of lysis binding solution and 20 mu L of magnetic beads, turning upside down, uniformly mixing, placing on a four-side mixing instrument, and cracking at room temperature for 30min to keep the magnetic beads in a suspended state.
2) Washing machine
Placing the centrifuge tube on a magnetic frame, absorbing magnetism for 2min, and reversing the washing tube cover for several times until all the magnetic absorption is finished after the solution is clarified. Carefully absorbing waste liquid, adding 2mL of washing liquid, uniformly mixing for more than 10 times by vortex to completely disperse magnetic beads, absorbing magnetism for 2min, and after the solution is clarified, reversing the washing tube for several times to cover the residual magnetic beads until all the magnetic absorption is finished.
3) Rinsing
Carefully absorbing waste liquid, firstly adding 500 mu L of rinsing liquid to wash the magnetic beads to the bottom, then transferring the magnetic bead suspension into a new 2mL centrifuge tube, then adding 500 mu L of rinsing liquid to completely wash the residual magnetic beads on the tube wall of the 5mL centrifuge tube to the bottom, transferring all the magnetic bead suspension into the 2mL centrifuge tube after instantaneous centrifugation, performing vortex mixing for more than 10 times to completely disperse the magnetic beads, absorbing magnetism for 2min, and after the solution is clarified, reversing the residual magnetic beads on the cover of the washing tube for several times until all the magnetic beads are absorbed completely. The rinsing was repeated once.
4) Elution is carried out
And taking off the centrifugal tube, centrifuging for a short time, collecting residual liquid, placing the centrifugal tube on a magnetic frame, and sucking the residual liquid by using a small gun head after the magnetic suction is finished. The centrifuge tube was left uncovered for 5min to make the surface of the beads matte. Adding 50 μ L of TE eluent, gently shaking to disperse the magnetic beads, eluting at 56 deg.C for 10min, taking out every 3min, and gently shaking to keep the magnetic beads in suspension.
5) Collecting
Taking out the centrifuge tube, centrifugally collecting liquid on the tube cover and the tube wall, placing the centrifuge tube on a magnetic frame for magnetic absorption for 1min, and carefully absorbing supernatant to obtain the DNA solution.
3. Urine DNA conversion
Adding 40 mu L of the DNA solution obtained in the step 2 into a 200 mu L PCR tube, adding 110 mu L of the transformation mixed solution, uniformly mixing, and then setting a program in a PCR instrument: 10min at 95 ℃, 90min at 64 ℃ and 1h at 4-8 ℃.
4. Urine DNA purification
1) Transferring the transformation product obtained in the step 3 into a 2mL centrifuge tube, adding 600 mu L of binding solution and 10 mu L of magnetic beads, uniformly mixing, standing and binding for 15min, and shaking and uniformly mixing for 5s every 3min to keep the magnetic beads in a suspension state; the tube was briefly centrifuged and placed on a magnetic rack and after the beads were fully adsorbed (about 1min), the supernatant was carefully removed.
2) Adding 600 mu L of rinsing liquid, and uniformly mixing by vortex for 20s to disperse magnetic beads; briefly, centrifuge the tube on a magnetic rack and carefully remove the supernatant after the beads have been fully adsorbed (about 1 min).
3) Adding 800 mu L of desulfurizer, uniformly mixing by vortex for 20s, dispersing magnetic beads, standing for 15min at room temperature for desulfurization, and uniformly mixing by shaking for 5s every 5min to keep the magnetic beads in a suspension state.
4) Adding 800 mu L of rinsing liquid, and uniformly mixing by vortex for 20s to disperse magnetic beads; briefly, centrifuge the tube on a magnetic rack and carefully remove the supernatant after the beads have been fully adsorbed (about 1 min).
5) Repeating the step 4) once.
6) Collecting the liquid to the bottom of the tube by short-time centrifugation, placing the centrifugal tube on a magnetic frame, and carefully sucking up the supernatant; and opening the cover and placing the mixture at room temperature for about 5min until the surfaces of the magnetic beads are matt.
7) Adding 20-50 mu L of eluent TE, vortexing to enable the magnetic beads to be fully suspended in the eluent, incubating for 10min at 56 ℃, and vortexing and uniformly mixing every 3min to promote the nucleic acid to be fully eluted.
8) Collecting: and (4) performing short-time centrifugation, placing the centrifuge tube on a magnetic frame, standing for 2min, and transferring the DNA solution to a new centrifuge tube.
PCR amplification and sequencing
Using the DNA of the urine sample obtained in step 4 as a template, degenerate primer pairs shown in Table 1 were used as primers (to amplify both methylated and unmethylated DNA fragments), PCR reaction systems were prepared according to Table 2, and PCR amplification was performed according to the amplification procedure shown in Table 3 to obtain each gene region of HCG 9. After the PCR amplification is finished, the amplification product is subjected to Sanger sequencing by respectively using the degenerate primers in the table 1 as sequencing primers, and sequencing is carried out by a sequencing company from the 5 'end and the 3' end at the same time.
TABLE 1 sequencing primers for regions 1-7 of the HCG9 Gene
Specific information of regions 1 to 7 of the HCG9 gene in Table 1 is as follows:
HCG9 gene region 1 positive strand (Chr6: 29975312-29975466) DNA sequence:
GGCCCGCCCTGGAGCTGAGAACACGCGGACTCCAGGGAGAGGACAGGGCTTCAGGGACCCGAGAGCCGCTCTGAGCACCGGGGGATGTGACTGCCTCAGCGGCAGAGCTGGAAGGGCCCTCGAATGCCATTCACAGGAACAGCCCAGGAACCCAG。
HCG9 gene region 2 positive strand (Chr6: 29975464-29975604) DNA sequence:
CAGGGACTTCAGAAGGGCTGGTTTGTCCGAAAAGTGAGAGGAGGCGGAGGAGAGGTGAGGAGAGCAAGTGCAAGAAGAGACCAGAAAGTGCAGGGGGTGGGGGTGATGCGCGATCCCGAGGAGGACTGAAAAGAGACTGAA。
HCG9 gene region 3 positive strand (Chr6: 29975602-29975770) DNA sequence:
GAAAAGCAGGGCTGAGGAGTGGCGGCAACCGGCAGCGTCCAGCTCCCGCACCTCGCTGCACATCGCACCTGAGCCCCGCCGCGACCGCATCGCGCTCGCTGCGACCCATTCAGACCCCCCAGAAACGCCAAGCCGCTCCCGCTCTAGCCGAGGGCTAGAACAATCCTGC。
HCG9 gene region 4 positive strand (Chr6: 29975776-29975919) DNA sequence:
CAGCCTCCTGAGTAGTTGGGACTACAAGCGAGTGCCACCACGTCCAGCTGTCATTTACCATCTGGTACCAACCCCCATTAGACAATGAACCATCCATGATCACGAACTGTGTCCCTTCCATCTTCGTCAGCTTTAGGAGCATTT。
HCG9 gene region 5 minus strand (Chr6: 29975949-29975778) DNA sequence:
TAATCATAGGTGGAGTTCCATTGGGAAAAAAAATGCTCCTAAAGCTGACGAAGATGGAAGGGACACAGTTCGTGATCATGGATGGTTCATTGTCTAATGGGGGTTGGTACCAGATGGTAAATGACAGCTGGACGTGGTGGCACTCGCTTGTAGTCCCAACTACTCAGGAGGC。
HCG9 gene region 6 minus strand (Chr6: 29975778-29975434) DNA sequence:
CTGAGGTGGCAGGATTGTTCTAGCCCTCGGCTAGAGCGGGAGCGGCTTGGCGTTTCTGGGGGGTCTGAATGGGTCGCAGCGAGCGCGATGCGGTCGCGGCGGGGCTCAGGTGCGATGTGCAGCGAGGTGCGGGAGCTGGACGCTGCCGGTTGCCGCCACTCCTCAGCCCTGCTTTTCAGTCTCTTTTCAGTCCTCCTCGGGATCGCGCATCACCCCCACCCCCTGCACTTTCTGGTCTCTTCTTGCACTTGCTCTCCTCACCTCTCCTCCGCCTCCTCTCACTTTTCGGACAAACCAGCCCTTCTGAAGTCCCTGGGTTCCTGGGCTGTTCCTGTGAATGGCATT。
HCG9 gene region 7 minus strand (Chr6: 29975456-29975313) DNA sequence:
GGGCTGTTCCTGTGAATGGCATTCGAGGGCCCTTCCAGCTCTGCCGCTGAGGCAGTCACATCCCCCGGTGCTCAGAGCGGCTCTCGGGTCCCTGAAGCCCTGTCCTCTCCCTGGAGTCCGCGTGTTCTCAGCTCCAGGGCGGGC。
TABLE 2PCR reaction System
| Components | Dosage (mu L) |
| 10×Taq buffer(Mg 2+ Free) | 5 |
| 25mM Mg 2+ | 4 |
| dNTP Mix(10mM each) | 1 |
| Upstream primer (10. mu.M) | 1 |
| Downstream primer (10. mu.M) | 1 |
| Hot Start (Hot Start) Taq DNA polymerase | 0.5 |
| Template DNA | 10 |
| Ultrapure water | Supplement to 50 |
TABLE 3PCR amplification procedure
6. Analysis of results
For sequences that were sequenced successfully, the methylation of the differential CpG sites in each amplicon of each sample was analyzed according to the sequencing peak maps. Methylation of cytosine in a CpG dinucleotide is classified into two types, non-methylation and methylation, wherein methylation is further classified into complete methylation and partial methylation. If the sequencing result of cytosine in CpG dinucleotide is thymine, it is unmethylated. If the cytosine sequencing result in the CpG dinucleotide is still cytosine, it is completely methylated. A CpG dinucleotide is partially methylated if it is sequenced to have both cytosine and thymine (doublet).
A sample is considered methylation positive in the region of the gene if cytosines in more than 95% of CpG dinucleotides in an amplicon are methylated. The number of methylation positives and the number of methylation negatives in each type of sample were calculated, and the ratio of methylation positives to methylation negatives was calculated. The sensitivity is the proportion of methylation positives in samples with positive pathological results. Specificity is the proportion of methylation negatives in samples with negative pathological results. Methylation status, sensitivity and specificity of HCG9 gene regions 1-7 in urine samples of 64 bladder cancer patients and 78 healthy persons are shown in Table 4.
TABLE 4 sensitivity and specificity of HCG9 gene regions 1-7 in urine samples
As can be seen from Table 4, the effect of detecting urine samples in HCG9 gene regions 1-7 is different. Specifically, the sensitivity of detecting the urine sample of the bladder cancer patient in the area 3 and the area 6 is higher than 70 percent, and the specificity of detecting the urine sample of a healthy person is higher than 88 percent; the sensitivity and specificity for detecting cancer samples and healthy samples are not high in the other regions than regions 3 and 6. In conclusion, the method based on Sanger sequencing has higher sensitivity and specificity for detecting the urine sample by using the methylation level of the Chr6: 29975434-29975778 negative strand of the HCG9 gene region.
Example 2
Methylation state of HCG9 gene Chr6: 29975318-29975823 detected based on methylation fluorescent quantitative PCR and sensitivity specificity evaluation (paraffin tissue sample) of the method
After the DNA of the urine sample is extracted in example 1, the methylation state of the full-length or partial region of the Chr6: 29975312-29975949 of the HCG9 gene region is detected by a bisulfite conversion and Sanger sequencing method, and in order to improve the value of the kit in clinical application in consideration of tedious operation, time and labor waste and severe dependence on sequencing companies, the method for detecting the methylation state of each region of the HCG9 gene based on methylation fluorescent quantitative PCR is provided in this embodiment, and the methylation state of the sample can be judged according to the Ct value, so as to judge whether the sample is a cancer sample.
1. Sample collection
64 cancer tissue samples of bladder cancer patients confirmed to be detected by pathological examination and 64 corresponding para-cancer tissue samples are collected in Wuhan hospital, and all the samples are formalin-soaked paraffin-embedded tissue samples. All samples were collected under examination and approval by the ethics committee, all volunteers signed informed consent, and all samples were processed anonymously.
2. Extraction of DNA from paraffin tissue
Tissue DNA was extracted using the QIAamp DNA FFPE Tissue Kit (56404), and the detailed procedures were performed according to the Kit instructions.
3. Conversion of bisulfite
And (3) carrying out bisulfite conversion and purification on the sample genome extracted in the step (2), wherein the nucleic acid conversion kit is a nucleic acid conversion reagent (20200843, Wayama instruments) of Wuhan Amison Life technologies, Ltd.), and the specific experimental operation is shown in the kit specification.
4. Methylation quantitative PCR reaction
Taking the sample DNA obtained after bisulfite conversion in step 3 as a template, respectively using the primers and probes in Table 5, configuring a reaction system according to the formula in Table 6, and performing methylation quantitative PCR reaction by using hot-start DNA polymerase, wherein the PCR reaction conditions are shown in Table 7. Each PCR reaction can detect the methylation level of a region of the HCG9 gene in a certain sample, namely, a reaction tube is added with necessary reaction components and templates, and is also added with a detection primer and a probe corresponding to a target gene region, and is also added with a detection primer and a probe of an internal reference gene ACTB. The probe of the detection target region is a Taqman probe, the reporter group at the 5 'end is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the ACTB probe is VIC, and the quenching group at the 3' end is BHQ 1.
TABLE 5 detection primer and probe sequences of HCG9 gene region 8-13
In Table 5 and below, the HCG9 gene regions 8-13 are specifically as follows:
the plus strand base sequence of region 8 is as follows (5 'to 3'):
CCCTGGAGCTGAGAACACGCGGACTCCAGGGAGAGGACAGGGCTTCAGGGACCCGAGAGCCGCTCTGAGCACCGGGGGATGTGACTGCCTCAGCGGCAGAGCTGGAAGGGCCCT is added. The combination of primers and probes of region 8 can detect methylation of cytosines at positions Chr6:29975335, Chr6:29975337, Chr6:29975371, Chr6:29975378, Chr6:29975390 and Chr6:29975411 of the positive strand of region 8.
The plus strand base sequence of region 9 is as follows (5 'to 3'):
CGAAAAGTGAGAGGAGGCGGAGGAGAGGTGAGGAGAGCAAGTGCAAGAAGAGACCAGAAAGTGCAGGGGGTGGGGGTGATGCGCGATCCCGAGGAGGACTGAAAAGAGACTGAAAAGCAGGGCTGAGGAGTGGCGGCAACCGGCAGCGTCCAGCT are provided. The combination of primers and probes in region 9 can detect methylation of cytosine at positions Chr6:29975491, Chr6:29975508, Chr6:29975572, Chr6:29975574, Chr6:29975580, Chr6:29975624, Chr6:29975631 and Chr6:29975637 of region 9.
The plus strand base sequence of the region 10 is as follows (5 'to 3'):
GCAGCGTCCAGCTCCCGCACCTCGCTGCACATCGCACCTGAGCCCCGCCGCGACCGCATCGCGCTCGCTGCGACCCATTCAGACCCCCCAGAAACGCCAAGCCGCTCCCGCTCTAGCCGAGGGCTAGAACAAT are provided. The combination of primers and probes in region 10 can detect methylation of cytosines at the positive strand Chr6:29975637, Chr6:29975648, Chr6:29975655, Chr6:29975678, Chr6:29975681, Chr6:29975683, Chr6:29975687, Chr6:29975692, Chr6:29975741 and Chr6:29975750 of the region 10.
The minus-strand base sequence of the region 11 is as follows (5 'to 3'):
GCTGGACGTGGTGGCACTCGCTTGTAGTCCCAACTACTCAGGAGGCTGAGGTGGCAGGATTGTTCTAGCCCTCGGCTAGAGCGGGAGCGGCTTGGCGTTTCTGG are provided. The combination of primers and probes in region 11 can detect methylation of cytosines at positions Chr6:29975817, Chr6:29975805, Chr6:29975751, Chr6:29975742, Chr6:29975736 and Chr6:29975728 in the minus strand of region 11.
The minus-strand base sequence of the region 12 is as follows (5 'to 3'):
GTCGCAGCGAGCGCGATGCGGTCGCGGCGGGGCTCAGGTGCGATGTGCAGCGAGGTGCGGGAGCTGGACGCTGCCGGTTGCCGCCACTC are provided. The combination of primers and probes in region 12 can detect methylation of cytosines at positions Chr6:29975704, Chr6:29975699, Chr6:29975695, Chr6:29975693, Chr6:29975688, Chr6:29975684, Chr6:29975682, Chr6:29975679, Chr6:29975638, Chr6:29975632, and Chr6:29975625 in region 12.
The minus-strand base sequence of the region 13 is as follows (5 'to 3'):
CCTGTGAATGGCATTCGAGGGCCCTTCCAGCTCTGCCGCTGAGGCAGTCACATCCCCCGGTGCTCAGAGCGGCTCTCGGGTCCCTGAAGCCCTGTCCTCTCCCTGGAGTCCGCGTGTTCTCAGCTCCAGGG are provided. The combination of primers and probes in region 13 can detect methylation of cytosines at positions Chr6:29975433, Chr6:29975391, Chr6:29975379, Chr6:29975372, Chr6:29975338 and Chr6:29975336 in the minus strand of region 13.
TABLE 6PCR reaction System
| Components | Specification of | Volume (μ L) |
| Platinum II PCR buffer | 5× | 5 |
| dNTPs | 2.5mM each | 3 |
| Target gene region upstream primer | 10μM | 0.5 |
| Target gene region downstream primer | 10μM | 0.5 |
| Target gene region probe | 10μM | 0.5 |
| ACTB upstream primer | 10μM | 0.5 |
| ACTB downstream primer | 10μM | 0.5 |
| ACTB probes | 10μM | 0.5 |
| Taq enzyme | / | 0.5 |
| DNA of sample to be tested | / | 5 |
| Purified water | / | Supply to 25 |
TABLE 7PCR amplification procedure
In addition, negative and positive controls: when different regions of the target gene are detected respectively, the negative control and the positive control are synchronously detected. The negative control was purified water. The preparation method of the positive control comprises the following steps: and (3) artificially synthesizing a sequence which is completely converted by the bisulfite and corresponds to the amplified region of the ACTB, and cloning the sequence onto a vector to form an artificially synthesized plasmid. Sequences which correspond to the completely methylated HCG9 gene regions 8-13 and are converted by bisulfite are artificially synthesized and are respectively cloned to vectors to form artificially synthesized plasmids. The positive control of HCG9 gene region 8-13 is 10 3 Copy/microliter ACTB Artificial Synthesis plasmid and 10 3 Copy/microliter regions 8-13 of artificially synthesized plasmid 1:1, e.g. 10 for the positive control in zone 8 3 Copy/microliter ACTB Artificial Synthesis plasmid and 10 3 Copies/microliter of region 8 of the synthetic plasmid 1:1 were mixed.
And 5, analyzing PCR results:
1) ct value reading: and after the PCR is finished, adjusting a base line, setting a fluorescence value of the sample in the primary PCR before the minimum Ct value is advanced by 1-2 cycles as a base line value, and setting a threshold value at an inflection point of an S-shaped amplification curve to obtain the Ct value of each gene of the sample.
2) Quality control: negative control needs no amplification, positive control needs obvious exponential growth period, and the Ct value of the positive control is between 26 and 30. The Ct value of the reference gene of the sample to be detected is less than or equal to 35, and the negative control, the positive control and the reference gene all meet the requirements, which shows that the experiment is effective and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is required to be carried out again.
3) Results analysis and interpretation methods: when the Ct value of a certain detection area on the tissue sample is less than or equal to 38, the sample is considered to be methylated in the area, and the sample is positive for cancer; if the Ct value of a certain detection area on the tissue sample is greater than 38, the sample is considered to be methylation negative in the detection area, namely cancer negative. The Ct values obtained from the methylation quantitative PCR experiment were used to determine the positivity and negativity of the tissue samples, and the results are shown in Table 8.
TABLE 8 sensitivity and specificity of HCG9 Gene regions 8-13 in tissue samples
As can be seen from Table 8, the HCG9 gene regions 8-13 have different effects on detecting bladder cancer tissue samples. Wherein, the sensitivity of detecting bladder cancer tissue samples in the area 10 and the area 12 is higher than 89%, and the specificity of detecting para-carcinoma tissue samples is higher than 87%; the sensitivity and specificity for detecting cancerous and paracancerous tissue samples is not high in regions other than regions 10 and 12. Also, region 12 is slightly better than region 10 in detecting. Therefore, the sensitivity and specificity for distinguishing whether the tissue sample is cancerized or not are higher by using the methylation state of the negative strand of the HCG9 gene region 12(Chr6: 29975618-29975706).
Example 3
Methylation state of HCG9 gene Chr6: 29975318-29975823 and sensitivity specificity evaluation (urine sample) are detected based on methylation fluorescent quantitative PCR, and the method specifically comprises the following steps:
1. the steps of urine sample collection, urine DNA extraction, transformation and purification are the same as in example 1.
2. And (3) carrying out methylation fluorescent quantitative PCR reaction on the DNA converted by the bisulfite in each urine sample respectively to detect the methylation level of the HCG9 gene regions 8-13 in each sample, wherein the specific detection method is the same as that in example 2. The analysis of the PCR results was as follows: when the Ct value of a certain detection area on the urine sample is less than or equal to 45, the sample is considered to be methylated in the area, and the methylation is positive for the cancer; if the Ct value of a certain detection area on the urine sample is greater than 45, the sample is considered to be methylation negative in the detection area, namely cancer negative.
3. The positive and negative of the sample are judged according to the Ct value, and the sensitivity and specificity of the urine sample are calculated, and the results are shown in Table 9.
TABLE 9 sensitivity and specificity of HCG9 Gene regions 8-13 in urine samples
As can be seen from Table 9, the effect of detecting urine samples of patients with bladder cancer and urine samples of healthy people in HCG9 gene regions 8-13 are different. Wherein, the sensitivity of detecting bladder cancer urine samples in the area 10 and the area 12 is higher than 85 percent, and the specificity of detecting healthy human urine samples is higher than 89 percent; the sensitivity and specificity for detecting urine samples from cancer patients and urine samples from healthy persons are low in areas other than areas 10 and 12. In contrast, the detection sensitivity and specificity of HCG9 gene region 12 were higher than that of region 10. Therefore, the methylation state of the HCG9 gene region 12 (minus strand, Chr6: 29975618-29975706) can be used for evaluating whether the urine sample of the subject is positive for bladder cancer based on the methylation fluorescent quantitative PCR method, and the detection effect is better.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, which is convenient for specific and detailed understanding of the technical solutions of the present invention, but the present invention should not be construed as being limited to the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. It should be understood that the technical solutions obtained by logical analysis, reasoning or limited experiments based on the technical solutions provided by the present invention are all within the protection scope of the appended claims of the present invention. Therefore, the protection scope of the patent of the invention is subject to the content of the appended claims, and the description can be used for explaining the content of the claims.
Sequence listing
<110> Wuhan Amisen Life technologies Ltd
<120> application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer
<160> 35
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggttcgtttt ggagttgaga ata 23
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggctaaatt cctaaactat tcctata 27
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtagggattt tagaagggtt gg 22
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gttcaatctc ttttcaatcc tcc 23
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaaaagtagg gttgaggagt gg 22
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgggacaaaa ttattctaac cct 23
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gggtagtttt ttgagtagtt ggg 23
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gggggaaata ctcctaaaac taac 24
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
taattatagg tggagtttta ttggg 25
<210> 10
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggacctccta aataattaaa actacaa 27
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttgaggtggt aggattgttt tagt 24
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aataccattc acaaaaacaa ccc 23
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gggttgtttt tgtgaatggt att 23
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
acccgcccta aaactaaaaa c 21
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ttttggagtt gagaatacgc g 21
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
aaaacccttc caactctacc g 21
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tcgagagtcg ttttgagtat cgggg 25
<210> 18
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cgaaaagtga gaggaggcg 19
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
aactaaacgc taccgattac cg 22
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
ggggtgatgc gcgatttcga 20
<210> 21
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gtagcgttta gttttcgtat ttcg 24
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
attattctaa ccctcgacta aaacg 25
<210> 23
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
atttgagttt cgtcgcgatc gtatc 25
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gttggacgtg gtggtattcg 20
<210> 25
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
ccaaaaacgc caaaccg 17
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
gggttttcgg ttagagcggg ag 22
<210> 27
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
tgtcgtagcg agcgcg 16
<210> 28
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
aaataacgag aaccgacaac g 21
<210> 29
<211> 15
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
atgcggtcgc ggcgg 15
<210> 30
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
tttgtgaatg gtattcgagg g 21
<210> 31
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
ccctaaaact taaaacacgc g 21
<210> 32
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
cggtgtttag agcggttttc gg 22
<210> 33
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
aaggtggttg ggtggttgtt ttg 23
<210> 34
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
aataacaccc ccaccctgc 19
<210> 35
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
ggagtggttt ttgggtttg 19
Claims (10)
1. Application of a reagent for detecting HCG9 gene methylation in preparation of products for diagnosing bladder cancer.
2. The use according to claim 1, wherein the reagent is capable of detecting chr6: (ii) methylation levels in all or part of regions 29975312-29975949;
optionally, the reagent is capable of detecting the methylation level of all or part of at least one of:
chr6: 29975312-29975466, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919 plus strand, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
3. A bladder cancer detection kit comprising a reagent for detecting the methylation level of HCG9 gene.
4. The kit of claim 3, wherein the reagent is used to detect chr6: (ii) methylation levels in all or part of regions 29975312-29975949;
optionally, the reagent is capable of detecting the methylation level of all or part of at least one of:
chr6: 29975312-29975466, Chr6: 29975464-29975645, Chr6: 29975602-29975770, Chr6: 29975776-29975919, Chr6: 29975720-29975949 minus strand, Chr6: 29975434-29975778 and Chr6: 29975313-29975456.
5. The kit of claim 3 or 4, wherein the kit detects the methylation level of the HCG9 gene by at least one of the following methods: methylation-specific PCR, fluorescent quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve, and methylation-sensitive restriction endonuclease.
6. The kit of claim 5, wherein the reagents comprise a primer pair;
optionally, the reagent further comprises a detection probe corresponding to the primer pair.
7. The kit of claim 6, wherein the primer pair comprises at least one of the following primer pairs:
for detecting Chr6: 29975312-29975466, and a first primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975464-29975645, and a second primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975602-29975770, and a third primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975776-29975919, and a fourth primer pair for detecting the methylation level of the plus strand of the full-length or partial region in the Chr6: 29975720-29975949, and a fifth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975434-29975778, and a sixth primer pair for detecting the methylation level of the minus strand of the full-length or partial region in the Chr6: 29975313-29975456, and a seventh primer set for the methylation level of the minus strand of the full-length or partial region.
8. The kit of claim 7, wherein the nucleotide sequence of the first primer pair is as set forth in SEQ ID NO: 1-2 or as shown in SEQ ID NO: 15-16;
and/or the nucleotide sequence of the second primer pair is shown as SEQ ID NO: 3-4 or as shown in SEQ ID NO: 18-19;
and/or, the nucleotide sequence of the third primer pair is shown as SEQ ID NO: 5-6 or as shown in SEQ ID NO: 21 to 22;
and/or, the nucleotide sequence of the fourth primer pair is shown as SEQ ID NO: 7-8;
and/or the nucleotide sequence of the fifth primer pair is shown as SEQ ID NO: 9-10 or as shown in SEQ ID NO: 24-25;
and/or, the nucleotide sequence of the sixth primer pair is shown as SEQ ID NO: 11-12 or as shown in SEQ ID NO: 27 to 28;
and/or, the nucleotide sequence of the seventh primer pair is shown as SEQ ID NO: 13-14 or SEQ ID NO: 30 to 31.
9. The kit of claim 8, wherein the reagents further comprise detection probes corresponding to the primer pairs, wherein:
and the sequence is shown as SEQ ID NO: 15-16, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 17 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 18-19, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 20 is shown in the figure; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 21-22, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 23 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: the nucleotide sequence of the detection probe corresponding to the primer pair shown in 24-25 is shown as SEQ ID NO: 26 is shown; and/or, a polypeptide having the sequence set forth in SEQ ID NO: 27-28, wherein the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: 29 is shown; and/or, a polypeptide having a sequence as set forth in SEQ ID NO: 30-31, the nucleotide sequence of the detection probe corresponding to the primer pair is shown as SEQ ID NO: shown at 32.
10. The kit of claim 3, 4, 6, 7, 8 or 9, further comprising at least one of a nucleic acid extraction reagent, a methylation conversion reagent, a quality control reagent, a PCR reaction reagent, and a sequencing reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210542498.9A CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210542498.9A CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114959030A true CN114959030A (en) | 2022-08-30 |
| CN114959030B CN114959030B (en) | 2023-08-01 |
Family
ID=82984093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210542498.9A Active CN114959030B (en) | 2022-05-18 | 2022-05-18 | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114959030B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024125308A1 (en) * | 2022-12-14 | 2024-06-20 | 武汉艾米森生命科技有限公司 | Reagent for detecting methylation level of molecular marker and urothelial carcinoma detection kit |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100234242A1 (en) * | 2007-01-23 | 2010-09-16 | Arturas Petronis | DNA Methylation Changes Associated with Major Psychosis |
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| US20160244843A1 (en) * | 2007-11-30 | 2016-08-25 | Genomictree, Inc. | Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene |
| WO2018008740A1 (en) * | 2016-07-08 | 2018-01-11 | 有限会社ハヌマット | Method for judging onset possibility of large bowel cancer |
| CN110872631A (en) * | 2019-12-26 | 2020-03-10 | 广州市基准医疗有限责任公司 | DNA methylation biomarker combination, detection method and kit |
| CN113604563A (en) * | 2021-06-02 | 2021-11-05 | 武汉艾米森生命科技有限公司 | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof |
-
2022
- 2022-05-18 CN CN202210542498.9A patent/CN114959030B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100234242A1 (en) * | 2007-01-23 | 2010-09-16 | Arturas Petronis | DNA Methylation Changes Associated with Major Psychosis |
| US20160244843A1 (en) * | 2007-11-30 | 2016-08-25 | Genomictree, Inc. | Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene |
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| WO2018008740A1 (en) * | 2016-07-08 | 2018-01-11 | 有限会社ハヌマット | Method for judging onset possibility of large bowel cancer |
| CN110872631A (en) * | 2019-12-26 | 2020-03-10 | 广州市基准医疗有限责任公司 | DNA methylation biomarker combination, detection method and kit |
| CN113604563A (en) * | 2021-06-02 | 2021-11-05 | 武汉艾米森生命科技有限公司 | Nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, detection kit and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| KAMINSKY Z 等: "A multi-tissue analysis identifies HLA complex group 9 gene methylation differences in bipolar disorder" * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024125308A1 (en) * | 2022-12-14 | 2024-06-20 | 武汉艾米森生命科技有限公司 | Reagent for detecting methylation level of molecular marker and urothelial carcinoma detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114959030B (en) | 2023-08-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110578001B (en) | Detection kit for detecting methylation of cervical cancer related genes and use method thereof | |
| CN106834426B (en) | Composition for detecting pancreatic cancer and use thereof | |
| CN114891886B (en) | Nucleic acid product, kit and application for diagnosing bladder cancer | |
| CN113430272B (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
| CN113621704B (en) | Reagent and kit for detecting and diagnosing liver cancer | |
| CN111534588A (en) | Kit and method for detecting gene mutation in acute lymphocytic leukemia based on fluorescent quantitative PCR | |
| CN114959030B (en) | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer | |
| CN109837344B (en) | Methylated EphA7 nucleotide fragment, detection method and application thereof | |
| CN115094139B (en) | Application of reagent for detecting methylation level in preparation of bladder cancer diagnosis product and bladder cancer diagnosis kit | |
| CN115786502B (en) | Use of an agent for detecting the methylation level of a target region for the preparation of a diagnostic product for bladder cancer | |
| CN117344009B (en) | Kit for detecting bladder cancer | |
| CN115927610A (en) | Application of reagent for detecting methylation level of target region in FOXO6 gene in preparation of bladder cancer diagnosis product | |
| CN115948561B (en) | Reagent and detection kit for esophageal squamous carcinoma diagnosis or auxiliary diagnosis and application thereof | |
| CN115838799A (en) | Application of reagent for detecting gene methylation in preparation of product for diagnosing colorectal cancer | |
| CN116024342A (en) | Nucleic acid product for detecting cervical cancer or precancerous lesions, kit and application | |
| CN117587124A (en) | Detection reagent and kit for diagnosing pancreatic cancer and application thereof | |
| CN116287227A (en) | Reagent and kit for diagnosing prostate cancer | |
| CN117604095A (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN115838798A (en) | Application of reagent for detecting methylation level in preparation of colorectal cancer diagnosis product | |
| CN117248021A (en) | Nucleic acid combination, kit and application for detecting urothelial cancer or precancerous lesions | |
| CN116179694A (en) | Application of reagent for detecting methylation level in preparation of prostate cancer diagnosis product and prostate cancer diagnosis kit | |
| CN117587125A (en) | Application of reagent for detecting methylation in preparation of pancreatic cancer diagnosis product | |
| CN118360389A (en) | Methylation biomarker and reagent for auxiliary detection of liver cancer | |
| CN117004712A (en) | Nucleic acid product for diagnosing gastric cancer, kit and application | |
| CN115851937A (en) | Primer probe composition for multi-gene methylation joint detection of cervical cancer, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |