CN115820847A - Detection reagent for methylation of cervical cancer related genes and application thereof - Google Patents

Abstract

The invention discloses a detection reagent for methylation of a cervical cancer related gene and application thereof, wherein the detection reagent comprises a first primer pair for detecting methylation of a PAX1 gene and/or a second primer pair for detecting methylation of an ST6GALNAC5 gene. The detection reagent prepared by the scheme of the invention has the advantages of short target sequence obtained by amplification, high amplification efficiency, higher detection sensitivity to cervical high-grade lesion and cervical cancer, better specificity, capability of accurately detecting the methylation ratio of 0.5 percent under the background of 200ng of DNA, simple and rapid operation, low cost and suitability for clinical detection.

Description

Detection reagent for methylation of cervical cancer related genes and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a detection reagent for methylation of genes related to cervical cancer and application thereof.

Background

Cervical cancer has been a "killer" threatening the health of women, second only to breast cancer in female malignancies, with almost all (99.7%) of cervical cancer being caused by persistent infection with Human Papillomavirus (HPV). HPV belongs to the genus papillomavirus A of the papovavirus family, is a spherical DNA virus and can cause squamous epithelial proliferation of human skin mucosa. The cervical cancer is developed by infecting high-risk HPV virus from normal cervical cells, then from CIN1 to CIN2 to CIN3, and finally progressing to cervical invasive carcinoma. In this process, the methylation of a specific gene is abnormally elevated in the late stage of CIN2 and CIN3, and therefore, the risk of the progression of cervical lesions can be evaluated by detecting abnormal changes in the methylation of a specific gene. When detecting a transforming lesion (part of CIN2 and CIN 3) by specific gene methylation, the risk of cancer progression can be known, and the physician can be prompted whether to immediately perform therapeutic intervention or keep track of observation.

Cancer gene detection is a worldwide trend, early diagnosis of the risk and occurrence of cancer, early intervention and intervention can greatly improve the 5-year survival rate of cancer and reduce the mortality rate. Epigenetic research worldwide has become an important milestone for the most advanced early diagnosis of cancer: one of the characteristics of the tumor is methylation imbalance, namely, the methylation degree of a specific cancer suppressor gene at a canceration part is obviously increased, the expression is reduced or even silenced, the cancer suppressor function is lost, and finally, the cancer is rapidly developed. Therefore, the methylation state of a specific gene can be regarded as an important index of tumorigenesis and tumor development. Therefore, detection of gene methylation is key to future full-molecular screening of cervical cancer, assessing the risk of progression to cervical cancer in the short term. Therefore, a high-sensitivity and high-specificity methylation detection reagent serving as a molecular marker for detecting the cervical cancer is urgently needed to be searched and developed, and powerful help is provided for early diagnosis of the cervical cancer.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a detection reagent for methylation of cervical cancer related genes.

The invention also provides a kit containing the detection reagent.

The invention also provides an application of the detection reagent and the kit.

In a first aspect of the present invention, a detection reagent for methylation of a cervical cancer-associated gene is presented, the detection reagent comprising a first primer pair for detecting methylation of a PAX1 gene and/or a second primer pair for detecting methylation of a ST6GALNAC5 gene;

wherein, the nucleic acid sequence of the first primer pair is a forward primer with the sequence shown as SEQ ID NO. 1 and a reverse primer with the sequence shown as SEQ ID NO. 2, a forward primer with the sequence shown as SEQ ID NO. 4 and a reverse primer with the sequence shown as SEQ ID NO. 2, or a forward primer with the sequence shown as SEQ ID NO. 5 and a reverse primer with the sequence shown as SEQ ID NO. 6;

the nucleic acid sequence of the second primer pair is a forward primer with a sequence shown as SEQ ID NO. 8 and a reverse primer with a sequence shown as SEQ ID NO. 9, or the forward primer with a sequence shown as SEQ ID NO. 8 and the reverse primer with a sequence shown as SEQ ID NO. 11.

In some embodiments of the invention, the detection reagent further comprises a fluorescent probe sequence having a nucleotide sequence shown in SEQ ID NO. 3, SEQ ID NO. 7, and/or SEQ ID NO. 10.

In some embodiments of the invention, the fluorescent probe sequence shown in SEQ ID NO. 3 is a fluorescent sequence matched with the forward primer shown in SEQ ID NO. 1 and the reverse primer shown in SEQ ID NO. 2, or the forward primer shown in SEQ ID NO. 4 and the reverse primer shown in SEQ ID NO. 2; the fluorescent probe sequence shown in SEQ ID NO. 7 is a fluorescent sequence matched with the forward primer shown in SEQ ID NO. 5 and the reverse primer shown in SEQ ID NO. 6; the fluorescent probe sequence shown in SEQ ID NO. 10 is a fluorescent sequence matched with the forward primer shown in SEQ ID NO. 8 and the reverse primer shown in SEQ ID NO. 9, or the forward primer shown in SEQ ID NO. 8 and the reverse primer shown in SEQ ID NO. 11.

In some embodiments of the invention, the fluorescent probe sequence has a fluorophore at the 5 'end and a quencher at the 3' end; the fluorescent group is VIC, ROX, FAM, cy5, HEX, TET, JOE, NED or TexasRed; the quenching group is TAMRA, BHQ, MGB or Dabcyl.

In some embodiments of the invention, the detection reagent further comprises an internal reference primer pair and an internal reference probe, wherein the nucleotide sequences of the internal reference primer pair are shown as SEQ ID NO. 12 and SEQ ID NO. 13 respectively, and the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 14.

In some embodiments of the invention, the detection reagent is used to detect a sequence of PAX1 gene or ST6GALNAC5 gene modified by a transformation reagent; the conversion reagent is a reagent which converts cytosine, which is not methylated in DNA, into uracil, while leaving 5-MeC substantially unaffected.

In some embodiments of the invention, the conversion reagent comprises a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a reagent that under appropriate reaction conditions can produce one or more of a hydrazine salt, a bisulfite salt.

In some embodiments of the invention, the conversion reagent is bisulfite.

In some embodiments of the invention, bisulfite conversion in the present examples includes, but is not limited to, conversion using commercial kits, conversion using home-made or commercially available bisulfite. .

In some embodiments of the invention, the water is sterile, enzyme-free water.

In some embodiments of the present invention, the detection sample for which the detection reagent is directed is selected from cervical cancer tissue, blood, serum, or plasma.

In some embodiments of the invention, the detection reagent is used to detect the bisulfite modified sequence.

In some embodiments of the invention, the detection region targeted by the detection reagent is the PAX1 gene and/or ST6GALNAC5 gene or the promoter region of the PAX1 gene and/or ST6GALNAC5 gene.

In some embodiments of the invention, the detection region targeted by the detection reagent is a CG-rich region or a non-CG-rich region of the PAX1 gene and/or the ST6GALNAC5 gene.

In some embodiments of the invention, the detection region targeted by the detection reagent is a CG-rich region of the PAX1 gene and/or the ST6GALNAC5 gene.

In some embodiments of the invention, the detection region of the PAX1 gene targeted by the detection reagent is a sequence shown as SEQ ID NO. 17, SEQ ID NO. 19 or SEQ ID NO. 20; the detection region of the ST6GALNAC5 gene aimed at by the detection reagent is a sequence shown as SEQ ID NO. 18 or SEQ ID NO. 21. The selection of the detection area can affect the detection efficiency of the tumor, and the detection results of the primer pairs designed according to different CG enrichment areas have obvious difference.

In a second aspect of the present invention, there is provided a kit containing the above-mentioned detection reagent for methylation of a gene associated with cervical cancer.

In some embodiments of the present invention, the kit further comprises a PCR reaction solution, wherein the PCR reaction solution is

TaqMan mμLtiplex qPCR master mix。

In some embodiments of the invention, the kit further comprises a positive control and a negative control, wherein the positive control is gDNA of SiHa cell line, caski cell line, ME-180 cell line and the like (the cell line is a cell line which is verified to be highly methylated in the gene region detected by the invention through Sanger sequencing), and the negative control is gDNA of HEK293 or C-33A cell line and the like (a cell line which is verified to be not methylated or to be very low methylated in the gene region detected by the invention through Sanger sequencing).

In some embodiments of the invention, the positive control is gDNA from the ME-180 cell line and the negative control is gDNA from the HEK293 cell line.

In a third aspect of the invention, the invention provides an application of the detection reagent or the kit, wherein the application is an application in preparing cervical cancer or cervical precancerous diagnosis products.

In some embodiments of the invention, the cervical cancer or cervical precancerous diagnostic product is used to detect the sequence of PAX1 and/or ST6GALNAC5 gene modified with a transformation reagent; the conversion reagent is a reagent which converts cytosine, which is not methylated in DNA, into uracil, while leaving 5-MeC substantially unaffected.

In some embodiments of the invention, the conversion reagent comprises a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a reagent that under appropriate reaction conditions can produce one or more of a hydrazine salt, a bisulfite salt.

In some embodiments of the invention, the conversion reagent is a bisulfite reagent.

In some embodiments of the invention, bisulfite conversion in embodiments of the invention includes, but is not limited to, conversion using commercial kits, conversion using home-made or commercially available bisulfite.

In some embodiments of the invention, the cervical cancer or cervical precancerous diagnostic product is used to detect sequences modified with bisulfite.

In some embodiments of the invention, the detection region targeted by the cervical cancer or cervical precancerous diagnostic product is the PAX1 gene and/or the ST6GALNAC5 gene or a promoter region thereof.

In some embodiments of the invention, the cervical cancer or cervical precancerous diagnostic product is directed to a detection region that is a CG-rich region or a non-CG-rich region of the PAX1 gene and/or the ST6GALNAC5 gene.

In some embodiments of the invention, the cervical cancer or cervical precancerous diagnostic product is directed to a detection region that is a CG-rich region of the PAX1 gene and/or the ST6GALNAC5 gene.

In some embodiments of the invention, the detection region of the PAX1 gene of the cervical cancer or cervical precancerous diagnosis product is a sequence shown as SEQ ID NO. 17, SEQ ID NO. 19 or SEQ ID NO. 20; the detection region of the ST6GALNAC5 gene aimed at by the detection reagent is a sequence shown as SEQ ID NO. 18 or SEQ ID NO. 21.

In some embodiments of the invention, the method of using the cervical cancer or cervical precancerous diagnostic product comprises the steps of:

s1, processing a sample to be detected with bisulfite or hydrazine salt to obtain a modified sample to be detected;

and S2, detecting the methylation condition of the PAX1 gene and/or the ST6GALNAC5 gene of the modified sample to be detected in the step S1 by using the detection reagent.

In some embodiments of the present invention, the detecting in step S2 is performed by real-time fluorescence quantitative methylation specific polymerase chain reaction.

In some embodiments of the present invention, the real-time fluorescent quantitative methylation specific polymerase chain reaction amplification procedure is:

92-97℃ 8-12min

92-97℃ 13-17s 40-50cycles

56-64 deg.C (collecting fluorescence) 0.5-1.5min 40-50cycles

16-22℃ 0.5-1.5min。

In some embodiments of the invention, the real-time fluorescent quantitative methylation specific polymerase chain reaction amplification procedure is;

95℃ 10min

95℃ 15s 45cycles

1min 45cycles at 60 deg.C (Collection of fluorescence)

20℃ 1min。

In some embodiments of the invention, when methylation is detected using the PAX1 gene, the criteria is positive when Δ CT is ≦ 9.5 and negative when Δ CT > 9.5.

In some embodiments of the invention, when methylation is detected using the ST6GALNAC5 gene, the criteria for determination is positive when Δ CT ≦ 10 and negative when Δ CT > 10.

In some embodiments of the invention, when methylation detection is performed using the PAX1 gene and the ST6GALNAC5 gene, the criteria for determination are positive when the Δ CT detected for the PAX1 gene is less than or equal to 8.5 or when the Δ CT detected for the ST6GALNAC5 gene is less than or equal to 6.5, and negative when the Δ CT detected for the PAX1 gene is greater than 8.5 and the Δ CT detected for the ST6GALNAC5 gene is greater than 6.5.

According to the embodiment of the invention, at least the following beneficial effects are achieved: the detection reagent for methylation of cervical cancer related genes prepared by the scheme of the invention has the advantages of short target sequence obtained by amplification and high amplification efficiency; the detection reagent provided by the invention has high detection sensitivity and good specificity on cervical high-grade lesion and cervical cancer, can accurately detect the methylation ratio of 0.5% under the background of 200ng of DNA, is simple and quick to operate, has low cost, and is suitable for clinical detection.

Drawings

The invention is further described with reference to the following figures and examples, in which:

FIG. 1 is a graph showing the results of detection of the amplification efficiency of the primers for the PAX1 gene and the reference gene in example 2 of the present invention;

FIG. 2 is a diagram showing the results of the analysis of the consistency of the amplification efficiencies of the primers for the PAX1 gene and the reference gene in example 2 of the present invention;

FIG. 3 is a graph showing the results of detection of amplification efficiencies of primers for the ST6GALNAC5 gene and the reference gene in example 2 of the present invention;

FIG. 4 is a diagram showing the results of the analysis of the uniformity of the amplification efficiencies of the primers for the ST6GALNAC5 gene and the reference gene in example 2 of the present invention;

FIG. 5 is a graph showing the results of detection of the amplification efficiencies of the primers for the PAX1 gene, ST6GALNAC5 gene and reference gene in example 2 of the present invention;

FIG. 6 is a graph showing the results of the analysis of the uniformity of the amplification efficiencies of the primers for the PAX1 gene, ST6GALNAC5 gene, and the reference gene in example 2 of the present invention.

Detailed Description

The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments to fully understand the objects, features and effects of the present invention. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and those skilled in the art can obtain other embodiments without inventive effort based on the embodiments of the present invention, and all embodiments are within the protection scope of the present invention.

Example 1 detection reagent for methylation of cervical cancer-associated genes

Performing biological information analysis and mining on methylation data and gene expression data of cervical Cancer in a Cancer Genome map database (The Cancer Genome Atlas, TCGA), setting 90% of methylation Beta Value of cervical Cancer tissues to be more than 0.5, and setting methylation Beta Value of normal tissues to be less than 0.2 as data primary screening, then selecting sites with large difference in The cervical Cancer tissues and The normal tissues, searching CpG sites with significant difference in methylation level in The cervical Cancer tissues and The normal tissues, and selecting a plurality of methylation sites with significant difference through analysis and screening; the methylation sites of cervical cancer cell strains ME-180, siHa, 15 cervical cancer positive samples and 30 normal population samples are verified by adopting a Sanger sequencing technology after sulfite treatment, and the fact that the PAX1 gene after bisulfite conversion is located in the CpG sites of a region chr20:21686201-21686359 and the ST6GALNAC5 gene is located in the region chr1:77332991-77333259 is highly methylated in the cervical cancer positive cell strains or samples, but in the normal population samples, the CpG sites are unmethylated or the methylation of a small part of CpG sites is low.

The original sequence of the highly methylated region chr20:21686201-21686359 of the PAX1 gene was as follows (5 '-3'):

GGGGAGGGGGGCGCTGGGGCGCAGTGACGGGAACCAATGAGCTGCCAACTCGCGCGTCTCCGGCGTGACTGCCGAGATTGACGTGGAGGACACGTCAAATTGATTCCCGCACGCTGCAGCCTCCCGGTCAGACGAATTTCTCCCAATCGGATGAAGTTC(SEQ ID NO:15)。

the original sequence of the ST6 GALNC 5 gene highly methylated region chr1:77332991-77333259 is as follows:

CGCGGACCAAGAAGTGGGTACACTGGCTCGGTTAACTCTCTCTCCCCAGAAATTTCACTACTGAAAAGATTATTATTTGGGGGCGGGGAAGGGGATGTAGAGGTCTTTAGGACCCAGCAGGCGGCGGCAGGCGGCAGTTGTGTAGATCGCTGAGAGACTACGAGGGTCCGGTTCAGTTTTAATTCTGTCTCTAATCTCTGCAACAGCCGCGCTTCCCGGGTCCCGCGGCTCCCGCGCGCGATCTGCCGCGGCCGGCTGCTGGGCAAAAA(SEQ ID NO:16)。

1. selection of detection regions

Because methylation state and distribution of the same gene are not uniform, and methylation primers and probe detection systems designed by selecting different regions have different diagnostic detection efficacies on the same sample for the same gene, even the selected regions are not suitable for causing no diagnostic effect on tumors at all, after repeated research and comparison, the inventor screens the PAX1 gene highly-methylated region chr20:21686201-21686359 and the ST6GALNAC5 gene highly-methylated region chr1:77332991-77333259, screens the PAX1 gene highly-methylated region chr20:21686201-21686359 to obtain 3 target region sequences (regions 1-3) with the best methylation of the PAX1 gene, screens the ST6GALNAC5 gene highly-methylated region chr1:77332991-77333259 to obtain 2 target region sequences (regions 4 and 5) with the best methylation of the ST6GAL 5 gene (specific sequences are shown in Table 1:

TABLE 1

2. Design and selection of primer Probe sequences

The sequences of the two gene regions after bisulfite treatment are used as templates, a series of parameters such as the length, annealing temperature, specificity and the like of amplification products of different detection regions are analyzed, a forward primer R2F-MF1, a reverse primer R2F-MR1 and a probe sequence R2F-MP1 for the region 1 are designed and screened, a forward primer R2F-MF2, a reverse primer R2F-MR1 and a probe sequence R2F-MP1 for the region 2 are designed and screened, a forward primer R2R-MF1, a reverse primer R2R-MR1 and a probe sequence R2R-MP1 for the region 3 are designed and screened, a forward primer R7F-MF1, a reverse primer R7F-MR1 and a probe sequence R7F-MP1 for the region 4 are designed and screened, a forward primer R7F-MF1, a reverse primer R7F-MF 2 and a probe sequence R7F-MP1 for the region 5 are designed and screened, and an ACTF-MP 2, such as shown in ACT-primer sequences and ACT-BS 2 are designed for the internal reference genes. The designed primer probes were all synthesized by Biotechnology engineering (Shanghai) GmbH.

TABLE 2 primer and probe sequences for methylation detection

For different primer probe combinations in table 2, gDNA of cell lines ME-180, siHa and C-33A (cell lines are purchased from cell banks of shanghai department of china) and 1 normal population of cervical exfoliated cells (sample number RD001, samples from people and future medical laboratories) is subjected to bisulfite treatment and then used as a template, sterile water is used as negative reference (NTC) for screening tests, and the primer probe combinations designed for different areas in table 1 are respectively subjected to amplification, wherein the amplification system is as follows: 12.5 muL of 1 XTaqMan Probe qPCR mix (purchased from Fipeng organism), the final concentration of a primer Probe of a target gene (a primer Probe combination designed in different areas in Table 1) is 0.2 muM, 20ng of gDNA to be detected is detected, and sterile water is supplemented until the total volume is 25 muL. The amplification procedure was: at 95 ℃ for 10min;95 ℃,15sec,60 ℃,1min (fluorescence collected), 45cycles;20 ℃ for 1min. The specific results of the detection are shown in table 3.

TABLE 3 CT values of cell lines examined for different PAX1 gene combinations and ST6GALNAC5 gene combinations

Note: if the detection result is NoCt, the result is negative.

From the analysis of the detection results of different primer probe combinations in table 3, the sensitivity of the PAX1 combination 2 to positive cell strains is higher, so that the PAX1 combination 2 is preferred to be subsequently studied by the multiplex fluorescence kit of the present invention; meanwhile, ST6GALNAC5 combination 1 is more sensitive to positive cell lines, so it is subsequently preferred that ST6GALNAC5 combination 1 is subjected to the multiplex fluorescence kit study of the present invention. The other combinations do not achieve the effect of the preferred combination in effect, but can also distinguish the cervical cancer samples to a certain extent, and equivalent substitutions or changes made by the person skilled in the art on the basis of the invention are within the scope of the invention.

EXAMPLE 2 establishment of multiplex fluorescent PCR detection System

1. Establishment of dual-fluorescence PCR system for PAX1 gene methylation detection

The amplification efficiency of the primer is an important index of the PCR detection performance and is also an important parameter for evaluating the methylation level of the target gene, so the amplification efficiency of the target gene PAX1 and the reference gene ACTB in the dual-fluorescence PCR system is analyzed, taking the PAX1 combination 2 as an example. The specific operation is as follows: in an amplification system (total volume 25. Mu.L), 12.5. Mu.L of 1 XTAQMAN Probe qPCR mix (from Fipeng organism), primer probes for the target gene (PAX 1 combination 2) and ACTB for the reference gene at final concentrations of 0.2. Mu.M, respectively, were added with the amount of the bisulfite-treated gDNA template of 50ng, 25ng, 12.5ng, 2.5ng, 1.25ng, respectively. The amplification procedure was: at 95 ℃ for 10min;95 ℃,15sec,60 ℃,1min (fluorescence collected), 45cycles; and (3) selecting a corresponding detection channel according to the fluorescent label of the TaqMan probe at the temperature of 20 ℃ for 1min. And after qPCR amplification is finished, analyzing the amplification efficiency of the PAX1 gene and the ACTB gene in the PCR reaction.

The results of the detection of the amplification efficiency of the primers are shown in FIG. 1, where the log value of the template amount is taken as the abscissa and the Ct value is taken asAs an ordinate, amplification slopes of the reference gene ACTB and the target gene (PAX 1) were calculated, and amplification efficiencies thereof were calculated from the respective amplification slopes, and E =10 ^-1/a And a is the slope of the amplification curve, the amplification efficiency is expressed as a percentage, i.e., the percentage of template amplified per cycle, and the amplification efficiency E is converted into a percentage: efficiency% = (E-1) × 100%. As can be seen from FIG. 1, the amplification efficiency of ACTB was 101.11% and that of PAX1 was 97.41%. The amplification efficiency of both is between 90 and 110 percent, and the next step of test can be carried out.

Carrying out consistency analysis on the amplification efficiency of detection primers of the reference gene ACTB and the target gene PAX1 by respectively calculating the delta Ct values (delta Ct = Ct) of different detection template amounts of the target gene _{Target gene} -Ct _{Internal reference gene} ). Then, the amount of the template to be detected is taken as an abscissa and the Δ Ct value is taken as an ordinate, a curve is drawn, and the slope of the curve is calculated. The result of the analysis of the consistency of the amplification efficiency of the primers is shown in FIG. 2, and it can be seen from the graph that the slope of the curve is 0.002, which is close to 0, and the components of the detection system and the amplification conditions can be determined to be used for the subsequent detection.

2. Establishment of ST6GALNAC5 gene methylation detection double PCR system

The specific method established by the ST6GALNAC5 gene methylation detection duplex PCR system is the same as the duplex fluorescence PCR system for PAX1 gene methylation detection, and the difference is that the target gene detection primer probe combination in the amplification system is ST6GALNAC5 combination 1 in example 1, and the detection result of the amplification efficiency is shown in fig. 3, and it can be seen from the figure that in the duplex fluorescence PCR reaction system, the amplification efficiency of ACTB is 99.67%, and the primer amplification efficiency of the target gene ST6GALNAC5 is 92.49%. The result of the analysis of the consistency of the amplification efficiency of the primers is shown in fig. 4, and it can be seen from the figure that the consistency of Δ CT is better, the slope of the curve is 0.006 (close to 0), and the components of the detection system and the amplification conditions can be determined to be used for subsequent detection.

3. Establishment of triple fluorescence PCR system for PAX1, ST6GALNAC5 double-marker methylation detection

The specific method for establishing the PAX1 and ST6GALNAC5 dual-marker methylation detection triple fluorescence PCR system is consistent with the double fluorescence PCR system for PAX1 gene methylation detection, and is different in that the PAX1 and ST6GALNAC5 target gene detection primer probe combination which is the preferred PAX1 combination 2 and ST6GALNAC5 combination 1 in the embodiment 1 is simultaneously added into the amplification system, the detection result of the amplification efficiency is shown in FIG. 5, and it can be seen from the figure that in the double fluorescence PCR reaction system, the amplification efficiency of ACTB is 109.17%, the amplification efficiency of the target gene ST6GALNAC5 primer is 107.85%, and the amplification efficiency of the ST6GALNAC5 primer is 101.43%. The result of the analysis of the consistency of the amplification efficiency of the primers is shown in fig. 6, and it can be seen from the figure that the consistency of each target and the reference gene delta CT is better, the slope of the curve is 0.005 and 0.001 (close to 0), respectively, and the components of the detection system and the amplification conditions can be determined to be used for subsequent detection.

Example 3

1 screening of Positive and negative reference

The positive reference substance adopts cell strains ME-180 and SiHa (both purchased from Nanfeng hui biology in lake), and the results of qPCR and Sanger sequencing verification show that the two cell strains have high methylation in the target regions of the PAX1 and ST6GALNAC5 genes, so that ME-180 and SiHa can be selected as the positive reference substance of the multiple fluorescence kit in the following process, ME-180 is selected as the positive reference substance of the following kit in the scheme of the invention, and the methylation level of ME-180 in the target regions of the PAX1 and ST6GALNAC5 genes is defined as 100%.

Screening of negative reference products: the cell strains GSE-1, SV-HUC-1 and HEK293 (all purchased from Nanfeng Hui) are preliminarily screened by adopting a triple fluorescent quantitative PCR mode, the establishment of a triple fluorescent quantitative PCR system and an amplification program are consistent with the establishment of a PAX1 and ST6GALNAC5 dual-marker methylation detection triple fluorescent PCR system in example 2, the difference is that templates in the system are gDNA of the 3 cell strains treated by bisulfite respectively, the input amount of qPCR templates is 50ng, and the preliminary screening result is shown in Table 4.

TABLE 4 detection results of triple fluorescent quantitative PCR on cell lines GSE-1, SV-HUC-1, HEK293

As shown in table 4, it can be seen from the results in table 4 that the PCR products of the target region of the cell line HEK293 were preferably subjected to Sanger sequencing verification, which was consistent with the triple fluorescence PCR results, and no methylation was observed in the target regions of PAX1 and ST6GALNAC 5. Consequently, HEK293 was subsequently selected as a negative reference for the PAX1 and ST6GALNAC5 target regions, defining a methylation of HEK293 at 0% in both target regions.

Preparation of 2 three multiplex fluorescent PCR kits

On the basis of the above embodiments, the present invention provides three multiple fluorescent PCR kits for screening cervical high-grade lesions and cervical cancer, wherein the three multiple fluorescent PCR kits respectively comprise the main components in table 5.

TABLE 5 three multiplex fluorescent PCR kit Components

3 multiple fluorescent PCR kits were assembled according to the kit composition in Table 5, wherein the multiple fluorescent PCR kit 1 was used to detect the methylation of the PAX1 gene, the multiple fluorescent PCR kit 2 was used to detect the methylation of the ST6GALNAC5 gene, and the multiple fluorescent PCR kit 3 was used to detect the methylation of the PAX1 and ST6GALNAC5 genes. And then, the 3 kits are respectively applied to diagnosis of cervical lesions and cervical cancer.

Example 4 application of multiplex fluorescence PCR kit in cervical lesion and cervical cancer diagnosis

The present example tests the application of the multiplex fluorescence PCR kit prepared in example 3 in cervical cancer diagnosis, and the specific process is as follows:

1 obtaining a biological sample

All samples in the invention are 291 samples of cervical exfoliated cells collected during 2021 month 04-2021 month 10 at the maternal and child care facility in Changsha, wherein 93 samples of colposcopic negative samples, 54 samples of HSIL (high grade squamous intraepithelial lesion) samples, 81 samples of LSIL grade (low grade squamous intraepithelial lesion) samples and 63 samples of CA (cervical cancer) samples.

2 sample extraction

The extraction of all cervical exfoliated specimens adopts a nucleic acid extraction and purification kit purchased from human and future biotechnology (Changsha) limited company, and the specific operation steps are as follows.

(1) Taking 1mL of cervical exfoliated cell preservative fluid into 1.5mL of centrifuge, centrifuging at 16000rpm for 3min, and removing supernatant;

(2) Adding 200 μ L deionized water, adding 300 μ L lysine Buffer and 10 μ L protease K, vortex mixing, and water bath at 55 deg.C for 60min, and mixing once every 15 min;

(3) Taking out the centrifuge tube, adding 300 μ L binding buffer solution and 20 μ L magnetic beads, reversing and mixing for 10min, and performing instantaneous separation;

(4) Placing the centrifugal tube on a magnetic frame to enable magnetic beads in the tube to be adsorbed, and discarding liquid in the tube;

(5) Adding 500 mu L of cleaning buffer solution I, uniformly mixing by vortex, placing on a magnetic frame for 1min, removing the supernatant, and taking down a centrifuge tube;

(6) Adding 500 μ L of cleaning buffer solution II, mixing by vortex, placing on a magnetic frame for 1min, removing supernatant, and taking off the centrifuge tube;

(7) Adding 500 μ L of washing buffer solution II, vortex mixing, placing on magnetic frame for 1min, and removing supernatant;

(8) Sucking with a pipette to remove residual supernatant in the tube, adding 50 μ L of precipitation Buffer, re-suspending, and performing metal bath at 55 deg.C for 10min while gently shaking;

(9) And (5) placing the sample on a magnetic frame for 1min, and transferring the supernatant to a new centrifuge tube to obtain the sample DNA to be detected.

3 DNA bisulfite conversion and purification.

The Methylation transformation kit adopted is EZ-96DNA Methylation-Gold MagPrep (purchased from Zymo Research) to transform and purify the nucleic acid of the extracted sample, the operation is carried out strictly according to the kit operation instruction, and the specific transformation and purification steps are as follows:

(1) Add 20. Mu.L of the sample to be transformed into 0.2mL of eight tubes, add 130. Mu.L of CT Conversion Reagent, cover 8 tubes and mark them, vortex, shake, mix well, and centrifuge instantaneously.

(2) The 8-tube was placed in a PCR apparatus and the PCR procedure is shown in Table 6.

TABLE 6

Temperature of	Time
		98℃	10min
64℃	3h
		4℃	hold

(3) A1.5 mL centrifuge tube was prepared and 600. Mu.L of M-Binding Buffer and 10. Mu.L of magnetic bead suspension were added (mixed well by vortexing well before use). And (3) taking the sample reacted in the step (2) out of the PCR instrument, transferring the liquid in the tube into a corresponding 1.5mL centrifuge tube according to the number, uniformly mixing the liquid in the tube by vortex for 30s, and standing the liquid at room temperature for 5min.

(4) And (5) instantaneous separation, placing on a magnetic frame for adsorption until clarification is achieved, and discarding the supernatant.

(5) Add 400. Mu.L M-Wash Buffer (gently shake before use), vortex mix for 30s, and flash-separate. Adsorbing on magnetic frame until it is clear, and discarding the supernatant.

(6) Adding 200 μ L M-depletion Buffer, vortex mixing for 30s, standing at room temperature for 15min (reverse mixing), performing flash separation, placing on magnetic frame, adsorbing to clarify, and discarding supernatant.

(7) Add 400. Mu.L M-Wash Buffer, vortex and mix for 30s, and flash separate. Adsorbing on magnetic frame until it is clear, and discarding the supernatant.

(8) Repeating the step (7) once, and needing to suck and discard residual liquid.

(9) Incubate in a metal bath at 55 ℃ for 5min (uncapped) to dryness.

(10) Adding 50 mu L of M-Elution Buffer, suspending magnetic beads, incubating at 55 ℃ for 4min (without uncovering) in a metal bath, performing instant separation, placing on a magnetic frame for adsorption until clarification is achieved, transferring the supernatant into a new 1.5mL centrifuge tube, collecting the supernatant as a BS-DNA solution for subsequent PCR detection, and placing at-80 ℃ if long-term storage is required.

4 PCR detection

The fluorescence quantitative PCR instrument used in the invention is a full-automatic medical PCR analysis system (SLAN-96S) of the macrolite, and the PCR amplification system and the program are as follows:

the PCR amplification system is shown in Table 7.

TABLE 7

Composition (I)	Reaction volume (μ L)
		PCR reaction solution A	12.5μL
PCR reaction solution B/C/D	7.5μL
		BS-DNA template	5μL

The detection on the computer is operated according to the instructions of each fluorescent PCR, and a PCR program is set.

The PCR reaction procedure is shown in Table 8.

TABLE 8

5 interpretation of results

Threshold value demarcation: both FAM and HEX thresholds were defined as 0.12.

The results were interpreted (PAX 1:. DELTA.CT = FAM CT-HEX CT; ST6GALNAC 5:. DELTA.CT = ROX CT-HEX CT) as shown in Table 9.

TABLE 9

Methylation detection distribution of PAX1 gene and ST6GALNAC5 gene in 6 cervical lesions, cervical cancer samples and negative samples

Cervical lesions, cervical cancer samples and negative samples were tested using the above method and primer probe set, and the results are shown in table 10. The results show that: the multiplex fluorescence PCR kit 1 (namely, the single-target PAX 1) detects 7 of 93 colposcopic negative samples (the specificity is 86/93 and is about 92.47%), 63 cervical cancer samples are all detected, 54 HSIL samples are 36 of the cervical cancer samples, and 81 LSIL samples are 22 of the cervical cancer samples; the multiplex fluorescence PCR kit 2 (namely, the single-target ST6GALNAC 5) detects 13 cases (the specificity is 80/93 and is about 86.02 percent) in 93 cases of colposcopic negative samples, 58 cases in 63 cases of cervical cancer samples, 40 cases in 54 cases of HSIL samples and 30 cases in 81 cases of LSIL samples; the multiplex fluorescent PCR kit 3 (i.e., the dual targets PAX1 and ST6GALNAC 5) detected 5 out of 93 colposcopic negative samples (specificity 88/93, about 94.62%), 63 out of 63 cervical cancer samples, 43 out of 54 HSIL samples, and 24 out of 81 LSIL samples. Meanwhile, the methylation ratio of the PAX1 and ST6GALNAC5 genes is increased along with the progression of cervical cancer, the sensitivity of the single target PAX1 to cervical cancer is 100%, the sensitivity to HSIL is 66.67%, the sensitivity to LSIL is 27.16%, and the specificity to a negative sample is 92.47%; single target ST6GALNAC5 had 92.06% sensitivity to cervical cancer, 74.07% sensitivity to HSIL, 37.04% sensitivity to LSIL, and 86.02% specificity for negative samples; the dual targets PAX1 and ST6GALNAC5 had 100% sensitivity to cervical cancer, 79.63% sensitivity to HSIL, 29.63% sensitivity to LSIL, and 94.62% specificity for negative samples. Therefore, the kit with the double targets PAX1 and ST6GALNAC5 is more beneficial to the detection of precancerous lesion HSIL, and the performance of the kit is obviously superior to that of the kit with the single target PAX1 and the single target ST6GALNAC 5.

TABLE 10 cervical lesions and cervical cancer samples and negative samples in different kits

Example 5 sensitivity test

The methylation rates of different proportions in the background of 200ng of DNA were detected using the kit 3 prepared in example 3 of the present invention, and the methylation sensitivity of the detection in the background of 200ng of DNA was evaluated.

The invention selects a cell line ME-180 (purchased from China Shanghai academy of sciences cell bank) as a 100% methylation sample, and a cell line HEK293 (purchased from Hunan Fenghui organism) as a 0% methylation sample. The detailed procedure for DNA extraction of the cell lines is described in step 2 of example 4, and the DNA concentration of the extracted DNA was determined by a Qubit 2.0 fluorescence quantifier (from Thermofeisher Scientific). ME-180 and HEK293 were diluted to 10 ng/. Mu.L solutions and then diluted in multiple ratios to different methylation ratio references, the specific methylation ratio reference formulations are shown in Table 11.

TABLE 11

The procedure for bisulfite conversion of reference DNA with different ratios of methylation was as described in example 4, step 3, where 200ng of DNA was added.

The transformed BS-DNA was used as a template for PCR detection in accordance with step 4 of example 3. The result analysis and interpretation were performed by referring to the result interpretation method in example 4, and the specific detection results are shown in table 12:

TABLE 12 CT detection and interpretation of different methylation ratio references

Note: when the detection result of the FAM channel is NoCt, the Delta CT is more than 8.5, and when the detection result of the ROX channel is NoCt, the Delta CT is more than 6.5, and the result is judged to be negative.

The results of the methylation sensitivity test are shown in Table 12, and it can be seen from the table that the kit of the present invention can accurately detect the methylation ratio of 0.5% in the background of 200ng of DNA.

The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

Claims (10)

1. A detection reagent for methylation of a cervical cancer-associated gene, wherein the detection reagent comprises a first primer pair for detecting methylation of a PAX1 gene and/or a second primer pair for detecting methylation of a ST6GALNAC5 gene;

wherein, the nucleic acid sequence of the first primer pair is a forward primer with the sequence shown as SEQ ID NO. 1 and a reverse primer with the sequence shown as SEQ ID NO. 2, a forward primer with the sequence shown as SEQ ID NO. 4 and a reverse primer with the sequence shown as SEQ ID NO. 2, or a forward primer with the sequence shown as SEQ ID NO. 5 and a reverse primer with the sequence shown as SEQ ID NO. 6;

the nucleic acid sequence of the second primer pair is a forward primer with a sequence shown as SEQ ID NO. 8 and a reverse primer with a sequence shown as SEQ ID NO. 9, or the nucleic acid sequence of the second primer pair is a forward primer with a sequence shown as SEQ ID NO. 8 and a reverse primer with a sequence shown as SEQ ID NO. 11.

2. The detection reagent according to claim 1, wherein the detection reagent further comprises a fluorescent probe sequence with a nucleotide sequence shown as SEQ ID NO. 3, SEQ ID NO. 7 and/or SEQ ID NO. 10.

3. The detection reagent according to claim 1, further comprising an internal reference primer pair and an internal reference probe, wherein the nucleotide sequences of the internal reference primer pair are shown as SEQ ID NO. 12 and SEQ ID NO. 13, respectively, and the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 14.

4. The detection reagent according to claim 1, wherein the detection sample of the detection reagent is selected from the group consisting of cervical cancer tissue, exfoliated cells of cervical cancer, blood, serum, and plasma.

5. A kit comprising the detection reagent according to any one of claims 1 to 4.

6. The kit of claim 5, further comprising a positive control selected from the group consisting of gDNA of SiHa cell line, caski cell line and ME-180 cell line, and a negative control of gDNA of HEK293 cell line or C-33A cell line.

7. Use of the detection reagent according to any one of claims 1 to 4 or the kit according to any one of claims 5 to 6 for the preparation of a cervical cancer or a cervical precancerous diagnostic product.

8. The use according to claim 7, wherein the cervical cancer or cervical precancerous diagnostic product is used for detecting a sequence of PAX1 gene or ST6GALNAC5 gene modified with a transforming agent; preferably, the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulfite; preferably, the conversion reagent is bisulfite.

9. The use according to claim 7, wherein the cervical cancer or the cervical precancerous diagnostic product is directed to a detection region of the PAX1 gene and/or the ST6GALNAC5 gene, or a promoter region of the PAX1 gene and/or the ST6GALNAC5 gene; preferably, the detection region of the cervical cancer or cervical precancerous diagnosis product aiming at the PAX1 gene is a sequence shown as SEQ ID NO. 17, SEQ ID NO. 19 or SEQ ID NO. 20; the detection region of the ST6GALNAC5 gene aimed at by the detection reagent is a sequence shown as SEQ ID NO. 18 or SEQ ID NO. 21.

10. Use according to claim 7, characterized in that the method of use of the cervical cancer or cervical precancerous diagnostic product comprises the following steps:

s1, processing a sample to be detected with bisulfite or hydrazine salt to obtain a modified sample to be detected;

s2, using the detection reagent of any one of claims 1 to 4 or the kit of any one of claims 5 or 6 to detect the methylation condition of the PAX1 gene and/or ST6GALNAC5 gene of the test sample modified in the step S1.

Images