CN115341030A

CN115341030A - MIR129-2 gene methylation detection reagent and application thereof

Info

Publication number: CN115341030A
Application number: CN202210404382.9A
Authority: CN
Inventors: 王煜; 朱碧银; 传军; 颛孙丹丹; 陈可欣; 卜中鑫; 何庆
Original assignee: Genetalks Bio Tech Changsha Co ltd
Current assignee: Genetalks Bio Tech Changsha Co ltd
Priority date: 2022-04-18
Filing date: 2022-04-18
Publication date: 2022-11-15

Abstract

The invention discloses an MIR129-2 gene methylation detection reagent and application thereof, wherein the MIR129-2 gene methylation detection reagent comprises: a forward primer with a sequence shown as SEQ ID NO. 1 and a reverse primer with a sequence shown as SEQ ID NO. 2; and/or a forward primer with a sequence shown as SEQ ID NO. 4 and a reverse primer with a sequence shown as SEQ ID NO. 5. The MIR129-2 gene methylation detection reagent prepared by the scheme of the invention has the advantages of short target sequence obtained by amplification, high amplification efficiency, capability of accurately detecting the methylation ratio of 5% under the background of 200ng of DNA, simple and rapid operation, low cost and suitability for clinical detection.

Description

MIR129-2 gene methylation detection reagent and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a MIR129-2 gene methylation detection reagent and application thereof.

Background

Cervical cancer is the first in the morbidity and mortality of female genital tract tumors and seriously threatens the life health of women. Cervical cancer is caused by Human Papilloma Virus (HPV), and can be prevented and treated by HPV screening. However, this viral infection is very common and in most cases, the infected cervical cells do not convert to cervical cancer. Therefore, patients with positive HPV detection result need further evaluation of disease risk, and cytological examination is the main diagnosis method for patients with positive HPV detection at present, but the method has low sensitivity and high requirements on doctor experience.

Hypermethylation of tumor suppressor gene promoters has specific change modes in various stages of generation and development of cervical cancer; in the process of cervical cancer occurrence and development, due to hypermethylation of the promoter, inactivation of different tumor suppressor genes is caused. The additive effect of epigenetic changes is of great significance in the development of cervical cancer from normal tissues-precancerous lesions-cervical cancer. The methylation level of a specific molecular marker is detected, and auxiliary diagnosis can be performed on cervical precancerous lesions and early cervical cancer. Therefore, a high-sensitivity and high-specificity methylation detection reagent for the molecular marker for detecting the cervical cancer is urgently needed to be searched and developed, and powerful help is provided for early diagnosis of the cervical cancer.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a reagent for detecting the methylation of the MIR129-2 gene.

The invention also provides a kit containing the MIR129-2 gene methylation detection reagent.

The invention also provides an application of the MIR129-2 gene methylation detection reagent or the kit.

According to one aspect of the invention, a reagent for detecting the methylation of the MIR129-2 gene is provided, and the reagent comprises: a forward primer with a sequence shown as SEQ ID NO. 1 and a reverse primer with a sequence shown as SEQ ID NO. 2; and/or a forward primer with a sequence shown as SEQ ID NO. 4 and a reverse primer with a sequence shown as SEQ ID NO. 5.

In some embodiments of the invention, the reagent further comprises a fluorescent probe sequence having a nucleotide sequence shown in SEQ ID NO. 3 and/or SEQ ID NO. 6.

In some embodiments of the invention, the fluorescent probe sequence has a fluorophore at the 5 'end and a quencher at the 3' end; the fluorescent group is VIC, ROX, FAM, cy5, HEX, TET, JOE, NED or TexasRed; the quenching group is TAMRA, BHQ, MGB or Dabcyl.

In some embodiments of the invention, the MIR129-2 gene methylation detection reagent is used for detecting a sequence of a MIR129-2 gene modified by a transformation reagent; the conversion reagent is a reagent which converts cytosine, which is not methylated in DNA, into uracil, while leaving 5-MeC substantially unaffected.

In some embodiments of the invention, the conversion reagent comprises one or more of a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a compound that under the appropriate reaction conditions produces a hydrazine salt, a bisulfite salt.

In some embodiments of the invention, the conversion reagent is a bisulphite reagent.

In some embodiments of the invention, bisulfite conversion in the present examples includes, but is not limited to, conversion using commercial kits, conversion using home-made or commercially available bisulfite. Wherein, the commercial kit of the bisulfite consists of CT Conversion Reagent dry powder, M-dispensing Buffer, M-Dilution Buffer, M-Binding Buffer, M-Wash Buffer, M-Des mu Lphosphorylation Buffer, M-Elution Buffer and MagBinding Beads; the preparation method of the bisulfite conversion reagent comprises the following steps: adding water, M-dispersing Buffer and M-Dilution Buffer into CT Conversion Reagent dry powder, mixing until the dry powder is completely dissolved, and storing at-20 ℃ for later use.

In some embodiments of the invention, the water is sterile, enzyme-free water.

In some embodiments of the invention, the detection reagent for the methylation of the MIR129-2 gene detects a sequence modified by bisulfite.

In some embodiments of the invention, the detection region of the MIR129-2 gene methylation to which the detection reagent for MIR129-2 gene methylation is directed is the MIR129-2 gene or a promoter region thereof.

In some embodiments of the invention, the detection region of the agent for detecting methylation of the MIR129-2 gene for the MIR129-2 gene is a CG-rich region or a non-CG-rich region of the MIR129-2 gene.

In some embodiments of the invention, the detection region targeted by the MIR129-2 gene methylation detection reagent is a CG-rich region of the MIR129-2 gene.

In some embodiments of the invention, the detection region of the MIR129-2 gene methylation detection reagent for the MIR129-2 gene is a sequence shown in SEQ ID NO. 10 or SEQ ID NO. 11. The selection of the detection region of the MIR129-2 gene can affect the detection efficiency of tumors, and the detection results of the primers designed in different regions are obviously different according to the primers designed in the CG enrichment region of the MIR129-2 gene.

In some embodiments of the invention, the detection reagent for MIR129-2 gene methylation further comprises a detection reagent for a reference gene; preferably, the internal reference gene is ACTB or GAPDH.

In some embodiments of the invention, the reference gene is ACTB.

In some embodiments of the invention, the detection reagent containing the reference gene comprises a primer pair shown in SEQ ID NO. 7 and SEQ ID NO. 8, and a probe of SEQ ID NO. 9.

In some embodiments of the present invention, the detection sample of the MIR129-2 gene methylation detection reagent is selected from cervical cancer tissue, cervical cancer exfoliative cells, blood, serum or plasma.

In a second aspect of the invention, a kit is provided, which comprises the MIR129-2 gene methylation detection reagent.

In some embodiments of the present invention, the kit further comprises a PCR reaction solution, wherein the PCR reaction solution is 1 × Hieff

TaqMan mμLtiplex qPCR master mix。

In some embodiments of the invention, the kit further comprises a positive control, which is gDNA of SiHa cell line, caski cell line, ME-180 cell line, etc. (cell line that is highly methylated in the gene region detected by the invention as confirmed by Sanger sequencing) and a negative control, which is gDNA of C-33A cell line, etc. (cell line that is not methylated or is poorly methylated in the gene region detected by the invention as confirmed by Sanger sequencing).

In some embodiments of the invention, the positive control is gDNA of the ME-180 cell line and the negative control is gDNA of the C-33A cell line.

In a third aspect of the invention, the invention provides an application of the detection reagent or the kit for MIR129-2 gene methylation, wherein the application is an application in preparation of a cervical cancer diagnosis reagent or a kit.

In some embodiments of the present invention, the cervical cancer diagnostic reagent or kit is used for detecting a sequence of MIR129-2 gene modified by a transformation reagent; the conversion reagent is a reagent which converts cytosine, which is not methylated in DNA, into uracil, while leaving 5-MeC substantially unaffected.

In some embodiments of the invention, the conversion reagent is bisulfite.

In some embodiments of the invention, bisulfite conversion in embodiments of the invention includes, but is not limited to, conversion using commercial kits, conversion using home-made or commercially available bisulfite. Wherein, the commercial kit of the bisulfite comprises CT Conversion Reagent dry powder, M-dispensing Buffer, M-Dilution Buffer, M-Binding Buffer, M-Wash Buffer, M-Des mu Lphosphorylation Buffer, M-Elution Buffer and MagBinding Beads.

In some embodiments of the invention, the method of preparing a bisulfite conversion reagent comprises the steps of: adding water, M-dispensing Buffer and M-Dilution Buffer into CT Conversion Reagent dry powder, mixing until the dry powder is completely dissolved, and storing at-20 ℃ for later use.

In some embodiments of the invention, the water is sterile, enzyme-free water.

In some embodiments of the present invention, the cervical cancer diagnostic reagent or kit detects a sequence modified with bisulfite.

In some embodiments of the present invention, the detection region of the MIR129-2 gene to which the cervical cancer diagnostic reagent or kit is directed is the MIR129-2 gene or a promoter region thereof.

In some embodiments of the present invention, the detection region of the cervical cancer diagnostic reagent or kit for the MIR129-2 gene is a CG-rich region or a non-CG-rich region of the MIR129-2 gene.

In some embodiments of the present invention, the cervical cancer diagnostic reagent or kit is directed to a detection region that is a CG-rich region of the MIR129-2 gene.

In some embodiments of the invention, the detection region of the cervical cancer diagnostic reagent or kit for MIR129-2 gene is a sequence shown in SEQ ID NO. 10 or SEQ ID NO. 11. The selection of the detection region of the MIR129-2 gene can affect the detection efficiency of tumors, and the detection results of the primers designed in different regions are obviously different according to the primers designed in the CG enrichment region of the MIR129-2 gene.

In some embodiments of the present invention, the test sample of the cervical cancer diagnostic reagent or kit is selected from cervical cancer tissue, cervical cancer exfoliated cells, blood, serum or plasma.

In some embodiments of the present invention, the method for using the cervical cancer diagnostic reagent or kit comprises the steps of:

s1, processing a sample to be detected with bisulfite or hydrazine salt to obtain a modified sample to be detected;

and S2, carrying out MIR129-2 gene methylation detection on the modified sample to be detected in the step S1 by using the detection reagent for detecting the methylation of the MIR129-2 gene.

In some embodiments of the present invention, the detecting in step S2 is performed by using methylation specific polymerase chain reaction or real-time fluorescence quantitative methylation specific polymerase chain reaction.

In some embodiments of the invention, the real-time fluorescent quantitative methylation specific polymerase chain reaction amplification procedure is;

according to the embodiment of the invention, at least the following beneficial effects are achieved: the MIR129-2 gene methylation detection reagent prepared by the scheme of the invention has the advantages of short target sequence obtained by amplification, high amplification efficiency, capability of accurately detecting the methylation ratio of 5% under the background of 200ng of DNA, simple and rapid operation, low cost and suitability for clinical detection.

Drawings

The invention is further described with reference to the following figures and examples, in which:

FIG. 1 is a diagram showing PCR amplification of a positive control (ME-180 cell line) in example 3 of the present invention;

FIG. 2 is a diagram showing PCR amplification of a negative control (C-33A cell line) in example 3 of the present invention;

FIG. 3 is a diagram showing PCR amplification of a normal sample in example 3 of the present invention;

FIG. 4 is a PCR amplification chart of a cervical cancer positive sample in example 3 of the present invention;

FIG. 5 is a graph of methylation-fold-ratio dilution amplification against a background of 200ng of DNA in example 4 of the present invention.

Detailed Description

The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments to fully understand the objects, features and effects of the present invention. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and other embodiments obtained by those skilled in the art without inventive efforts are within the protection scope of the present invention based on the embodiments of the present invention.

The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

Example 1 detection reagent for methylation of MIR129-2 Gene

The preparation method of the detection reagent for MIR129-2 gene methylation comprises the following steps: performing biological information analysis and mining on methylation data and gene expression data of cervical Cancer in a Cancer Genome map database (The Cancer Genome Atlas, TCGA), setting 90% of methylation Beta Value of cervical Cancer tissues to be more than 0.5, and setting methylation Beta Value of normal tissues to be less than 0.2 as data primary screening, then selecting sites with large difference in The cervical Cancer tissues and The normal tissues, searching CpG sites with significant difference in methylation level in The cervical Cancer tissues and The normal tissues, and selecting a plurality of methylation sites with significant difference through analysis and screening; the methylation sites of cervical cancer cell strains ME-180, siHa, 15 cervical cancer positive samples and 30 normal population samples are verified by adopting a Sanger sequencing technology after sulfite treatment, and the CpG sites of the MIR129-2 gene in a region chr11:43602805-43602965 are found to be highly methylated in the cervical cancer positive cell strains or the samples, but are unmethylated or are methylated at a small part of the CpG sites in the normal population samples.

The original sequence of region chr11:43602805-43602965 is as follows:

CGCGGAGGGGCGGGCAGCGCGCGGAGTGGTGAGACTGAGCCGCGATGGAACGCG

CTGGGGAGACCCAGCCTGTTCGGCTCCAGGGTTCGGAGACATCCTGGGCTGAAGG CGGCGGCGAACCGAAGAAGCCGGCATATTCTGCCCTTCGCGAATCTTTTTGC(SEQ ID NO:12)。

1. selection of detection regions

Because the methylation state and distribution of the same gene are not uniform, for the same gene, the methylation primers and probe detection systems designed by selecting different regions have different diagnostic detection efficiencies on the same sample of the same tumor, even the selected regions are not suitable for completely having no diagnostic effect on the tumor, after repeated research and comparison, the inventors screened the region chr11:43602805-43602965 of the MIR129-2 gene, and screened the 2 target region sequences (region 1 and region 2) which detect the best methylation of the MIR129-2 gene from the region chr11:43602805-43602965 of the MIR129-2 gene, as shown in Table 1:

TABLE 1

2. Designing primer probe sequences aiming at 2 regions respectively:

the forward primer MIR129-2-MF1, the reverse primer MIR129-2-MR1 and the probe sequence MIR129-2-MP1 are obtained by designing and screening aiming at the region 1, the forward primer MIR129-2-MF2, the reverse primer MIR129-2-MR2 and the probe sequence MIR129-2-MP2 are obtained by designing and screening aiming at the region 2, and the forward primer BS-ACT-F, the reverse primer BS-ACT-R and the probe BS-ACT-P are obtained by designing and screening aiming at the reference gene ACTB, wherein the sequences are shown in the table 2.

TABLE 2

The gDNA of cell line ME-180 (purchased from Shanghai Zhongkojie cell bank in China) and clinical cervical cancer positive exfoliated cells collected from 5 women's health care institutes in Changsha were used as templates (the gDNA adopts the Jinmaige biotechnology)Nucleic acid extraction and purification kit of limited company) and respectively amplifying by adopting primer probe combinations designed aiming at two different areas, wherein the amplification system is as follows: 1 XHieff

12.5. Mu.L of TaqMan m.mu.L of Ltiplex qPCR master mix (purchased from san-assist in Shanghai), 0.2. Mu.M of the final concentration of the primer probes of the target genes (the primer probe combination designed aiming at two different regions), 0.2. Mu.M of the final concentration of the primer probe sets of the internal reference genes, BS-ACT-F, BS-ACT-R and BS-ACT-P, 25ng of gDNA to be detected, and sterile water is added to the total volume of 25. Mu.L. The amplification procedure was: at 95 ℃ for 10min;95 ℃,15sec,60 ℃,1min (fluorescence collected), 45cycles;20 ℃ for 1min. The specific results of the screening test using sterile water as negative reference (NTC) are shown in table 3, and it can be seen from table 3 that the primer probe combination designed for region 2 can also distinguish cervical cancer samples to some extent, but the primer probe combination designed for region 1 has higher sensitivity to positive samples, so it is preferable to subsequently study the primer probe combination designed for region 1 as MIR129-2 gene methylation detection reagent.

TABLE 3

Note: when the FAM channel detection result is NoCt, the delta Ct is more than 9, and the FAM channel is judged to be negative.

Example 2

The embodiment prepares a multiplex fluorescence PCR kit for detecting the methylation of the MIR129-2 gene, which comprises the primer probe sets MIR129-2-MF1, MIR129-2-MR1 and MIR129-2-MP1 prepared in the embodiment 1, the primer probe sets BS-ACT-F, BS-ACT-R and BS-ACT-P of the internal reference gene, a PCR reaction solution, a positive control and a negative control.

The final concentration of the primer probes in the final reaction system was 0.2. Mu.M. The PCR reaction solution of the MIR129-2 gene also comprises: sterile water without enzyme (available from beijing solibao technologies, ltd), 2 × hotspot hitaqq PCR mix (available from guangdong fenpeng bio ltd); wherein the final concentration of the 2 XHotstart HiTaq PCR mix in the final reaction system is 1X; the positive control was the gDNA of cell line ME-180 (purchased from cell bank of China academy of sciences), and the negative control was the gDNA of cell line C-33A (purchased from cell bank of China academy of sciences), both at a concentration of 10 ng/. Mu.L.

Example 3 application of multiplex fluorescent PCR kit in cervical cancer diagnosis

The present example tests the application of the multiplex fluorescence PCR kit prepared in example 2 in cervical cancer diagnosis, and the specific process is as follows:

1 obtaining a biological sample

All samples in the present invention were 126 specimens of exfoliated cervical cells collected during the period of 2021-04-2021-10 months, among which 38 specimens of healthy population, 35 specimens of high-grade squamous intraepithelial lesions (HSIL), 27 specimens of low-grade squamous intraepithelial lesions (LSIL), 22 specimens of cervical cancer CA, and 4 specimens of other cancer species (including 1 specimen of ovarian cancer and 3 specimens of endometrial cancer).

2 sample extraction

The extraction of all cervical exfoliated cells adopts a nucleic acid extraction and purification kit purchased from Jinmaige biotechnology limited, and the specific operation steps are as follows.

(1) Taking 1mL of cervical exfoliated cell preservative fluid into 1.5mL of centrifuge, centrifuging at 16000rpm for 3min, and removing supernatant;

(2) Adding 200 μ L deionized water, adding 300 μ L lysine buffer and 10 μ L protease K, mixing by vortex, and mixing in 55 deg.C water bath for 60min, every 15 min;

(3) Taking out the centrifuge tube, adding 300 mu L Binding buffer and 20 mu L magnetic beads, reversing and uniformly mixing for 10min, and performing instant separation;

(4) Placing the centrifugal tube on a magnetic frame to adsorb magnetic beads in the tube, and discarding liquid in the tube;

(5) Adding 500 μ L Wash buffer I, vortex mixing, placing on magnetic frame for 1min, discarding supernatant, and taking off centrifuge tube;

(6) Adding 500 μ L of Wash buffer II, mixing by vortex, placing on a magnetic frame for 1min, removing supernatant, and taking off the centrifuge tube;

(7) Adding 500 μ L Wash buffer II, mixing by vortex, placing on magnetic frame for 1min, and removing supernatant;

(8) Sucking with a pipette to remove residual supernatant in the tube, adding 50 μ L of precipitation buffer, re-suspending, and performing metal bath at 55 deg.C for 10min while gently shaking;

(9) And (5) placing the sample on a magnetic frame for 1min, and transferring the supernatant to a new centrifugal tube to obtain the sample DNA to be detected.

3, DNA bisulfite conversion and purification;

the Methylation transformation kit adopted is EZ-96DNA Methylation-Gold MagPrep (purchased from Zymo Research Biotech company), the operation is carried out strictly according to the kit operation instruction, and the specific transformation and purification steps are as follows:

1) And (3) adding 20 mu L of the sample DNA to be detected prepared in the step (2) into a 0.2mL PCR8 tube, then adding 130 mu L LCT Conversion Reagent, covering the PCR8 tube and marking, vortexing, shaking uniformly, and performing instantaneous centrifugation.

2) The PCR8 tube was placed in a PCR machine, and the PCR program is shown in Table 4:

TABLE 4

Temperature of	Time
		98℃	10min
64℃	3h
		4℃	Holding

3) A1.5 mL centrifuge tube was prepared and 600. Mu.L of M-Binding Buffer and 10. Mu.L of magnetic bead suspension were added (mixed well by vortexing well before use). Taking out the sample reacted in the step 2) from the PCR instrument, transferring the liquid in the tube to a corresponding 1.5mL centrifuge tube according to the number, uniformly mixing the liquid in the centrifuge tube by vortex for 30s, and standing the liquid at room temperature for 5min.

4) And (5) instantaneous separation, placing on a magnetic frame for adsorption until clarification is achieved, and discarding the supernatant.

5) Add 400. Mu.L M-Wash Buffer (gently shake before use), vortex mix for 30s, and flash-separate. Adsorbing on magnetic frame until it is clear, and discarding the supernatant.

6) Adding 200 μ L M-Des μ L phonation Buffer, vortex mixing for 30s, standing at room temperature for 15min (reverse mixing), instantaneous separating, placing on magnetic frame, adsorbing to clarify, and discarding supernatant.

7) Add 400. Mu.L M-Wash Buffer, vortex and mix for 30s, snap. Adsorbing on magnetic frame until it is clear, and discarding the supernatant.

8) Repeating the step 7) once, and needing to suck and discard residual liquid.

9) Incubate in a metal bath at 55 ℃ for 5min (uncapped) to dryness.

10 Adding 25-60 mu L M-Elution Buffer, suspending magnetic beads, incubating at 55 ℃ for 4min (without opening a cover) in a metal bath, performing instantaneous separation, placing on a magnetic frame for adsorption until the supernatant is clarified, transferring the supernatant into a new 1.5mL centrifuge tube, collecting the supernatant as BS-DNA for subsequent PCR detection, and placing at-80 ℃ if long-term storage is required.

4 PCR detection

The fluorescence quantitative PCR instrument used in the invention is a full-automatic medical PCR analysis system (SLAN-96S) of the macrolite, and the PCR amplification system and the program are as follows:

the PCR amplification system is shown in Table 5.

TABLE 5

The detection on the computer is carried out according to the fluorescent PCR by the instruction, and a PCR program is set.

The PCR reaction procedure is shown in Table 6.

TABLE 6

The results are shown in FIGS. 1 to 4, in which FIG. 1 is a positive control (ME-180 cell line) PCR amplification chart, and FIG. 2 is a negative control (C-33A cell line) PCR amplification chart; FIG. 3 is a diagram of PCR amplification of normal cervical cells; FIG. 4 is the PCR amplification diagram of the cervical cancer cell, and it can be seen from the diagram that the Ct of the reference gene ACTB is less than or equal to 34 and the delta Ct is less than or equal to 3 in the positive control and the cervical cancer cell, which are positive. And the Ct is less than or equal to 34 and the delta Ct is more than 3 in the negative control and normal cervical tissues, and the negative control and the normal cervical tissues are negative.

5 interpretation of results

Threshold value demarcation: both FAM and HEX thresholds were defined as 0.12.

The results (Δ Ct = FAMCt-HEXCt) are shown in table 7.

TABLE 7

6 methylation detection distribution condition of cervical cancer sample and normal sample in MIR129-2 gene

Cervical cancer samples and normal samples were tested using the above method and primer probe set, and the results are shown in table 8. The results showed that methylation of MIR129-2 gene was not detected in 38 normal human samples, 21 in 22 cervical cancer samples, and 1 undetected cervical cancer sample was cervical adenocarcinoma (stomach type, HPV-unrelated type). Meanwhile, the methylation ratio of the MIR129-2 gene is increased along with the progression of cervical cancer, the sensitivity of the MIR129-2 gene on the HSIL level is 57.14%, the specificity of the MIR129-2 gene on the HSIL level is 97.1%, and a useful guide can be provided for clinical cervical cancer early screening.

TABLE 8 statistical results of MIR129-2 methylation detection in cervical cancer samples and normal sample groups

Example 4 sensitivity testing

The kit is adopted to detect the methylation rates with different proportions in the background of 200ng DNA, and the methylation sensitivity of the kit in the background of 200ng DNA is evaluated.

The invention selects the cell line ME-180 as 100% methylation sample, and the cell line C-33A as 0% methylation sample. Both cell lines were purchased from the cell bank of the Chinese Shanghai national academy of sciences. The procedure for DNA extraction from the cell lines was as in example 3, and the DNA concentration was determined by a Qubit 2.0 fluorescence quantifier (from Thermofeisher Scientific). ME-180 and C-33A were diluted to a concentration of 10 ng/. Mu.L and then diluted in multiple ratios to different methylation ratio references, the specific methylation ratio reference formulations are shown in Table 9.

TABLE 9

The procedure for bisulfite conversion of DNA, a reference sample for methylation ratios in various ratios was the same as in step 3 of example 3, and the amount of DNA added was 200ng of DNA.

The transformed BS-DNA was used as a template, and PCR was performed according to step 4 of example 3, and the amplification results are shown in FIG. 5. The results were analyzed and interpreted by the result interpretation method in reference to example 3, and the specific test results are shown in table 10. As can be seen from Table 10, the kit of the present invention can accurately detect the methylation rate of 0.5% against a background of 200ng of DNA.

TABLE 10 detection Ct values and interpretation of different methylation ratio references

Reference methylation ratio	HEX Ct	FAM Ct	△Ct	Interpretation
						50% methylation	32.52	30.58	-1.94	Positive for
10% methylation	32.42	32.79	0.37	Positive for
					5% methylation	32.25	33.86	1.61	Positive for
1% methylation	32.12	36.15	4.03	Negative of
					0.5% methylation	32.02	37.22	5.2	Negative of
0.1% methylation	32.08	39.45	7.37	Negative of

Note: when the detection result of the FAM channel is NoCt, the delta Ct is more than 3, and the FAM channel is judged to be negative.

The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and features of the embodiments may be combined with each other without conflict.

Sequence listing

<110> people and future Biotechnology (Changsha) Limited

<120> MIR129-2 gene methylation detection reagent and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggagtggtga gattgagtcg c 21

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaatatacc gacttcttcg attcg 25

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccgccgcctt caacccaaaa tatc 24

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttcgcgaagg gtagaatatg tc 22

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aacctattcg actccaaaat tcg 23

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcggttcgtc gtcgttttta gtttaggatg 30

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gagagaatta gtgagaaagg gtgtag 26

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aataacccaa ataaataacc cactacctc 29

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctaataacc acctccctcc ttcctaacct c 31

<210> 10

<211> 118

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggagtggtga gattgagtcg cgatggaacg cgttggggag atttagtttg ttcggtttta 60

gggttcggag atattttggg ttgaaggcgg cggcgaatcg aagaagtcgg tatatttt 118

<210> 11

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttcgcgaagg gtagaatatg tcggtttttt cggttcgtcg tcgtttttag tttaggatgt 60

tttcgaattt tggagtcgaa taggtt 86

<210> 12

<211> 161

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgcggagggg cgggcagcgc gcggagtggt gagactgagc cgcgatggaa cgcgctgggg 60

agacccagcc tgttcggctc cagggttcgg agacatcctg ggctgaaggc ggcggcgaac 120

cgaagaagcc ggcatattct gcccttcgcg aatctttttg c 161

Claims

1. A reagent for detecting the methylation of the MIR129-2 gene, which is characterized in that the reagent for detecting the methylation of the MIR129-2 gene comprises: a forward primer with a sequence shown as SEQ ID NO. 1 and a reverse primer with a sequence shown as SEQ ID NO. 2; and/or a forward primer with a sequence shown as SEQ ID NO. 4 and a reverse primer with a sequence shown as SEQ ID NO. 5.

2. The MIR129-2 gene methylation detection reagent of claim 1, wherein the MIR129-2 gene methylation detection reagent further comprises a fluorescent probe sequence having a nucleotide sequence shown as SEQ ID NO. 3 and/or SEQ ID NO. 6.

3. The MIR129-2 gene methylation detection reagent of claim 1, wherein the MIR129-2 gene methylation detection reagent further comprises a detection reagent for an internal reference gene; preferably, the internal reference gene is ACTB or GAPDH; more preferably, the detection reagent for the reference gene comprises a primer and a probe aiming at the reference gene.

4. The MIR129-2 gene methylation detection reagent of claim 1, wherein the detection sample of the MIR129-2 gene methylation detection reagent is selected from cervical cancer tissues, cervical cancer exfoliated cells, blood, serum or plasma.

5. A kit comprising the MIR129-2 gene methylation detection reagent of any one of claims 1-4.

6. The kit of claim 5, further comprising a positive control selected from one of gDNAs of SiHa cell line, caski cell line and ME-180 cell line, and a negative control that is gDNA of C-33A cell line.

7. Use of the MIR129-2 gene methylation detection reagent of any one of claims 1-4 or the kit of any one of claims 5-6 for the preparation of a cervical cancer diagnostic reagent or kit.

8. The use according to claim 7, wherein the cervical cancer diagnostic reagent or kit is used for detecting the sequence of the MIR129-2 gene modified by a transformation reagent; preferably, the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulfite; more preferably, the conversion reagent is bisulfite.

9. The use according to claim 7, wherein the cervical cancer diagnostic reagent or the kit is directed to a detection region of the MIR129-2 gene, which is the MIR129-2 gene or a promoter region thereof; preferably, the detection region of the MIR129-2 gene methylation detection reagent aiming at the MIR129-2 gene is a sequence shown as SEQ ID NO. 10 or SEQ ID NO. 11.

10. The use according to claim 7, wherein the method for using the cervical cancer diagnostic reagent or kit comprises the following steps:

s2, carrying out MIR129-2 gene methylation detection on the modified sample to be detected in the step S1 by using the MIR129-2 gene methylation detection reagent in any one of claims 1 to 4 or the kit in any one of claims 5 to 6.