CN115961089A

CN115961089A - Primer and kit for detecting human parvovirus B19

Info

Publication number: CN115961089A
Application number: CN202111602766.3A
Authority: CN
Inventors: 刘白朵; 徐中友; 邓明文; 张健
Original assignee: Shanghai Kehua Bio Engineering Co ltd
Current assignee: Shanghai Kehua Bio Engineering Co ltd
Priority date: 2021-12-24
Filing date: 2021-12-24
Publication date: 2023-04-14

Abstract

The invention provides a fluorescent PCR detection primer for detecting human parvovirus B19 and a kit thereof, which comprises an upstream primer sequence for detecting human parvovirus target nucleic acid, wherein the upstream primer sequence is shown as SEQ ID NO. 1; the sequence of the downstream primer is shown as SEQ ID NO. 2; a probe sequence for detecting human parvovirus target nucleic acid, which is shown as SEQ ID NO. 3; the upstream primer sequence of the internal standard is shown as SEQ ID NO. 4; the internal standard downstream primer sequence is shown as SEQ ID NO. 5; the probe sequence of the internal standard is shown as SEQ ID NO. 6. The primer and the probe designed by the invention have high sensitivity and good specificity; the kit is simple to operate, the whole process only needs less than 2 hours, and the internal standard participates in the whole process monitoring.

Description

Primer and kit for detecting human parvovirus B19

Technical Field

The invention belongs to the field of molecular biology, and relates to a detection reagent, in particular to a primer, a probe and a kit for detecting human parvovirus B19.

Background

Human parvovirus B19 (parvorivirus B19, abbreviated as B19 virus) belongs to the family of parvoviridae (Parvoviridaemialy), the genus erythrovirus (Erythrovirusgenus), is a single-stranded linear DNA virus without an envelope. Can be divided into three genotypes of 1, 2 and 3, wherein the 1 type and the 3 type are respectively divided into two subtypes. B19 viral infections are ubiquitous in the human population, can be transmitted through the respiratory tract, blood, placenta, etc., and can occur in various age groups, particularly in pregnant women and children. Susceptible populations also include those with immune deficiency or insufficiency, as well as those with anemia. Erythema infectivity is most frequently induced after childhood infection; the infection of people with normal immunity is generally a light self-limiting symptom; infection in pregnant women can cause fetal edema and anemia, and in severe cases, death of the fetus; infections in patients with innate immunodeficiency, acquired immunodeficiency, patients undergoing chemotherapy after tumor or organ transplant surgery can lead to chronic anemia; acute anemia is caused by a transient aplastic crisis generated when a patient suffering from blood system diseases such as sickle cell anemia is infected; some of the infected patients develop symptoms such as joint pain, which then progresses to polyarthritis.

The diagnosis and detection of the B19 virus mainly comprise two types of serological detection and virus nucleic acid detection.

The B19 serological detection is the main method for clinical auxiliary diagnosis and epidemiological investigation and research of B19 virus infection at present, and the virus nucleic acid detection can provide further auxiliary diagnosis. For example, in immunodeficient patients, detection of B19 viral DNA is often required to aid diagnosis due to insufficient antibody production; for pregnant women, serological antibody detection is usually combined with viral DNA levels. The B19 virus nucleic acid detection mainly comprises a dot hybridization method, a Polymerase Chain Reaction (PCR) method and an In situ hybridization method (In hybridization). Wherein, the dot hybridization method is gradually replaced by a sensitive PCR method as an initial B19 virus nucleic acid detection method; the PCR method comprises a common PCR method and a more sensitive nested PCR method and a fluorescent quantitative PCR method (qPCR), wherein the latter two methods are the most commonly used B19 virus nucleic acid detection methods at present and are commonly applied to virus typing detection and large-scale screening of B19 viruses in blood.

The B19 detection adopts a PCR-based method, and has the advantages of high sensitivity, high accuracy and the like. The B19 DNA is directly detected by a fluorescence PCR method, the accuracy of B19 infection is greatly improved, and the kit can be used for early diagnosis and can also be used for curative effect evaluation.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides a fluorescent PCR primer for detecting human parvovirus B19 and a kit thereof, and the fluorescent PCR primer for detecting human parvovirus B19 and the kit thereof aim to solve the technical problems of long time and low sensitivity of the method for detecting human parvovirus B19 in the prior art.

The invention provides a fluorescent PCR detection primer for detecting human parvovirus B19, which comprises the following components:

an upstream primer sequence for detecting a human parvovirus B19 target nucleic acid is shown as SEQ ID NO. 1;

a downstream primer sequence for detecting a human parvovirus B19 target nucleic acid, which is shown as SEQ ID NO. 2;

the probe sequence for detecting the target nucleic acid of the human parvovirus B19 is shown as SEQ ID NO. 3.

The invention also provides a fluorescent PCR detection kit for detecting human parvovirus B19, which comprises:

a probe sequence for detecting a human parvovirus B19 target nucleic acid, which is shown as SEQ ID NO. 3;

the upstream primer sequence of the internal standard is shown as SEQ ID NO. 4;

the internal standard downstream primer sequence is shown as SEQ ID NO. 5;

the probe sequence of the internal standard is shown as SEQ ID NO. 6.

Further, the kit also comprises an internal standard, wherein the sequence of the internal standard is shown as SEQ ID No. 7.

The invention also provides a method for detecting HCV concentration by using the reagent, which comprises the following steps:

1) A step of preparing a PCR reaction solution: contains 0.05U/ul-0.1U/ul DNA polymerase, 1.5mM-5mM Mg ²⁺ 0.1mM-0.5mM dNTP,10 XPCR buffer,0.1uM-0.4uM upstream primer B19-F for amplifying target B19 nucleic acid, and the sequence is shown as SEQ ID NO. 1; 0.1uM-0.4uM of downstream primer B19-R for amplifying target B19 nucleic acid, and the sequence of the downstream primer B19-R is shown in SEQ ID NO. 2; 0.1uM-0.2uM probe B19-P for amplifying target B19 nucleic acid, the sequence of which is shown in SEQ ID NO. 3; 0.1uM-0.4uM upstream primer IC-F for amplifying internal standard, the sequence of which is shown in SEQ ID NO. 4; 0.1uM-0.4uM downstream primer IC-R for internal amplification standard, the sequence of which is shown in SEQ ID NO. 5; 0.1uM-0.2uM probe IC-P for amplifying internal standard, the sequence of which is shown in SEQ ID NO. 6; mixing, and centrifuging instantly;

2) Adding a certain amount of internal standard reference substances into the lysis solution of the extraction reagent in proportion, taking part in extraction together with the sample, and taking the extracted nucleic acid as a template for later use; the sequence of the internal standard is shown as SEQ ID No. 7;

3) And (3) fluorescent PCR reaction: adding the extracted nucleic acid DNA into the prepared PCR reaction solution in proportion, adding a PCR reaction tube into an amplification instrument, setting the name of a sample to be detected according to a corresponding sample, selecting FAM and ROX channels as a fluorescence channel, and setting NONE as reference fluorescence;

the reaction parameters were as follows:

25℃,5min；50℃，25min；95℃，2min；

5×(95℃，15S；55℃，20S；72℃，20S；)

40 × (95 ℃,10S, 60 ℃,45S; fluorescence collection;)

4) After the reaction, the initial value, the end value, and the threshold line of the baseline were adjusted, and then analyzed.

According to the invention, through sequence comparison, specific primers and probes are designed according to a B19 virus structural protein VP1 gene sequence, and detection is carried out through fluorescence PCR amplification.

Compared with the prior art, the invention has remarkable technical progress. The primer and the probe designed by the invention have high sensitivity and good specificity; the kit is simple to operate, only needs less than 2 hours in the whole process, and the internal standard participates in the whole-process monitoring.

Drawings

Figure 1 shows test one: amplification curve of primer probe set 1B 19.

Figure 2 shows test one: amplification curve for primer probe set 2B 19.

Figure 3 shows trial one: amplification curve of primer probe set 3B 19.

Figure 4 shows run two: target amplification curves with internal standards.

Figure 5 shows run two: target amplification curves without internal standard.

FIG. 6 shows a B19 gradient dilution amplification curve.

FIG. 7 shows an internal standard amplification curve.

FIG. 8 shows 50IU/mL.

Fig. 9 shows a clinical negative sample.

Detailed Description

Example 1

According to the invention, through comparing sequences of different genotypes of the B19 virus, a plurality of primers and probes are designed, through comparing amplification effects of different primer probes, a pair of specific primer probe sets capable of efficiently amplifying the B19 virus is screened out, and meanwhile, through designing a specific internal standard sequence, an internal standard primer probe set which is not interfered with a target B19 virus is selected out.

The invention provides a primer, a probe and a kit for detecting human parvovirus B19, which comprise the following components:

the upstream primer B19-F for detecting the target nucleic acid has a sequence shown in SEQ ID No.1, and the sequence is as follows: 5't gaagacttacacaagcctggg-3';

the downstream primer B19-R for detecting the target nucleic acid has a sequence shown in SEQ ID No.2, and the sequence is as follows: 5 'ccagcttggtagctcattgcc-3';

a probe B19-P for detecting a target nucleic acid, having the sequence of SEQ ID No.3, being: 5 'aggcccacacatagagtttaccgggtag-3';

preferably, the carboxyl terminal of the SEQ ID No.3 sequence is marked by FAM, and the hydroxyl terminal is modified by BHQ1 quenching group.

The upstream primer IC-F for the internal amplification standard has a sequence of SEQ ID No.4, and the sequence is as follows: 5 'calciggacaaggagtctgtc-3'; the downstream primer IC-R has a sequence of SEQ ID No.5 and is: 5 'cgtcaggatcggttgtttgatt-3';

probe IC-P for amplification of internal standard having the sequence: 5 'aatgcgagttgggtgttcaaacccgt-3';

preferably, the carboxyl terminal of the sequence of SEQ ID No.6 is marked by ROX, and the hydroxyl terminal is modified by BHQ2 quenching group.

PCR reaction solution: contains 0.05U/ul-0.1U/ul DNA polymerase, 1.5mM-5mM Mg ²⁺ 0.1mM-0.5mM dNTP,10 XPCR buffer.

Preferably, the reagent of the present invention further comprises an internal standard (internal control), the internal control adopted in the present invention is a artificially synthesized pseudovirus, and the internal control is used as the internal standard in a PCR amplification system to prevent false negative caused by PCR interfering substances possibly existing in a sample.

The sequence is specifically as follows:

gctaggatgttggcgtaatgattttaaaccacccgtcttgaaacacggaccaaggagtctattgccaatgcgagtgtttgggtgtcaaacccgtacgcgtaatgaaagtgaacgtagattggggccctttgggtgcacaatcgaccgatcctgacgttttctaatggatttgagtaagagcattgttgatgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaagctcgtagcggttctgacgtgcaaatcga；(SEQ ID No.7)。

preferably, the reagent of the invention further comprises a human parvovirus positive control which is derived from pseudovirus containing a B19 target gene segment and diluted by negative plasma; and a negative control: inactivated negative plasma without human parvovirus.

Example 2

The operation steps for detecting B19 DNA in unknown samples such as serum, plasma and the like are as follows:

1) Preparing a PCR reaction solution: contains 0.05U/ul-0.1U/ul DNA polymerase, 1.5mM-5mM Mg ²⁺ 0.1mM-0.5mM dNTP,10 XPCR buffer,0.1uM-0.4uM upstream primer B19-F and downstream primer B19-R for amplifying target B19 nucleic acid, 0.1uM-0.2uM probe B19-P for amplifying target B19 nucleic acid, 0.1uM-0.2uM4uM upstream primer IC-F and downstream primer IC-R for internal standard amplification, 0.1uM-0.2uM probe IC-P for internal standard amplification. Mixing, and centrifuging instantly.

2) And adding a certain amount of internal standard reference substances into the lysis solution of the extraction reagent in proportion, and taking part in extraction together with the sample. The extracted nucleic acid is used as a template for standby.

3) And (3) fluorescent PCR reaction: adding the extracted nucleic acid DNA into the prepared PCR reaction solution in proportion, adding the PCR reaction tube into an amplification instrument, and setting the name of the sample to be detected according to the corresponding sample. The fluorescence channel is selected from FAM and ROX channel,

the reference fluorescence was set to NONE.

The reaction parameters were as follows:

25℃,5min；50℃，25min；95℃，2min；

5×(95℃，15S；55℃，20S；72℃，20S；)

40 × (95 ℃,10S, 60 ℃,45S; fluorescence collection;)

5) The specific scheme is as follows:

the formula is as follows:

	concentration of
		10×PCRbuffer	3uL
Mg ²⁺	3mM
		dNTP	0.2mM
DNA polymerase	0.05U/ul
		IC-F	0.2uM
IC-R	0.2uM
		IC-P	0.1uM
B19-F	0.2uM
		B19-R	0.2uM
B19-P	0.1uM

Shaking, mixing, and packaging into 8-96-well plates.

6) Test I, B19 primer Probe screening analysis of the parvovirus fluorescent PCR detection method of the present invention

Respectively detecting four gradient samples of 1.00E + O5IU/mL, 1.00E + O4IU/mL, 1.00E + O3IU/mL, 1.00E + O2IU/mL and negative plasma diluted by the designed B19 primer probe set 1, set 2 and set 3 by adopting the reaction liquid system; comparing the detection effect of different primer probes on the sample, the result is shown in figure 1, figure 2 and figure 3, and the screened group 3 of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 is the preferred group.

7) Experiment II, internal standard analysis of parvovirus fluorescence PCR detection method of the present inventors

Adding the designed internal standard primer probe group into a reaction system of a target B19, comparing and analyzing with a target B19 control group without an internal standard, and respectively diluting negative plasma for detection to 50IU/mL; the detection effect of B19 target with and without internal standard was compared. The detection results are shown in fig. 4 and fig. 5, and it can be seen that the added internal standard basically has no interference to the target, and can be detected by 100%.

6) Third, the sensitivity analysis of the parvovirus fluorescence PCR detection method of the present inventors

B19 pseudovirus after value fixing is sequentially diluted to 1.00E + O7IU/mL, 1.00E + O6IU/mL, 1.00E + O5IU/mL, 1.00E + O4IU/mL, 1.00E + O3IU/mL, 1.00E + O2IU/mL and 50IU/mL by adopting negative plasma; PCR amplification assay was performed as described in example 1. As shown in FIGS. 6, 7 and 8, the lowest detectable concentration was 50IU/mL, indicating that the method had high sensitivity.

7) Fourth, the specificity detection of the parvovirus fluorescence PCR detection method of the present invention

The kit provided by the invention is used for detecting a negative sample of clinical detection, and the detection results are negative. The results are shown in FIG. 9.

The invention provides a primer, a probe and a kit for detecting human parvovirus B19, and the primer, the probe and the kit designed by the patent have higher sensitivity and specificity.

The above embodiments are not intended to limit the present invention, and the present invention is not limited to the above embodiments, and all embodiments are within the scope of the present invention as long as they meet the requirements of the present invention.

Sequence listing

<110> Shanghai Kowa bioengineering GmbH

<120> fluorescent PCR detection primer for detecting human parvovirus B19 and kit thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgaagactta cacaagcctg gg 22

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccagcttgta gctcattgcc 20

<210> 3

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Aggcccaaca tagttagtac cgggtag 27

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cacggaccaa ggagtctatt gc 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtcaggatc ggtcgattgt 20

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aatgcgagtg tttgggtgtc aaacccgt 28

<210> 7

<211> 281

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctaggatgt tggcgtaatg attttaaacc acccgtcttg aaacacggac caaggagtct 60

attgccaatg cgagtgtttg ggtgtcaaac ccgtacgcgt aatgaaagtg aacgtagatt 120

ggggcccttt gggtgcacaa tcgaccgatc ctgacgtttt ctaatggatt tgagtaagag 180

cattgttgat gggacccgaa agatggtgaa ctatgcctga atagggtgaa gccagaggaa 240

actctggtgg aagctcgtag cggttctgac gtgcaaatcg a 281

Claims

1. A fluorescent PCR detection primer for detecting human parvovirus B19 is characterized by comprising the following components:

the probe sequence for detecting the human parvovirus B19 target nucleic acid is shown as SEQ ID NO. 3.

2. A fluorescent PCR detection kit for detecting human parvovirus B19, characterized in that the kit comprises:

the upstream primer sequence of the internal standard is shown as SEQ ID NO. 4;

the internal standard downstream primer sequence is shown as SEQ ID NO. 5;

the probe sequence of the internal standard is shown as SEQ ID NO. 6.

3. The kit of claim 2, wherein: also comprises a PCR reaction solution, wherein the PCR reaction solution contains 0.05U/ul-0.1U/ul DNA polymerase and 1.5mM-5mM Mg ²⁺ 0.1mM-0.5mM dNTP,10 XPCR buffer; a positive control and a negative control.

4. The kit of claim 2, wherein: the kit also comprises an internal standard, and the sequence of the internal standard is shown as SEQ ID No. 7.

5. The method for detecting human parvovirus B19 using the kit of claim 2, comprising the steps of:

1) A step of preparing a B19 reaction solution: contains 0.05U/ul-0.1U/ul DNA polymerase, 1.5mM-5mM Mg ² ⁺ 0.1mM-0.5mM dNTP,10 XPCR buffer,0.1uM-0.4uM upstream primer B19-F for amplifying target B19 nucleic acid, the sequence of which is shown in SEQ ID NO. 1; 0.1uM-0.4uM downstream primer B19-R for amplifying target B19 nucleic acid, and the sequence thereof is shown in SEQ ID NO. 2; 0.1uM-0.2uM probe B19-P for amplifying target B19 nucleic acid, the sequence of which is shown in SEQ ID NO. 3; 0.1uM-0.4uM upstream primer IC-F for amplifying internal standard, the sequence of which is shown in SEQ ID NO. 4; 0.1uM-0.4uM downstream primer IC-R for internal amplification standard, the sequence of which is shown in SEQ ID NO. 5; 0.1uM-0.2uM probe IC-P for amplifying internal standard, the sequence of which is shown in SEQ ID NO. 6; fully mixing the components uniformly, and performing instantaneous centrifugation for later use;

2) A certain amount of internal standard reference substance; proportionally adding the extract into a lysis solution of an extraction reagent, and taking part in extraction together with a sample, and taking the extracted nucleic acid as a template for later use; the sequence of the internal standard is shown as SEQ ID No. 7.

3) And (3) fluorescent PCR reaction: adding the extracted nucleic acid RNA into the prepared PCR reaction solution in proportion, adding a PCR reaction tube into an amplification instrument, setting the name of a sample to be detected and the concentration of an internal standard reference substance according to a corresponding sample, selecting FAM, HEX or VIC channels as fluorescence channels, and setting the reference fluorescence as NONE;

the reaction parameters were as follows:

25℃,5min；50℃，25min；95℃，2min；

5×(95℃，15S；55℃，20S；72℃，20S；)

40 × (95 ℃,10S, 60 ℃,45S; fluorescence collection;)

4) After the reaction was completed, the initial value, the final value, and the threshold line of the baseline were adjusted and analyzed.