CN111235238A

CN111235238A - DNA methylation detection method and related application

Info

Publication number: CN111235238A
Application number: CN202010118248.3A
Authority: CN
Inventors: 于浩洋; 梁宁; 吕禾
Original assignee: Shenzhen Genebiohealth Co ltd
Current assignee: Shenzhen Genebiohealth Co ltd
Priority date: 2018-09-14
Filing date: 2018-09-14
Publication date: 2020-06-05
Also published as: CN109929919A; CN109929919B

Abstract

The present disclosure provides methods, reagents, kits and related applications for DNA methylation detection, and further provides methods, nucleic acids, kits and applications for detecting methylation of RNF180 gene or Reprimo gene, which methods, nucleic acids, kits and the like can be used for cancer diagnosis and/or prognosis.

Description

DNA methylation detection method and related application

The application is a divisional application of patent applications with application numbers of 201811074552.1, application dates of 2018, 9 and 14, and the name of the invention is 'DNA methylation detection method and related application'.

Technical Field

The present disclosure belongs to the field of biotechnology, and relates to in vitro diagnostic technology. In particular, the present disclosure relates to methods, reagents, kits and related uses for DNA methylation detection, to methods, products (including reagents, kits) for cancer diagnosis and/or prognosis.

Background

Malignant tumors are a serious disease threatening human life and health. Although tumor treatment has advanced sufficiently, the high mortality rate has not been effectively controlled. According to the national cancer statistical data of the latest stage of the national cancer center (the registration data of malignant tumors in 2014 of the national 31 provincial municipality and municipality tumor registration center collected and summarized by the national cancer registration center in 2017), the number of new cases of the national malignant tumors is 380.4 ten thousands, the normalized incidence rate is 174.0/10 ten thousands, and the average level is slightly lower than the average level in the world of 182.3/10 thousands. However, the incidence of Chinese cancer accounts for about 22% of the world, and the incidence is the first worldwide. The cancer death cases in China exceed 200 ten thousand, account for about 27 percent of the whole world, and the normalized mortality rate is 122.2/10 ten thousand, which is higher than the average level in the world of 102.4/10 ten thousand. Due to lack of early screening of cancer and late time of treatment, the 5-year survival rate of Chinese cancer is only 30.9%, while more than 70% of the cancer is common in developed countries.

Taking gastric cancer as an example, about 68 ten thousand new gastric cancer cases and about 49.8 ten thousand death cases are newly added in China every year; the number of the attack accounts for about 50% of the number of new cases in the world. The 5-year survival rate of the gastric cancer patients is closely related to the intervention period, the 5-year survival rate of the gastric cancer patients in the middle and late stages is lower than 15 percent, and the 5-year survival rate of the gastric cancer patients in the early stages exceeds 90 percent. Therefore, the early diagnosis and screening level of the gastric cancer is improved, and the method has important significance for controlling the growth of gastric cancer population, prolonging the life cycle of patients and improving the life quality. At present, endoscopic (gastroscope) -based imaging examinations are widely used in clinical and physical examinations. By combining with slice pathological analysis, the change of the mucosa of early gastric cancer can be found by gastroscopy, but the problems that IIb type early gastric cancer is difficult to find, the success rate of accurate biopsy material taking is unstable, the misdiagnosis risk is caused and the like still exist. Furthermore, gastroscopy compliance is poor, and 70% of the examinees are afraid of gastroscopy because of fear, tension and anxiety caused by invasion. Upper gastrointestinal damage and cross-contamination due to poor operator experience or improper equipment cleaning has also been reported. Other image examination means such as X-ray or CT scanning are mostly applied to preoperative evaluation and surgical scheme making, and the early diagnosis significance is limited. The detection of protein molecular markers, such as CEA and CA19-9, etc., has low specificity to gastric cancer, and is generally used as a prognostic monitoring index. In conclusion, the development of a novel gastric cancer early diagnosis technology realizes early, sensitive and specific diagnosis of gastric cancer, and has great significance.

In recent years, studies have found that there is an abnormal level of gene methylation in DNA isolated from the plasma of tumor patients; gene methylation may be an important molecular feature in tumorigenesis and tumor development.

Ring finger protein 180 (RNF 180) has effects of inhibiting cell proliferation and inducing apoptosis, and is involved in lymphatic metastasis of gastric cancer. In recent years, researches show that the methylation state of CpG sites in the promoter sequence of RNF180 gene is closely related to the occurrence, the course and the prognosis of gastric cancer. Some researches suggest that the RNF180 gene methylation detection may have the application value of molecular diagnosis in vitro of gastric cancer.

Rerimo is a glycosylated cytoplasmic protein that acts as a downstream effector of p53, causing a block in the G2/M phase of the cell cycle, and has the effect of inhibiting cell proliferation. It is reported that in gastric cancer, replimo acts as a cancer suppressor gene, and its expression is deleted in some samples due to abnormal methylation state of the promoter region. Research suggests that replimo or its methylation may have potential application in gastric cancer diagnosis.

Conventional methylation detection includes methylation specific PCR (msp), methylation specific fluorescence PCR (methylight), and bisulfite sequencing.

Methylation Specific PCR (MSP) and methylation specific fluorescence PCR (methylight) are both performed by sulfite treatment of sample DNA to convert unmethylated cytosine to thymine while retaining methylated cytosine; and then carrying out PCR (polymerase chain reaction) matched with agar gel electrophoresis by using methylation/non-methylation specific primers and then developing or detecting the methylation degree in the DNA of the sample by using a fluorescence PCR luminescence method.

Sulfite sequencing also first sulfite the sample DNA and PCR amplification with the universal primer (containing no CpG island and thus capable of amplifying both methylated and unmethylated templates); and sequencing the amplified product, and identifying the methylation sites and the degree in the sample DNA according to the difference between the methylation sequence and the non-methylation sequence.

However, the bisulfite sequencing method has high cost, low flux and complex operation, and is not suitable for being widely applied to early diagnosis and screening. Methylation-specific PCR (msp) and methylation-specific fluorescence PCR (methylight) are always deficient in primer specificity, methylated primers also have a certain probability of amplifying unmethylated templates by mismatch: theoretically, a single primer will contain no more than 3 CpG sequences, and thus a primer pair of an unmethylated template will have no more than 6 base sites that match methylated primers. The methylation detection sample is a mixture of methylated template and unmethylated template, and the unmethylated template usually accounts for more than 90% of the total template amount, so that MSP and methylight have the defect of false positive. Therefore, it is important to specifically exclude the mismatch of methylated primers to unmethylated templates in practical measurement.

The invention content is as follows:

in order to solve the technical problems in the prior art, the present inventors have conducted a great deal of research and provide the following technical solutions.

1. A method for detecting DNA methylation, the method comprising:

(1) treating a portion of the DNA sample with a methylation sensitive restriction endonuclease, and

(2) amplifying a sequence containing at least one segment of sequence recognized by the enzyme in the DNA to be detected for the DNA sample treated by the enzyme and the DNA sample not treated by the enzyme,

and determining the methylation condition of the gene according to the amplification result of the DNA sample subjected to the enzyme treatment and the amplification result of the DNA sample not subjected to the enzyme treatment.

2. A DNA methylation detection kit, wherein the kit comprises: methylation sensitive restriction endonucleases and reagents for DNA amplification.

3. Use of a methylation sensitive restriction enzyme in the preparation of a DNA methylation detection kit, wherein the kit comprises reagents for DNA amplification.

4. The kit or use according to item 2 or 3, wherein the reagents include reagents for amplifying and/or detecting a sequence in the DNA to be detected comprising at least one sequence recognized by the enzyme, such as amplification primers and/or detection probes.

5. The method, kit or use according to any one of claims 1-4, wherein the enzyme specifically cleaves unmethylated sequences or cleaves methylated sequences.

6. The method, kit or use according to any one of items 1-5, wherein the enzyme specifically cleaves unmethylated sequences, preferably the enzyme is a methylation sensitive restriction enzyme selected from CpG-containing enzymes in the enzyme recognition sequence, more preferably one or more enzymes selected from BstUI enzyme, HpaII enzyme and HhaI enzyme.

7. The method, kit or use according to any of claims 1-5, wherein the enzyme specifically cleaves methylation sequences, preferably the enzyme is a methylation specific restriction enzyme selected from the group consisting of CpG-containing methylation specific restriction enzymes in the enzyme recognition sequence, more preferably McrBC.

8. The method, kit or use according to any one of claims 4 to 7, wherein the upstream and/or downstream amplification primers and/or detection probes used contain a sequence recognized by the enzyme.

9. A method, kit or use according to any one of claims 1 to 8 for the diagnosis and/or prognosis of cancer; the cancer is preferably one or more selected from the group consisting of gastric cancer, colorectal cancer, breast cancer, liver cancer, lung cancer, cervical cancer, and head and neck cancer, more preferably gastric cancer.

10. The method, kit or use according to any one of claims 1-9, wherein the DNA to be tested is the RNF180 gene, preferably the amplified RNF180 gene comprises a sequence selected from SEQ ID NOs 1-3, or amplifies a sequence selected from SEQ ID NOs 1-3.

11. The method, kit or use according to item 10, wherein the amplification primers and/or probes comprise or are a sequence selected from SEQ ID NOs 4-6.

12. The method, kit or use according to any one of items 1-9, wherein the DNA to be tested is a replimo gene, preferably comprising a sequence selected from SEQ ID NOs 7-9 in the amplified replimo gene, or amplifying a sequence selected from SEQ ID NOs 7-9.

13. The method, kit or use according to claim 12, wherein the amplification primers and/or probes comprise or are a sequence selected from SEQ ID NOs 10-12.

14. A method of DNA methylation detection, the method comprising: performing transformation treatment on the DNA sample, and amplifying by using the DNA after the transformation treatment as a template, wherein the method further comprises the following steps:

(1) ALU-C4 was used as an internal reference gene; and/or

(2) Adding a blocking agent when carrying out DNA amplification,

wherein the blocking agent is or comprises a sequence complementary to a sequence of a DNA to be detected after conversion treatment of a continuous unmethylated sequence, and the 3' end group of the blocking agent prevents the blocking agent from being extended during DNA amplification, wherein the continuous unmethylated sequence:

(i) is or comprises a region to which an amplification primer is directed or a fragment thereof, wherein the fragment comprises most or all of the methylation sites to be detected in the region, or

(ii) Is or comprises the region to which the detection probe is directed or a fragment thereof, wherein said fragment comprises most or all of the methylation sites to be detected in said region, or

(iii) Comprises a region or fragment thereof to which an upstream or downstream primer is directed and a region or fragment thereof to which a detection probe is directed, and covers at least 35% of the sum of the sequences of both the region to which the upstream or downstream primer is directed and the region to which the probe is directed, wherein the fragment comprises at least one methylation site in the region to be detected;

wherein the conversion treatment is preferably performed with a reagent comprising bisulfite and/or bisulfite.

15. A DNA methylation detection kit, wherein the kit comprises a reagent for conversion treatment of a DNA to be detected and/or a reagent for DNA amplification and/or detection, and

(1) reagents for detecting reference gene ALU-C4, and/or

(2) A blocking agent which is used as a carrier for the emulsion,

wherein the blocking agent is or comprises a complementary sequence of a continuous non-methylated sequence in a DNA to be detected after conversion treatment, and the 3' end group of the blocking agent prevents the blocking agent from being extended during DNA amplification,

wherein the contiguous unmethylated sequence:

Use of (1) a reagent for detecting the internal reference gene ALU-C4 and/or (2) a blocker for the preparation of a DNA methylation detection kit, wherein the kit comprises reagents for performing a conversion treatment, preferably with bisulfite and/or bisulfite, on a DNA to be detected and/or reagents for DNA amplification and/or detection.

17. The method, kit or use according to any one of claims 14 to 16, wherein the 3' terminal group of the blocker is selected from one of a phosphate group, Spacer C3(Spacer C3), Spacer C9(Spacer C9), Spacer 18(Spacer 18).

Use of ALU-C4 as a reference gene for the preparation of a DNA methylation detection kit, wherein said kit preferably comprises reagents for performing a conversion treatment, preferably with bisulfite and/or bisulfite, on a DNA sample to be detected and/or for DNA amplification and/or detection.

19. A method, kit or use according to any one of claims 14 to 18, wherein the method or kit is for the diagnosis and/or prognosis of cancer; the cancer is preferably one or more selected from the group consisting of gastric cancer, colorectal cancer, breast cancer, liver cancer, lung cancer, cervical cancer, and head and neck cancer, more preferably gastric cancer.

20. The method, kit or use according to any one of claims 14 to 19, wherein the DNA to be detected is the RNF180 gene, and the DNA amplification and/or detection preferably amplifies and/or detects a sequence comprising a sequence selected from SEQ ID NO 13-15 or a sequence selected from SEQ ID NO 13-15 in the RNF180 gene.

21. The method, kit or use according to item 20, wherein the reagents for DNA amplification and/or detection comprise amplification primers and/or detection probes comprising or being a sequence selected from SEQ ID NOs 16-18.

22. The method, kit or use according to any one of claims 14 to 19, wherein the DNA to be tested is a replimo gene, and the DNA amplification and/or detection preferably amplifies and/or detects a sequence comprising a sequence selected from SEQ ID nos. 20 to 22 and a sequence selected from SEQ ID nos. 20 to 22 in the replimo gene.

23. The method, kit or use according to item 22, wherein the reagents for DNA amplification and/or detection comprise amplification primers and/or detection probes comprising or being a sequence selected from SEQ ID NOs 23-25.

24. The method, kit or use of any one of claims 14 to 23, wherein the reagents for detecting ALU-C4 comprise amplification primers and/or probes comprising or being a sequence selected from SEQ ID NOs 27-29.

25. A method, kit or use according to any one of claims 14 to 24, wherein the blocker for detecting RNF180 gene methylation comprises or is the sequence of SEQ ID No. 19 and the blocker for detecting replimo gene methylation comprises or is the sequence of SEQ ID No. 26.

26. A nucleic acid selected from the group consisting of SEQ ID NOS 1-29.

27. The nucleic acid according to item 26, for use in the detection of RNF180 gene or replimo gene methylation, and/or for use in the diagnosis or prognosis of cancer, preferably one or more cancers selected from the group consisting of gastric cancer, colorectal cancer, breast cancer, liver cancer, lung cancer, cervical cancer and head and neck cancer, more preferably gastric cancer.

28. The method, kit, use or nucleic acid according to any preceding claim, wherein the detection probe is labelled with a label, preferably a fluorescent label.

29. The method, kit, use of any preceding claim, wherein the kit comprises a PCR reaction reagent, which may comprise a component selected from the group consisting of: nuclease and DNA polymerase, the positive control can be RNF180 synthetic DNA and Rerimo synthetic DNA, and the negative control can be purified water.

Drawings

FIG. 1 is a graph of the real-time PCR amplification curve of Rerimo by the enzymatic method described in example 1.

FIG. 2 is a boxed-type scatter plot of the results of detection of the replimo clinical samples by the enzymatic method described in example 2.

Figure 3 is a real-time PCR amplification curve for ACTB.

FIG. 4 is a real-time PCR amplification curve for ALU-C4.

FIG. 5 is a RNF180 real-time PCR amplification curve of the blocker method described in example 4. From left to right, curve 1. amplification of methylation standard with RNF180 gene methylation primer without addition of blocker; 2. amplifying a methylation standard substance by using an RNF180 gene methylation primer when a blocking agent is added; 3. amplifying the non-methylated standard substance by using an RNF180 gene methylation primer when the blocking agent is not added; 4. the unmethylated standards were amplified with RNF180 gene methylation primers when the blockers were added.

FIG. 6 is a graph of a Rerimo real-time PCR amplification curve of the blocker method described in example 4. From left to right, 1. amplifying the methylation standard by using a replimo gene methylation primer when no blocker is added; 2. amplifying a methylation standard substance by using a replimo gene methylation primer when a blocking agent is added; 3. amplifying the non-methylated standard substance by using a replimo gene methylation primer when the blocking agent is not added; 4. the unmethylated standards were amplified with the replimo gene methylation primers when the blockers were added.

FIG. 7 is a boxed scatter plot of the results of the RNF180 clinical sample testing by the blocker method described in example 5. The ordinate is the difference between the actual Ct value of RNF180 and the actual Ct value of reference gene ALU-C4.

FIG. 8 is a test ROC curve for a clinical sample of RNF180 from the blocker method described in example 5. The abscissa represents (1-specificity) x 100%, and the ordinate represents sensitivity.

Fig. 9 is a box scatter plot of the results of the repromo clinical specimen testing by the blocker method described in example 5. The ordinate is the difference between the measured Ct value of replimo and the measured Ct value of the internal reference gene ALU-C4.

FIG. 10 is a Repmo clinical sample test ROC curve for the blocker method described in example 5. The abscissa represents (1-specificity) x 100%, and the ordinate represents sensitivity.

Detailed Description

Before the present methods and compositions are described, it is to be understood that this invention is not limited to particular methods or compositions described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. The examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.), but some experimental error and deviation should be accounted for.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Some potential and preferred methods and materials are now described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. It will be understood that in case of conflict, the present disclosure is substituted for any disclosure in the cited publication.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method may be implemented in the order of events recited or in any other order that is logically possible.

As used herein and in the appended claims, "a" means "one or more" unless stated otherwise.

When a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and are subject to any specific exclusion within that range, where each range where either or both limits are included in the smaller ranges is also encompassed within the invention. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

The term "forward primer" and "forward primer" are used interchangeably in this disclosure, and "reverse primer" are used interchangeably.

In a first aspect, the present disclosure provides methods, kits and related applications for DNA methylation detection by methylation sensitive restriction enzyme treatment.

In this aspect, the present disclosure provides a method for detecting methylation of a gene, the method comprising treating a DNA sample with a methylation sensitive restriction enzyme, and determining the methylation of a DNA (e.g., a gene) to be detected, e.g., determining whether the DNA is methylated and/or the degree of methylation of the DNA, based on the results of DNA amplification of the DNA sample with and without the enzyme treatment.

Methylation of human (e.g., cancer patients, such as gastric cancer patients) DNA typically occurs at CpG islands where the 5' carbon of cytosine is modified by a methyl group. Methylation of specific fragments in genes was detected using palindromic sequences specifically recognized by methylation specific restriction endonucleases. For example, when cytosine in an enzyme recognition fragment in a specific fragment is methylated, the fragment is not cleaved; the enzyme recognition fragment of the specific fragment in the unmethylated state will be cleaved. For example, by designing specific primers and probes containing at least one methylation-sensitive restriction endonuclease recognition sequence or fragment thereof for PCR amplification of the sequence to be amplified, the methylated fragments can generate an amplification signal, while the unmethylated fragments do not. By designing at least one section of amplification primer containing a corresponding enzyme recognition palindromic sequence or a section thereof, a detection probe and a nucleic acid section to be amplified, the quantitative detection of the methylation degree of the gene can be realized.

As an example, the methylation sensitive restriction enzyme can be a methylation sensitive restriction enzyme that contains a CpG in the enzyme recognition sequence. The enzyme may be an enzyme that specifically cleaves an unmethylated sequence, and may be one or more enzymes selected from BstUI enzyme, HpaII enzyme, and hhal enzyme. The amplification primers and/or probes may comprise palindromic sequences or fragments thereof recognized by the enzyme.

The gene detected may be RNF180 and/or replimo.

The methylation sensitive restriction enzyme can also be an enzyme that specifically cleaves a methylated sequence. From the amplification results of a DNA sample digested with a methylation sensitive restriction enzyme and a DNA sample not digested with the enzyme, the methylation state, such as methylation and the methylation degree of a DNA (e.g., a gene) to be tested can be determined. The methylation sensitive restriction enzyme is preferably selected from methylation specific restriction enzymes containing a CpG in the enzyme recognition sequence, more preferably McrBC.

The gene detected may be RNF180 and/or replimo.

In one embodiment, the gene is the RNF180 gene, preferably the amplification primers and/or probes are directed against the promoter region of the RNF180 gene. For example, the primers and/or probes may amplify and/or detect a sequence comprising or being selected from the group consisting of:

CTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAACC(SEQ IDNO:1)；

CTTTCCCACGGTTCCGTCTGGCCCGCGGCGCTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAACC (SEQ ID NO: 2); and

ACTTTCCCACGGTTCCGTCTGGCCCGCGGCGCTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAACCCGCAGACGTGGGGCGAGGCTGGCTGTGGCGGGCGAG(SEQ ID NO:3)。

preferably, the amplification primers and/or probes can amplify and/or detect a palindromic sequence recognized by the enzyme in the promoter region of the RNF180 gene or a fragment thereof that includes a methylation site. In a more preferred embodiment, the amplification primers and probes comprise or are sequences selected from SEQ ID NOS 4-6:

CTTGTCTGCCTGCG (RNF180 upstream primer sequence) (SEQ ID NO:4),

GGTTCCCACCCGAGC (RNF180 downstream primer sequence) (SEQ ID NO:5),

GGGTCAAAGCCCGGCG (RNF180 detection probe sequence) (SEQ ID NO: 6).

In another embodiment, the gene is a replimo gene, preferably the amplification primers and/or probes are directed against the promoter region of the replimo gene, e.g., the primers and/or probes can amplify and/or detect a sequence comprising or being selected from the group consisting of:

CAGATCGCGGTCATGTGCGTGCTCTCACTCACCGTGGTCTTCGGCATCTTCTTCC(SEQ ID NO:7)，

CAGATCGCGGTCATGTGCGTGCTCTCACTCACCGTGGTCTTCGGCATCTTCTTCCTCGGCTGCAATCTGCTCATCAAGTCCGAGGG(SEQ ID NO:8)，

CAGATCGCGGTCATGTGCGTGCTCTCACTCACCGTGGTCTTCGGCATCTTCTTCCTCGGCTGCAATCTGCTCATCAAGTCCGAGGGCATGATCAACTTCCTCGTGAA(SEQ ID NO:9)。

preferably, the amplification primers and/or probes may comprise palindromic sequences recognized by the enzyme in the promoter region of the replimo gene or fragments thereof comprising a methylation site. In a more preferred embodiment, the amplification primers and probes comprise or are sequences selected from SEQ ID NOS: 10-12:

CAGATCGCGGTCATGT (replimo upstream primer sequence) (SEQ ID NO:10),

GGAAGAAGATGCCGAAG (replimo downstream primer sequence) (SEQ ID NO:11),

CGTGCTCTCACTCACCGTG (Repmo detection probe sequence) (SEQ ID NO: 12).

In this respect, the disclosure also relates to kits comprising said methylation sensitive restriction enzyme and related uses of said methylation sensitive restriction enzyme.

As described above, conventional methylation detection methods (e.g., Methylation Specific PCR (MSP) and methylation specific fluorescence PCR (methylight)) are always deficient in primer specificity, and methylated primers also have a certain probability of amplifying unmethylated templates by mismatching. Theoretically, a single primer will contain no more than 3 CpG sequences, and thus a primer pair of an unmethylated template will have no more than 6 base sites that match methylated primers. The methylation detection sample is a mixture of methylated template and unmethylated template, and the unmethylated template usually accounts for more than 90% of the total template amount, so that MSP and methylight have the defect of false positive. Therefore, it is important to specifically exclude the mismatch of methylated primers to unmethylated templates in practical measurement.

In a second aspect, aiming at the problems stated above, the present disclosure provides a method and a kit with simple operation, high sensitivity, strong specificity, high quantification degree, and repeatability and stability superior to those of the prior art by adding a PCR blocking agent and screening an internal reference gene.

In this aspect, the present disclosure provides a method for detecting methylation of a DNA (e.g., a gene), the method comprising providing a blocking agent upon amplification of a DNA sample after conversion treatment (e.g., with bisulfite and/or bisulfite) of the DNA sample.

The blocking agent is or comprises a sequence complementary to a sequence of the gene after transformation of a contiguous unmethylated sequence, and the 3' end group of the blocking agent is such that the blocking agent cannot be extended during DNA amplification, wherein the contiguous unmethylated sequence:

(iii) Comprising a region or fragment thereof to which an upstream or downstream primer is directed and a region or fragment thereof to which a detection probe is directed, and covering at least 35% (e.g., at least 40%) of the sum of the sequences of both the region to which the upstream or downstream primer is directed and the region to which the probe is directed, wherein the fragment comprises at least one methylation site in the region to be detected.

The term "substantial portion" as used in this disclosure has the meaning commonly understood by those skilled in the art, i.e., more than 50%. If the region contains 3 methylation sites to be detected, then "the fragment comprises most or all of the methylation sites to be detected in the region" means that the fragment comprises at least two methylation sites to be detected.

When the unmethylated sequence includes (1) the region targeted by the upstream or downstream primer (primer binding region) or fragment thereof and (2) the region targeted by the detection probe (probe binding region) or fragment thereof, the unmethylated can cover at least 35%, e.g., at least 40%, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc., or even 100% of (the region targeted by the upstream or downstream primer + the region targeted by the probe). For example, if the region a targeted by the downstream primer is 15bp long and the region B targeted by the probe is 20bp long, the contiguous unmethylated sequences can cover, for example, 7bp in a and 7bp in B (14/(15+20) ═ 40%), all 15bp in a and 5bp in B (20/(15+20) ═ 57.1%), and so forth.

The blocking agent of the present disclosure is or comprises a sequence complementary to a sequence of a continuous segment of unmethylated sequence in the gene to be tested after transformation (i.e., 100% match), and thus has a higher binding affinity to the unmethylated template than the binding affinity between the methylated primer and the unmethylated template, which can reduce the probability of mispairing of the methylated primer to the unmethylated template. By the design of the blocking agent, the overall specificity of the reaction is improved, and false positive amplification caused by mismatching can be effectively inhibited; and the interference of background signals can be reduced, and the sensitivity of the reaction is further optimized. By introducing the blocking agent, the detection rate of positive can be improved, and false positive caused by primer mismatching or too complex sample DNA background can be eliminated, so that the correctness, reliability and stability of a detection result are ensured.

In the technical scheme of the disclosure, the 3' end group of the blocking agent is a group which can prevent the blocking agent from being extended during amplification. Such a gene is known to those skilled in the art and may be, for example, one of a phosphate group, a spacer C3(Space C3), a spacer C9(Space C9), and a spacer 18(Space 18). As known to those skilled in the art, the spacer C3 is a short carbon chain containing 3 carbon atoms; spacer C9 is a short carbon chain containing 9 carbon atoms; spacer 18 is an amide compound.

In one embodiment of this aspect, the method using a blocking agent is used to detect RNF180 methylation. In certain embodiments, the primers and probes are directed to the promoter region of the RNF180 gene, e.g., the primers and/or probes can amplify and/or detect a sequence comprising or being selected from the group consisting of:

CGCTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAA(SEQ IDNO:13)，

CACGGTTCCGTCTGGCCCGCGGCGCTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAA(SEQ ID NO:14)，

ACTTTCCCACGGTTCCGTCTGGCCCGCGGCGCTTGTCTGCCTGCGCGGGGTCAAAGCCCGGCGCCGCCCACGCGCGGCTCGGGTGGGAACCCGCAGACGTGGGGCGAGCAGGGCCGCTGGCTGTGGCGGG(SEQ ID NO:15)。

wherein the primers, probes and blockers used in the method may be or comprise a sequence selected from:

CGTTTGTTTGTTTGCG (RNF180 upstream primer sequence) (SEQ ID NO:16),

TTCCCACCCGAACC (RNF180 downstream primer sequence) (SEQ ID NO:17),

GGGTTAAAGTTCGGCGTCGTT (RNF180 detection probe sequence) (SEQ ID NO:18),

TTCCCACCCAAACCACACAT (RNF180 blocker sequence) (SEQ ID NO: 19).

In another embodiment of this aspect, the method utilizing a blocking agent is used to detect replimo methylation. In certain embodiments, the primers and probes are directed to the promoter region of the replimo gene, e.g., the primers and/or probes can amplify and/or detect a sequence comprising or being selected from the group consisting of:

CTCGTGAAGGACCGGAGGCCGTCTAAGGAGGTGGAGGCGGTGGTCGTGGGGCCCTA(SEQ ID NO:20)，

AGTCCGAGGGCATGATCAACTTCCTCGTGAAGGACCGGAGGCCGTCTAAGGAGGTGGAGGCGGTGGTCGTGGGGCCCTACTGACCCGCCC(SEQ ID NO:21)，

TCGGCTGCAATCTGCTCATCAAGTCCGAGGGCATGATCAACTTCCTCGTGAAGGACCGGAGGCCGTCTAAGGAGGTGGAGGCGGTGGTCGTGGGGCCCTACTGACCCGCCCT(SEQ ID NO:22)。

wherein the replimo primers, probes and blockers used in this method may be or comprise a sequence selected from:

TTCGTGAAGGATCGGA (replimo upstream primer sequence) (SEQ ID NO:23),

TAAAACCCCACGACC (replimo downstream primer sequence) (SEQ ID NO:24),

CCGCCTCCACCTCCTTAAACGA (replimo detection probe sequence) (SEQ ID NO:25),

TAAAACCCCACAACCACCACC (Repmo blocker sequence) (SEQ ID NO: 26).

In a second aspect, the disclosure also relates to kits and related uses employing the blocking agents.

In particular, in methylation detection taking plasma as a sample, the DNA source is fragmented DNA, and the ALU-C4 gene (such as ALU-C4 genome repetitive subsequence) is selected and can be more accurately used as an internal reference of original DNA of the sample for calculation, while other internal reference genes, such as β -actin (β -actin), globulin (Globin) and the like, can only be used as a quality control standard due to low content in fragment DNA and no positive proportion relation with actually detected genes, and cannot assist content determination through Ct values of the internal reference genes.

Thus, in a third aspect, the disclosure relates to the use of ALU-C4 as an reference gene, to detection methods and kits relating thereto, and to the use of ALU-C4 as an reference gene.

ALU-C4 can be used as an internal reference gene in a method, a kit and related applications for detecting by using DNA amplification, in particular in a method, a kit and related applications for detecting plasma DNA (such as DNA methylation detection).

With respect to the method, the present disclosure provides a gene methylation detection method that employs ALU-C4 as a reference gene. In the method, preferably the ALU-C4 amplification primers and/or detection probes are directed against ALU-C4 genomic repeat subsequences, more preferably the amplification primers and/or detection probes are or comprise a sequence selected from:

ALU-C4 forward primer F2: GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA (SEQ ID NO:27),

ALU-C4 reverse primer R2: ATTAACTAAACTAATCTTAAACTCCTAACCTCA (SEQ ID NO:28),

ALU-C4 detection probe P2: CCTACCTTAACCTCCC (SEQ ID NO: 29).

In a third aspect, the disclosure also relates to application of ALU-C4 (especially ALU-C4 genome repetitive subsequence) as an internal reference gene in detection and diagnosis, and related methods, kits and applications, and relates to a reagent for detecting ALU-C4 (especially ALU-C4 genome repetitive subsequence) as an internal reference gene, a related kit containing the reagent, and related applications of the reagent.

The third aspect may be combined with the second aspect, i.e. the method and kit may be used with the blocker and ALU-C4 as a reference gene.

In the technical scheme of the disclosure, the kit can comprise a PCR reaction reagent, a positive control substance and/or a negative control substance. The PCR reaction reagent may include a component selected from the group consisting of: nuclease, DNA polymerase and ExTaq enzyme. The positive control substance can be RNF180 synthetic DNA or Rerimo synthetic DNA, and the negative control substance can be purified water.

Aiming at the problems in the prior art, the invention provides a kit and a method which are simple and convenient to operate, high in sensitivity, strong in specificity, high in quantitative degree, excellent in repeatability and stability by using methylation sensitive restriction enzyme, screening internal reference genes, improving primer probe design and adding a blocking agent.

The present invention will be described in further detail with reference to the accompanying drawings and examples. It should be understood that the specific embodiments are described herein to assist those skilled in the art in better understanding the technical aspects of the present disclosure and are not intended to limit the technical aspects.

Examples

Materials and methods

Firstly, enzyme:

the M.SssI, HpaII and HhaI enzymes used in the examples were purchased from New England Biolabs. BstUI enzyme was purchased from Thermo Fisher Scientific.

II, clinical samples:

plasma samples of gastric cancer patients are selected from 14 patients who are visited in the first hospital affiliated to Zhejiang university during 5-7 months in 2018, and plasma samples of normal persons are selected from 8 normal persons who voluntarily donate blood to participate in projects in Shenzhen Jinhui biology Limited on 17 months in 2018.

The normal human group entry conditions were:

1.45 years old or younger

2. No history of serious digestive tract diseases

3. There was no family genetic history of cancer.

Thirdly, extracting free cf-DNA of blood plasma:

free cf-DNA was extracted from plasma using a large-volume free nucleic acid extraction kit from Tiangen bio, available from Tiangen Biotech (Beijing) co., Ltd., according to the instructions provided by the kit.

Fourthly, conversion treatment

The transformation was carried out using EZ DNA Methylation-GoldTM kit (EZ DNA Methylation-Gold)^TMKit, Zymo Research Inc.), following the corresponding instructions provided in the Kit.

Fifth, PCR Process

The PCR procedure was performed using a PCR kit purchased from Takara Bio Inc. (Takara Bio Inc.), according to the instructions provided in the kit.

The PCR instrument used in the PCR procedure was a real-time fluorescent quantitative PCR system model ABI 7500 (available from Life technology Applied Biosystems) in USA, with a 20. mu.l reaction system, a final concentration of 600nM for the forward (upstream) and reverse (downstream) primers and 300nM for the probe. The PCR amplification reaction program is as follows: denaturation at 95 ℃ for 2min, one cycle; 95 ℃ for 8s, 60 ℃ for 30s, 45 cycles.

Example 1: method for verifying methylation detection of restriction enzyme method by using standard product

A pair of primers and probes for methylation detection containing at least one section of specificity corresponding to an enzyme recognition palindromic sequence are designed in the promoter region of a human genome Rerimo gene (the sequence is disclosed in NCBI database as a human whole genome sequence, Rerimo, TP53 dependent G2 array mediator homolog [ Homo sapiens (human) ] GeneID:56475, and updated on 12-Aug-2018). Then, the primer and the probe are used for amplifying and detecting the DNA of a normal human sample which is treated or not treated by the CpG methyltransferase (hereinafter referred to as treated or untreated) and digested by the methylation specific restriction endonuclease, and the effectiveness of the method for methylation detection is detected according to the comparison of the amplified Ct value of the replimo gene in the treated DNA which is digested by the methylation specific restriction endonuclease, the amplified Ct value of the replimo gene in the untreated DNA which is digested by the enzyme and the amplified Ct value of the replimo gene which is not digested by the enzyme.

The detection was carried out according to the following procedure.

The method comprises the following steps: 2mL of normal human plasma (3 portions) was extracted with Tiangen bulk free nucleic acid extraction kit according to the instructions provided in the kit, and the free DNA was eluted with 65. mu.l of DEPC water. 1/3 of each DNA was treated with CpG methyltransferase M.SssI as a methylated standard and the remaining 2/3 was treated in parallel with the same reaction system but without the enzyme as an unmethylated standard. The specific operations are performed according to the following table:

source of template	DNA from normal human plasma	DNA from normal human plasma	DNA from normal human plasma
				Sample naming	M1^*	F1^*	F2^*
Amount of template added	20μl	20μl	20μl
				S-adenosyl methionine	4μl	4μl	4μl
NEB Buffer 2	4μl	4μl	4μl
				SssI methyltransferase	2μl	0	0
DEPC water	10μl	12μl	12μl

M represents a methylated standard, F represents an unmethylated standard

CpG methyltransferase m.sssi reaction program: 5h at 37 ℃ and 20min at 65 ℃.

Step two: mu.l of each of the above-treated DNAs was subjected to methylation-sensitive restriction enzyme treatment. The specific operations are performed according to the following table:

source of template	M1/F1/F2	M1/F1/F2	M1/F1/F2	M1/F1/F2
					Sample naming	BsM1/BsF1^*	HpM1/HpF1^*	HhM1/HhF1^*	FM/FF^*
Amount of template added	10μl	10μl	10μl	10μl
					Buffer for enzyme digestion reaction	2μl	2μl	2μl	2μl
Methylation sensitive restriction endonucleases	0.1μl	0.1μl	0.1μl	0
					DEPC water	7.9μl	7.9μl	7.9μl	8μl

Bs indicates treatment with BstUI enzyme, Hp indicates treatment with HpaII enzyme, and Hh indicates treatment with hhal enzyme.

M represents a methylated standard, and F represents an unmethylated standard.

FM denotes a methylated standard which has not been treated with a methylation sensitive restriction enzyme, and FF denotes an unmethylated standard which has not been treated with a methylation sensitive restriction enzyme.

The methylation sensitive restriction enzyme reaction procedures are as follows: 16h at 37 ℃ and 20min at 80 ℃.

Step three: the template was PCR amplified using the replimo forward (upstream) primer F1 (5'-CAGATCGCGGTCATGT-3', SEQ ID NO:6), the replimo reverse (downstream) primer R1 (5'-GGAAGAAGATGCCGAAG-3', SEQ ID NO:7), and the replimo detection probe P1 (5'-CGTGCTCTCACTCACCGTG-3', SEQ ID NO: 8).

Step four: analyzing the result, and detecting whether the experimental result meets the quality control requirement, namely whether the Ct value of the sample to be detected which is not subjected to enzyme digestion treatment is less than or equal to 35; if the Ct value is more than 35, the sample does not include result statistics; and judging whether the methylation detection of the replimo gene of the sample to be detected is positive or not according to the difference between the Ct value of the replimo gene subjected to enzyme digestion treatment and the Ct value of the replimo gene not subjected to enzyme digestion treatment in the detection result of the sample. The specific criteria are as follows:

third, the detection result^*

The results of the measurements are shown in table 1 below and fig. 1.

TABLE 1

Example 2: diagnosis of gastric cancer by enzymatic methylation detection

The clinical samples described in "materials and methods" were tested using the method described in example 1. Briefly, plasma from clinical samples was taken to extract free DNA, a portion of the DNA samples were not digested (digested) with BstUI enzyme, and another portion were not digested with BstUI enzyme. Then, detection was performed using the primers and probes described in example 1.

And (4) analyzing results: detecting whether the experimental result meets the quality control requirement, namely detecting whether the Ct value of the sample to be detected which is not subjected to enzyme digestion treatment is less than or equal to 35; if the Ct value is more than 35, the sample does not include result statistics; and judging whether the methylation detection of the replimo gene of the sample to be detected is positive or not according to the difference between the Ct value of the replimo gene subjected to enzyme digestion treatment and the Ct value of the replimo gene not subjected to enzyme digestion treatment in the detection result of the sample.

The results of the clinical sample measurements are shown in table 2 and fig. 2.

TABLE 2

From the results shown in the table, the detection sensitivity of the gastric cancer sample was 57.14% and the specificity was 62.5% by the above method.

Example 3: ALU-C4 as an internal reference Gene in plasma

Using the partial clinical samples described in "materials and methods", ALU-C4 was tested for superiority in plasma as an internal reference gene over traditional internal reference genes such as ACTB.

Briefly, free dna was extracted from plasma of clinical samples according to the method described in "materials and methods" ALU-C4 and ACTB (i.e. β -actin) were detected in plasma by PCR reactions, primers and probes used in PCR reactions were as follows:

ALU-C4 Forward primer F2: GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA (SEQ ID NO:27)

ALU-C4 reverse primer R2: ATTAACTAAACTAATCTTAAACTCCTAACCTCA (SEQ ID NO:28)

ALU-C4 detection probe P2: CCTACCTTAACCTCCC (SEQ ID NO:29)

ACTB upstream primer 5'-TCTAACAATTATAAACTCCAACCACCAA-3' (SEQ ID NO:30)

ACTB downstream primer 5'-GGGAAGATGGGATAGAAGGGAATAT-3' (SEQ ID NO:31)

ACTB Probe: 5'-CCTTCATTCTAACCCAATACCTATCCCACCTCTAAA-3' (SEQ ID NO:32)

Wherein, the 5 'end of the ALU-C4 detection probe is marked by FAM as a luminescent group, and the 3' end uses MGB-NFQ as a quenching group; the ACTB probe was labeled with TAMRA at the 5 'end and BHQ2 at the 3' end.

And (4) analyzing results: the quality of the ACTB gene and ALU-C4 gene as reference genes in plasma samples was determined based on the peak onset of the ACTB gene and ALU-C4 gene in the samples.

The results of the clinical sample measurements are shown in Table 3 and FIGS. 3-4.

TABLE 3

As can be seen from the detection results, the feasibility and the stability of ALU-C4 as an internal reference gene in the plasma of normal persons and patients with gastric cancer are better than those of ACTB (100% vs 9.1%), so that the repeated ALU-C4 is recommended to be used as the internal reference gene for the methylation detection of plasma genes.

Example 4: method for verifying methylation detection by blocker method by using standard product

Designing a pair of specific methylation detection primers and probes and corresponding blockers in a promoter region of an RNF180 gene or a replimo gene of a human genome, then respectively using the gene primer pair and the probes containing the blockers and not containing the blockers to amplify methylated and unmethylated standards, and verifying the necessary action of the blockers on ensuring the reaction specificity and the working stability of the primers and the probes according to the comparison of relative fluorescence CT values of amplification results of the methylated standards and the unmethylated standards.

Design and synthesis of primers and probes

Specific primers and probes and corresponding blockers of the RNF180 Gene or the Rerimo Gene were designed using Beacon Designer 7.0 software for the promoter region of RNF180 Gene (see the sequence of the human genome set forth in NCBI database, RNF180 ring finger protein 180[ Homo sapiens (human) ] Gene ID:285671), the promoter region of the Rerimo Gene and the reference Gene ALU-C4 (see the sequence of the human genome set forth in NCBI database), respectively.

The sequences used are shown in the following table:

second, detection method

Methylated and unmethylated standards were prepared according to step 1 of example 1. Using EZ DNAlhylation-Gold^TMKit (EZ DNA Methylation-Gold)^TMKit, Zymo Research Inc.) the standards were subjected to transformation treatment according to the corresponding instructions provided in the Kit. The methylated and unmethylated standards described in example 1 were subjected to PCR amplification with or without the addition of the respective blockers using the primers and probes for detecting RNF180 gene or repromo gene. The 5 'end of each of the RNF180 detection probe and the Rerimo detection probe is labeled with VIC as a luminescent group, and the 3' end of each of the RNF180 detection probe and the Rerimo detection probe is labeled with BHQ1 as a quencher group. The 5 'end of the ALU-C4 detection probe was labeled with FAM as a luminophore and the 3' end was labeled with MGBNFQ as a quencher.

Third, result analysis

Detecting whether the experimental result meets the quality control requirement, namely checking whether the detection Ct value of the sample ALU-C4 to be detected is less than or equal to 27; if Ct value > 27, the experimental results are not included in the results statistics. And judging whether the methylation detection of the replimo gene of the sample is positive or not according to the difference between the Ct value of the replimo gene detected by the sample and the Ct value of the ALU-C4 gene.

And judging the sample according to the detection result. According to the comparison of the relative fluorescence CT values of the amplification results of the methylated standard substance and the unmethylated standard substance, the necessary action of the blocking agent on ensuring the reaction specificity and the working stability of the primer probe are verified. The specific criteria are as follows:

third, the detection result^*

The results of the detection of RNF180 gene are shown in Table 4 below and FIG. 5.

TABLE 4

As can be seen from table 4 and fig. 5, for the methylation standard, the primer pair of RNF180 and the probe thereof have good amplification effect, and the amplification effect is not significantly changed after the blocker is added; for the unmethylated standard, the primer pair of RNF180 and its probe amplified non-specifically when used alone, but the reaction specificity improved significantly upon addition of the blocker. Thus, the RNF180 primer pair, probe and blocker are effective and reliable for amplification of the nucleic acid sequence.

The results of the replimo assay are shown in table 5 below and fig. 6.

TABLE 5

As can be seen from table 5 and fig. 6, for the methylated standards, the primer pair of replimo and the probe thereof have good amplification effect, and the amplification effect is not significantly changed after the blocker is added; for the unmethylated standard, the primer pair of replimo and its probe amplified non-specifically when used alone, but the reaction specificity improved significantly upon addition of the blocker. Thus, the pair of replimo primers, probe and blocker are effective and reliable for amplification of the nucleic acid sequence.

Example 5: diagnosis of gastric cancer by methylation detection method using blocker method

The detection of RNF180 or replimo in the clinical specimens described in "materials and methods" was carried out using the methylation detection method using a blocking agent as described in example 4, together with the detection of ALU-C4 as an internal reference gene.

The results of the detection of the methylation of RNF180 gene are shown in Table 6 and FIGS. 7 to 8.

TABLE 6

From the results in the above table, the detection sensitivity of the kit was 78.57% and the specificity was 75% (as shown in FIG. 7). After ROC curves, an AUC value of 0.73 was obtained (as shown in fig. 8).

The results of the methylation detection of the replimo genes are shown in Table 7 and FIGS. 9-10.

TABLE 7

From the results in the above table, the detection sensitivity of the kit was 92.86%, and the specificity was 87.5% (as shown in fig. 9). After ROC curve, AUC value was 0.84 (as shown in fig. 10).

* * *

All of the methods, products (including kits, blockers, nucleic acids) and uses disclosed and claimed herein can be made and used without undue experimentation in light of the present disclosure. Although the methods, kits, and the like have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods, products, and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit, and scope of the invention. More specifically, certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Sequence listing

<110> Shenzhen Jinbaihui biology Limited

<120> DNA methylation detection method and related application

<130>20

<160>32

<170>PatentIn version 3.5

<210>1

<211>60

<212>DNA

<213>Homo sapiens

<400>1

cttgtctgcc tgcgcggggt caaagcccgg cgccgcccac gcgcggctcg ggtgggaacc 60

<210>2

<211>90

<212>DNA

<213>Homo sapiens

<400>2

ctttcccacg gttccgtctg gcccgcggcg cttgtctgcc tgcgcggggt caaagcccgg 60

cgccgcccac gcgcggctcg ggtgggaacc 90

<210>3

<211>127

<212>DNA

<213>Homo sapiens

<400>3

actttcccac ggttccgtct ggcccgcggc gcttgtctgc ctgcgcgggg tcaaagcccg 60

gcgccgccca cgcgcggctc gggtgggaac ccgcagacgt ggggcgaggc tggctgtggc 120

gggcgag 127

<210>4

<211>14

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>4

cttgtctgcc tgcg 14

<210>5

<211>15

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>5

ggttcccacc cgagc 15

<210>6

<211>16

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>6

gggtcaaagc ccggcg 16

<210>7

<211>55

<212>DNA

<213>Homo sapiens

<400>7

cagatcgcgg tcatgtgcgt gctctcactc accgtggtct tcggcatctt cttcc 55

<210>8

<211>86

<212>DNA

<213>Homo sapiens

<400>8

cagatcgcgg tcatgtgcgt gctctcactc accgtggtct tcggcatctt cttcctcggc 60

tgcaatctgc tcatcaagtc cgaggg 86

<210>9

<211>107

<212>DNA

<213>Homo sapiens

<400>9

cagatcgcgg tcatgtgcgt gctctcactc accgtggtct tcggcatctt cttcctcggc 60

tgcaatctgc tcatcaagtc cgagggcatg atcaacttcc tcgtgaa 107

<210>10

<211>16

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>10

cagatcgcgg tcatgt 16

<210>11

<211>17

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>11

ggaagaagat gccgaag 17

<210>12

<211>19

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>12

cgtgctctca ctcaccgtg 19

<210>13

<211>60

<212>DNA

<213>Homo sapiens

<400>13

cgcttgtctg cctgcgcggg gtcaaagccc ggcgccgccc acgcgcggct cgggtgggaa 60

<210>14

<211>82

<212>DNA

<213>Homo sapiens

<400>14

cacggttccg tctggcccgc ggcgcttgtc tgcctgcgcg gggtcaaagc ccggcgccgc 60

ccacgcgcgg ctcgggtggg aa 82

<210>15

<211>130

<212>DNA

<213>Homo sapiens

<400>15

actttcccac ggttccgtct ggcccgcggc gcttgtctgc ctgcgcgggg tcaaagcccg 60

gcgccgccca cgcgcggctc gggtgggaac ccgcagacgt ggggcgagca gggccgctgg 120

ctgtggcggg 130

<210>16

<211>16

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>16

cgtttgtttg tttgcg 16

<210>17

<211>14

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>17

ttcccacccg aacc 14

<210>18

<211>21

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>18

gggttaaagt tcggcgtcgt t 21

<210>19

<211>20

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> blocking agent (blocker)

<400>19

ttcccaccca aaccacacat 20

<210>20

<211>56

<212>DNA

<213>Homo sapiens

<400>20

ctcgtgaagg accggaggcc gtctaaggag gtggaggcgg tggtcgtggg gcccta 56

<210>21

<211>90

<212>DNA

<213>Homo sapiens

<400>21

agtccgaggg catgatcaac ttcctcgtga aggaccggag gccgtctaag gaggtggagg 60

cggtggtcgt ggggccctac tgacccgccc 90

<210>22

<211>112

<212>DNA

<213>Homo sapiens

<400>22

tcggctgcaa tctgctcatc aagtccgagg gcatgatcaa cttcctcgtg aaggaccgga 60

ggccgtctaa ggaggtggag gcggtggtcg tggggcccta ctgacccgcc ct 112

<210>23

<211>16

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>23

ttcgtgaagg atcgga 16

<210>24

<211>15

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>24

taaaacccca cgacc 15

<210>25

<211>22

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>25

ccgcctccac ctccttaaac ga 22

<210>26

<211>21

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> blockers (blocks)

<400>26

taaaacccca caaccaccac c 21

<210>27

<211>36

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>27

ggttaggtat agtggtttat atttgtaatt ttagta 36

<210>28

<211>33

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>28

attaactaaa ctaatcttaa actcctaacc tca 33

<210>29

<211>16

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>29

cctaccttaa cctccc 16

<210>30

<211>28

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>30

tctaacaatt ataaactcca accaccaa 28

<210>31

<211>25

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> primers (primers)

<400>31

gggaagatgg gatagaaggg aatat 25

<210>32

<211>36

<212>DNA

<213> Artificial sequence (ordo artificalia)

<220>

<223> Probe (probes)

<400>32

ccttcattct aacccaatac ctatcccacc tctaaa 36

Claims

1. A method for detecting DNA methylation, the method comprising:

(1) treating a portion of the DNA sample with a methylation sensitive restriction enzyme,

4. A kit or use according to claim 2 or 3 wherein the reagents include reagents for amplifying and/or detecting a sequence in the test DNA comprising at least one sequence recognised by the enzyme, such as amplification primers and/or detection probes.

5. The method, kit or use of any one of claims 1-4, wherein the enzyme specifically cleaves unmethylated sequences or cleaves methylated sequences.

6. The method, kit or use according to any one of claims 1-5, wherein the enzyme specifically cleaves unmethylated sequences, preferably the enzyme is a methylation sensitive restriction enzyme selected from CpG-containing enzymes recognition sequences, more preferably one or more enzymes selected from BstUI, HpaII and HhaI enzymes.

7. The method, kit or use according to any one of claims 1-5, wherein said enzyme specifically cleaves methylated sequences, preferably said enzyme is a methylation specific restriction enzyme selected from the group consisting of CpG-containing methylation specific restriction enzymes in the enzyme recognition sequence, more preferably McrBC.

9. The method, kit or use according to any one of claims 1 to 8, for the diagnosis and/or prognosis of cancer; the cancer is preferably one or more selected from the group consisting of gastric cancer, colorectal cancer, breast cancer, liver cancer, lung cancer, cervical cancer, and head and neck cancer, more preferably gastric cancer.

10. The method, kit or use according to any one of claims 1-9, wherein the DNA to be tested is the RNF180 gene, preferably wherein the RNF180 gene comprises a sequence selected from SEQ ID NOs 1-3, or wherein a sequence selected from SEQ ID NOs 1-3 is amplified.