CN116970698A

CN116970698A - Application of reagent for detecting methylation level of GYPC gene CpG island region

Info

Publication number: CN116970698A
Application number: CN202210423238.XA
Authority: CN
Inventors: 张良禄; 董兰兰; 张燕; 吴悦茨; 赵巴丽
Original assignee: Wuhan Aimisen Life Technology Co ltd
Current assignee: Wuhan Aimisen Life Technology Co ltd
Priority date: 2022-04-21
Filing date: 2022-04-21
Publication date: 2023-10-31

Abstract

The invention relates to an application of a reagent for detecting methylation level of a GYPC gene CpG island region. The invention discovers that by taking GYPC gene as a biomarker and detecting methylation of CpG island region, especially Chr2:126656121-126656595 region, gastric cancer can be diagnosed, and the sensitivity and specificity are high, so that the detection rate of gastric cancer can be effectively improved. Gastric cancer diagnosis is carried out based on GYPC gene CpG island region methylation, and the kit is applicable to various sample types including saliva, urine, blood and the like, is favorable for realizing noninvasive or minimally invasive detection, and is simple, convenient and quick.

Description

Application of reagent for detecting methylation level of GYPC gene CpG island region

Technical Field

The invention relates to the biomedical field, in particular to application of a reagent for detecting methylation level of a GYPC gene CpG island region.

Background

Currently, gastroscopy is the gold standard for gastric cancer examination, which and tissue biopsy are the main traditional methods of diagnosing gastric cancer, but as an invasive procedure, patient compliance is poor, the examination procedure is painful, the acceptance is low, and complications and other risks may be caused. Taking imaging screening for gastric cancer as an example, computed tomography (Computer tomography, CT) is commonly used to examine the development and metastasis of gastric cancer, but patients with gastric cancer often have no obvious clinical symptoms at early stage, so it is difficult to accurately diagnose them with imaging examination alone. Taking an electronic fiber gastroscope as an example, along with the lack of specificity and diversification of early gastric cancer manifestation and the difference of experience skills of doctors in various places, the missed diagnosis rate fluctuation is 8% -35%, and the clinical practice resource of the inspection equipment and the endoscopist is seriously relied on.

With the advent of accurate medicine, liquid biopsy (blood and other bodily fluids, etc.) techniques have played a significant role in the diagnosis of cancer. Compared with common digestive tract tumor markers in clinic, the specificity and sensitivity of carcinoembryonic antigen (CEA), alpha Fetoprotein (AFP), carbohydrate antigen (CA 72-4, CA 19-9) and the like in diagnosing digestive tract tumors have large differences, and organs suffering from tumors cannot be accurately positioned, so that the clinical application value is limited.

Therefore, there is an urgent need for biomarkers with high sensitivity to specifically realize diagnosis of gastric cancer.

Disclosure of Invention

Based on the methylation level, the invention aims to provide an application of a reagent for detecting the methylation level of a GYPC gene CpG island region in preparing a gastric cancer diagnosis kit. The invention prepares the gastric cancer diagnosis kit by using the detection reagent of the methylation level of the GYPC gene CpG island region, and the kit has high detection sensitivity and specificity.

In a first aspect of the invention, there is provided the use of a reagent for detecting the methylation level of a CpG island region of the GYPC gene in the preparation of a gastric cancer diagnostic kit.

In some embodiments of the invention, the GYPC gene CpG island region comprises Ch2: 126656121-126656595 with reference to GRCh38.p13.

In some embodiments of the invention, the GYPC gene CpG island region is selected from one or more of regions 1 to 8 defined as follows:

region 1: chr2:126656121-126656254, positive strand;

region 2: chr2:126656237-126656378, positive strand;

region 3: chr2:126656382-126656500, positive strand;

region 4: chr2:126656513-126656595, positive strand;

region 5: chr2, 126656595-126656463, negative strand;

region 6: chr2, 126656443-126656351, negative strand;

region 7: chr2, 126656329-126656235, negative strand;

region 8: chr2:126656205-126656125, negative strand.

In some embodiments of the invention, the reagent enables detection of the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

In some embodiments of the invention, the reagent comprises a detection primer pair for detecting one or more of the CpG island regions 1 to 8 of the GYPC gene and a detection probe corresponding to the detection primer pair.

In some embodiments of the invention, the reagent comprises one or more of the following detection primer pairs and combinations of detection probes corresponding to the detection primer pairs:

the detection primer pair shown in SEQ ID No.1-2 and the detection probe shown in SEQ ID No.17 corresponding to the region 1,

the detection primer pair shown in SEQ ID No.3-4 and the detection probe shown in SEQ ID No.18 corresponding to the region 2,

the detection primer pair shown in SEQ ID No.5-6 and the detection probe shown in SEQ ID No.19 corresponding to the region 3,

the detection primer pair shown in SEQ ID No.7-8 and the detection probe shown in SEQ ID No.20 corresponding to the region 4,

the detection primer pair shown in SEQ ID No.9-10 and the detection probe shown in SEQ ID No.21 corresponding to the region 5,

the detection primer pair shown in SEQ ID No.11-12 and the detection probe shown in SEQ ID No.22 corresponding to the region 6,

the detection primer pair shown in SEQ ID No.13-14 and the detection probe shown in SEQ ID No.23 corresponding to the region 7,

the detection primer pair shown in SEQ ID No.15-16 and the detection probe shown in SEQ ID No.24 corresponding to the region 8.

In some embodiments of the invention, the reagent further comprises an amplification buffer, dNTPs, a DNA polymerase, and Mg ²⁺ One or more of the following.

In some embodiments of the invention, the reagent further comprises a primer pair for detecting an internal reference gene comprising an ACTB gene and a probe corresponding to the primer pair, the primer pair for detecting the ACTB gene comprising the primers shown in SEQ ID nos. 25-26, and the probe corresponding to the primer pair is shown in SEQ ID No. 27.

In some embodiments of the invention, the detection probe and the control probe are labeled with a fluorescent reporter group and a fluorescence quenching group.

In some embodiments of the invention, the fluorescent reporter group is selected from one or more of FAM, HEX, VIC, CY, ROX, texa Red, JOE, and Quasar 705.

In some embodiments of the invention, the fluorescence quenching group is selected from one or more of MGB, BHQ1, BHQ2, and BHQ 3.

In some embodiments of the invention, the reagent further comprises a DNA extraction reagent and the reagent further comprises one or more of a DNA extraction reagent and a reagent that converts unmethylated cytosine bases to uracil.

In a second aspect of the invention there is provided a test kit for diagnosing gastric cancer comprising a reagent as defined in the first aspect of the invention.

In some embodiments of the application, the detection kit further comprises an amplification buffer, dNTPs, a DNA polymerase, and Mg ²⁺ One or more of the following.

Compared with the prior art, the application has the beneficial effects that:

the GYPC gene is located on a human chromosome 2, the specific position is 126656158-126696668bp, and the coded protein, namely glycophorin C, is a minor salivary glycoprotein carried on human erythrocyte membranes, and plays an important role in regulating the mechanical stability of erythrocytes. The application discovers that by taking GYPC gene as a biomarker and detecting methylation of CpG island region, especially Chr2:126656121-126656595 region, gastric cancer can be diagnosed, and the sensitivity and specificity are high, so that the detection rate of gastric cancer can be effectively improved. Gastric cancer diagnosis is carried out based on GYPC gene CpG island region methylation, and the kit is applicable to various sample types including saliva, urine, blood and the like, is favorable for realizing noninvasive or minimally invasive detection, and is simple, convenient and quick.

Drawings

In order to more clearly illustrate the technical solution in the embodiments of the present application and to more fully understand the present application and its advantageous effects, the following brief description will be given with reference to the accompanying drawings, which are required to be used in the description of the embodiments. It is evident that the figures in the following description are only some embodiments of the application, from which other figures can be obtained without inventive effort for a person skilled in the art.

FIG. 1 is a ROC curve of GYPC gene regions 1-8 for detecting a plasma sample of a gastric cancer patient and a plasma sample of a normal human.

Detailed Description

The present application will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the application and are not intended to limit the scope of the application in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present application may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by persons skilled in the art without departing from the spirit of the application, and equivalents thereof are also intended to fall within the scope of the application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the application, it being understood that the application may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the application.

Terminology

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

the term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from the group consisting of "and/or", "and/or", it should be understood that, in the present application, the technical solutions include technical solutions that all use "logical and" connection, and also include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).

The terms "plurality", "plural", "multiple", and the like in the present invention refer to, unless otherwise specified, an index of 2 or more in number. For example, "one or more" means one kind or two or more kinds.

As used herein, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.

The "suitable" in the "suitable combination manner", "suitable manner", "any suitable manner" and the like herein refers to the fact that the technical scheme of the present invention can be implemented, the technical problem of the present invention is solved, and the technical effect expected by the present invention is achieved.

Herein, "preferred", "better", "preferred" are merely to describe better embodiments or examples, and it should be understood that they do not limit the scope of the invention.

In the present invention, "further", "still further", "particularly" and the like are used for descriptive purposes to indicate differences in content but should not be construed as limiting the scope of the invention.

In the present invention, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present invention, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a technical feature being indicated. Moreover, the terms "first," "second," "third," "fourth," and the like are used for non-exhaustive list description purposes only, and are not to be construed as limiting the number of closed forms.

In the invention, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

In the present invention, a numerical range (i.e., a numerical range) is referred to, and optional numerical distributions are considered to be continuous within the numerical range and include two numerical endpoints (i.e., a minimum value and a maximum value) of the numerical range and each numerical value between the two numerical endpoints unless otherwise specified. Where a numerical range merely refers to integers within the numerical range, including both end integers of the numerical range, and each integer between the two ends, unless otherwise indicated, each integer is recited herein as directly, such as where t is an integer selected from 1-10, and where t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Further, when a plurality of range description features or characteristics are provided, these ranges may be combined. In other words, unless otherwise indicated, the ranges disclosed herein are to be understood to include any and all subranges subsumed therein.

In the present disclosure, the term "gastric cancer" (the same meaning as the stomach cancer) is a cancer originating from the gastric mucosal epithelium, may occur in the inner wall of the stomach, and may be in the cardia, the gastric body, the antrum of the stomach.

In the present disclosure, the term "diagnosis" includes aspects of auxiliary diagnosis, recurrence risk assessment, assessment of risk and extent of cancerous lesions, prognosis, and the like.

The term "gene" refers to a segment of DNA encoding a polypeptide chain that produces amino acids, and includes sequences located in coding and non-coding regions, as well as exon and intron sequences involved in gene transcription/translation and transcriptional/translational regulation.

The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and typically more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotides may be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine and guanine.

The term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

The term "methylation level" refers to whether or not cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, both qualitatively and quantitatively. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration of each index is also required to obtain a final decision index.

The term "CpG island" refers to a region on DNA that is rich in a large number of cytosines and guanines linked by phosphoester linkages. CpG dinucleotides are typically concentrated in the promoter region and exons of human genes. In normal human genomes, cpG sites outside CpG islands are typically methylated, whereas CpG sites in CpG islands are typically in an unmethylated state, a form of methylation that is inherited stably with cell division. When the tumor occurs, the unmethylation degree of CpG sites outside the cancer suppressor gene CpG island is increased, and the CpG sites in the CpG island are in a hypermethylation state, so that the chromosome helix degree is increased, the transcription is inhibited, and the gene expression is deleted.

The term "methylation level of a CpG island region" refers to the methylation level of cytosine in one or more CpG dinucleotides within a CpG island. "methylation site" refers to at least one CpG dinucleotide site in a region, and in particular to a cytosine in at least one CpG dinucleotide site in a region.

The term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction, PCR) to amplify a sequence of interest based on a polynucleotide sequence corresponding to a gene of interest or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence specific for that polynucleotide sequence. The exact length of the primer will depend on many factors, including temperature, source of primer, and method used. For example, for diagnostic and prognostic applications, the oligonucleotide primers will typically contain at least 10, 15, 20, 25 or more nucleotides, but may also contain fewer nucleotides, depending on the complexity of the target sequence. In the present disclosure, the term "primer" refers to a pair of primers that hybridize to the double strand of a target DNA molecule or to regions of the target DNA molecule that flank the nucleotide sequence to be amplified.

The term "Taqman probe" refers to a stretch of oligonucleotide sequences comprising a 5 'fluorescent group and a 3' quenching group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

The term "methylation-specific PCR" is one of the most sensitive experimental techniques currently studied for methylation, and a minimum of about 50pg of DNA methylation can be found. After the single-stranded DNA is subjected to bisulfite conversion, all unmethylated cytosines are deaminated to uracil, and methylated cytosines in CpG sites are kept unchanged, so that two pairs of primers aiming at methylated and unmethylated sequences are respectively designed, and the methylated and unmethylated DNA sequences can be distinguished through PCR amplification. In the present disclosure, methylation primers are added when performing real-time quantitative methylation-specific PCR, and if the Ct value meets the requirement (e.g., ct.ltoreq.38 in a tissue sample), it indicates that the target sequence is methylated.

First aspect of the invention

The invention provides application of a reagent for detecting methylation level of GYPC gene CpG island region in preparing a gastric cancer diagnosis kit.

The GYPC gene is located on human chromosome 2, the specific position is 126656158-126696668bp, and the positions of the locus or region are all referenced by GRCh38.p13. GYPC-glycocorin C, the protein coded by the glycocorin C, namely glycophorin C, is a minor salivary glycoprotein carried on human erythrocyte membranes, and GYPC protein plays an important role in regulating the mechanical stability of erythrocytes. The invention discovers that by taking GYPC gene as a biomarker and detecting methylation of CpG island region, especially Chr2:126656121-126656595 region, gastric cancer can be diagnosed, and the sensitivity and specificity are high, so that the detection rate of gastric cancer can be effectively improved. Gastric cancer diagnosis is carried out based on GYPC gene CpG island region methylation, and the kit is applicable to various sample types including saliva, urine, blood and the like, is favorable for realizing noninvasive or minimally invasive detection, and is simple, convenient and quick.

region 1: chr2:126656121-126656254, positive strand;

region 2: chr2:126656237-126656378, positive strand;

region 3: chr2:126656382-126656500, positive strand;

region 4: chr2:126656513-126656595, positive strand;

region 5: chr2, 126656595-126656463, negative strand;

region 6: chr2, 126656443-126656351, negative strand;

region 7: chr2, 126656329-126656235, negative strand;

region 8: chr2:126656205-126656125, negative strand.

Preferably, the GYPC gene CpG island region is selected from one or more of region 2, region 3, region 4, region 5 and region 7. Further preferably, the GYPC gene CpG island region is selected from one or more of region 2 and region 7.

In some embodiments of the invention, the reagent enables detection of the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, fluorescent quantitation, and the like.

In some embodiments of the invention, the reagent comprises a pair of detection primers and a detection probe corresponding to the pair of detection primers for detecting one or more of the CpG island regions 1 to 8 of the GYPC gene.

Preferably, the reagent comprises one or more of a detection primer pair shown in EQ ID No.3-4 and a detection probe shown in SEQ ID No.18, a detection primer pair shown in SEQ ID No.5-6 and a detection probe shown in SEQ ID No.19, a detection primer pair shown in SEQ ID No.7-8 and a detection probe shown in SEQ ID No.20, a detection primer pair shown in SEQ ID No.9-10 and a detection probe shown in SEQ ID No.21 and a detection primer pair shown in SEQ ID No.13-14 and a detection probe shown in SEQ ID No. 23. Further, the reagent comprises one or more of the detection primer pair shown in SEQ ID No.3-4, the detection probe shown in SEQ ID No.18, the detection primer pair shown in SEQ ID No.13-14 and the detection probe shown in SEQ ID No. 23.

In some embodiments of the invention, the reagent further comprises a primer pair for detecting an internal reference gene and a probe corresponding to the primer pair, wherein the internal reference gene comprises an ACTB gene, the primer pair for detecting the ACTB gene comprises primers shown in SEQ ID nos. 25-26, and the corresponding probe is shown in SEQ ID No. 27.

In addition, useful primers and probes include those that hybridize to SEQ ID NO:1-16 or the probe of SEQ ID No.17-24 has a nucleotide sequence which is greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical. Such primer and probe modifications are also contemplated and can be prepared according to standard techniques.

The term "% identity" in the context of two or more nucleotide sequences or amino acid sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example,% identity is the entire length of the coding region relative to the sequences to be compared.

For sequence comparison, typically one sequence is used as a reference sequence, and the test sequence is compared to that sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. The percent identity can be determined using search algorithms such as BLAST and PSI BLAST (Altschul et al, 1990, J Mol Biol 215:3,403-410;Altschul et al, 1997,Nucleic Acids Res25:17,3389-402).

The primer and probe modification may be performed by a known method. Modified versions of these primer and/or probe sequences can include, by way of non-limiting example, adding one or more nucleotides to the 5 'end, one or more nucleotides to the 3' end, one or more nucleotides to the 5 'and 3' ends, adding tails, shortening the sequence, extending the sequence, shifting the sequence several bases upstream and downstream, or any combination thereof.

Base modifications such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2 ' -deoxyadenosine, C-5 propynyl-deoxycytidine, C-5 propynyl-deoxyuridine, 2-amino-2 ' -deoxyadenosine-5 ' -triphosphate, 2, 6-diaminopurine (2-amino-dA), inverted dT, inverted dideoxy-T, hydroxymethyl dC, iso-dC, 5-methyl dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNA's) and include at least one mismatched base at one of the bases, or at least one of the bases is replaced with an RNA base, to effect, for example, an increase in nucleic acid interactions at the 3' end of the mutant-specific primer to increase Tm. The addition of double-stranded stable base modifications has a positive effect on PCR, enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. The modified probe should retain the ability to distinguish between the mutation site to be detected and the wild-type site.

In some embodiments of the invention, the fluorescent reporter group is selected from one or more of FAM, HEX, VIC, CY, ROX, texsa Red, JOE, and Quasar 705.

In some embodiments of the invention, the reagent further comprises one or more of a DNA extraction reagent and a reagent that converts unmethylated cytosine bases to uracil.

In some embodiments of the invention, the reagent that converts an unmethylated cytosine base to uracil is, for example, bisulfite.

In some embodiments of the invention, the sample to be tested may be from blood (whole blood, preferably peripheral blood), plasma, cell culture supernatant, stool, saliva, semen, alveolar lavage, amniotic fluid, villus, tissue or tissue lysate, bone or hair.

As used herein, "tissue or tissue lysate" may also be used interchangeably with the terms "lysate," "lysed sample," "tissue or cell extract," and the like, to refer to a sample and/or biological sample material comprising lysed tissue or cells, i.e., wherein the tissue or cell is

The structural integrity of the cells has been compromised. To release the contents of a cell or tissue sample, the material is typically treated with enzymes and/or chemicals to lyse, degrade or destroy the cell walls and cell membranes of such tissue or cells. The skilled artisan is well aware of suitable methods for obtaining lysates. This process is encompassed by the term "cleavage".

The ideal scenario for diagnosis is known to those skilled in the art, where a single event or process can cause a variety of diseases, especially when the etiology of the disease is not fully understood, as in the case of many cancer types, or gastric cancer as described herein. As will be appreciated by the skilled artisan, for a given multifactorial disease, diagnosis without biochemical markers is 100% specific and 100% sensitive, but those skilled in the art have the ability to use multiple disease markers in combination, or detection methods in combination, to increase the accuracy of the detection.

Determining whether a subject has significant differences from the healthy population/benign tumor control/initial status of the subject (baseline) can be done using statistical methods well known in the art and confirmed using confidence intervals and/or p-values. In some embodiments, the confidence interval may be 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, or 99.99% and the p-value may be 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001.

Second aspect of the invention

The present invention provides a test kit for diagnosing gastric cancer comprising the reagent defined in the first aspect.

Further, the detection kit of the invention also comprises an amplification buffer solution, dNTPs, DNA polymerase and Mg ²⁺ One or more of the following.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present invention, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

Example 1

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 1 and a nucleic acid combination 9.

Nucleic acid combination 1 comprises a nucleotide sequence as set forth in SEQ ID NO:1-2 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:17, the specific sequences of which are shown in Table 1.

Nucleic acid combination 1 allows detection of the methylation level of the forward strand of the Chr2:126656121-126656254 region (region 1) on the GYPC gene. The nucleotide sequence of the region 1 forward strand is as follows (5 '-3'):

CGGCCCGCGCGGGAGGAGTGTGACCCAGGTGCCGCTTCCTCTCGCCGCCGAGGGTCAGGAGCCCGGGAGCGCGACCCTCCCCCGGCCCGGCCTGGCCCGGCCTGGCCAGTCCCCGCGGTCTCTGCCCGGGCTGA(SEQ ID NO：28)

Nucleic acid combination 1 can detect methylation of cytosine at positions of the forward strand of region 1, where Chr2:126656121, chr2:126656126, chr2:126656128, chr2:126656130, chr2:126656169, chr2:126656184, chr2:126656190, chr2:126656236, and Chr2: 126656247.

Example 2

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 2 and a nucleic acid combination 9.

Nucleic acid combination 2 comprises a nucleotide sequence as set forth in SEQ ID NO:3-4 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:18, the specific sequences of which are shown in Table 1.

Nucleic acid combination 2 can detect the methylation level of the forward strand of the Chr2:126656237-126656378 region (region 2) on the GYPC gene. The nucleotide sequence of the region 2 forward strand is as follows (5 '-3'):

GGTCTCTGCCCGGGCTGACGCCCAGGAATGTGGTCGACGAGAAGCCCCAACAGCACGGCGTGGCCTCTCAGCCTCGGTGAGTACCCGCCGTGGGGAAGGGTCCTGGGGACCCACTGGAGGCCGCGGCCCGCAGCAGCCAGGG(SEQ ID NO：29)

nucleic acid combination 2 can detect methylation of cytosine at positions of the forward strand of region 2, where the positions are Chr2:126656247, chr2:126656255, chr2:126656311, chr2:126656322, chr2:126656325, chr2:126656358, chr2:126656360, and Chr2: 126656365.

Example 3

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 3 and a nucleic acid combination 9.

Nucleic acid combination 3 comprises a nucleotide sequence as set forth in SEQ ID NO:5-6 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:19, the specific sequences of which are shown in Table 1.

Nucleic acid combination 3 allows detection of the methylation level of the forward strand of the Chr2:126656382-126656500 region (region 3) on the GYPC gene. The nucleotide sequence of the forward strand of region 3 is as follows (5 '-3'):

GAGCCACGGCCACGGACGCCCTGGTGTCCCGGTCCGTGCCGGGCCTCCAGGCGGAGGAGGCGTCCGCTGGGCTCAGATCCCCGACTCCAGCCCCGGTTCCCCGGCGCCTGGGCTGCGCG(SEQ ID NO：30)

nucleic acid combination 3 can detect methylation of cytosine at positions of the forward strand of region 3, which are designated by Chr2:126656388, chr2:126656394, chr2:126656398, chr2:126656411, chr2:126656416, chr2:126656421, chr2:126656433, chr2:126656486, chr2:126656497, and Chr2: 126656499.

Example 4

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 4 and a nucleic acid combination 9.

Nucleic acid combination 4 comprises a nucleotide sequence as set forth in SEQ ID NO:7-8 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:20, the specific sequences of which are shown in Table 1.

Nucleic acid combination 4 allows detection of the methylation level of the forward strand of the Chr2:126656513-126656595 region (region 4) on the GYPC gene. The nucleotide sequence of the plus strand of region 4 is as follows (5 '-3'):

CGCGTCCCGGACCCCTACGCGCAGCCTCCACGCGCTCCGAGCTGGAGAAGCCGCCAGCCCGCCCTCCCAGGGCGTGTCGCCCG(SEQ ID NO：31)

nucleic acid combination 4 can detect methylation of cytosine at positions of the forward strand of region 4, where Chr2:126656513, chr2:126656515, chr2:126656520, chr2:126656530, chr2:126656543, chr2:126656545, chr2:126656550, chr2:126656564, chr2:126656585, chr2:126656590, and Chr2: 126656594.

Example 5

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 5 and a nucleic acid combination 9.

Nucleic acid combination 5 comprises a nucleotide sequence as set forth in SEQ ID NO:9-10 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:21, the specific sequences of which are shown in Table 1.

Nucleic acid combination 5 can detect the methylation level of the negative strand of the Chr2:126656595-126656463 region (region 5) on the GYPC gene. The nucleotide sequence of the negative strand of region 5 is as follows (5 '-3'):

CGGGCGACACGCCCTGGGAGGGCGGGCTGGCGGCTTCTCCAGCTCGGAGCGCGTGGAGGCTGCGCGTAGGGGTCCGGGACGCGGGACAGGGACTCCGCGCAGCCCAGGCGCCGGGGAACCGGGGCTGGAGTCG(SEQ ID NO：32)

nucleic acid combination 5 can detect methylation of cytosine at positions Chr2:126656595, chr2:126656591, chr2:126656586, chr2:126656546, chr2:126656544, chr2:126656533, chr2:126656531, chr2:126656476, and Chr2:126656464 on the negative strand of region 5.

Example 6

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 6 and a nucleic acid combination 9. Nucleic acid combination 6 comprises a nucleotide sequence as set forth in SEQ ID NO:11-12 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:22, the specific sequences of which are shown in Table 1.

Nucleic acid combination 6 can detect the methylation level of the negative strand of the Chr2:126656443-126656351 region (region 6) on the GYPC gene. The nucleotide sequence of the negative strand of region 6 is as follows (5 '-3'):

CGCCTCCTCCGCCTGGAGGCCCGGCACGGACCGGGACACCAGGGCGTCCGTGGCCGTGGCTCGGCCCCTGGCTGCTGCGGGCCGCGGCCTCCA(SEQ ID NO：33)

Nucleic acid combination 6 can detect methylation of cytosine at positions Chr2:126656443, chr2:126656434, chr2:126656422, chr2:126656417, chr2:126656412, chr2:126656399, chr2:126656366, chr2:126656361, and Chr2:126656359 on the negative strand of region 6.

Example 7

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 7 and a nucleic acid combination 9.

Nucleic acid combination 7 comprises a nucleotide sequence as set forth in SEQ ID NO:13-14 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:23, the specific sequences of which are shown in Table 1.

Nucleic acid combination 7 can detect the methylation level of the negative strand of the Chr2:126656329-126656235 region (region 7) on the GYPC gene. The nucleotide sequence of the negative strand of region 7 is as follows (5 '-3'):

CCACGGCGGGTACTCACCGAGGCTGAGAGGCCACGCCGTGCTGTTGGGGCTTCTCGTCGACCAC ATTCCTGGGCGTCAGCCCGGGCAGAGACCGC(SEQ ID NO：34)

nucleic acid combination 7 can detect methylation of cytosine at positions of Chr2:126656326, chr2:126656323, chr2:126656312, chr2:126656293, chr2:126656275, chr2:126656272, chr2:126656256, chr2:126656248, chr2:126656237, and Chr2:126656235 on the negative strand of region 7.

Example 8

The present embodiment provides a kit for diagnosis or auxiliary diagnosis of gastric cancer, which includes a nucleic acid combination 8 and a nucleic acid combination 9. Nucleic acid combination 8 comprises a nucleotide sequence as set forth in SEQ ID NO:15-16 and the nucleotide sequence corresponding to the primer pair are shown as SEQ ID NO:24, the specific sequences of which are shown in Table 1.

Nucleic acid combination 8 can detect the methylation level of the negative strand of the Chr2:126656205-126656125 region (region 8) on the GYPC gene. The nucleotide sequence of the negative strand of region 8 is as follows (5 '-3'):

CCGGGGGAGGGTCGCGCTCCCGGGCTCCTGACCCTCGGCGGCGAGAGGAAGCGGCACCTGGGTCACACTCCTCCCGCGCGG(SEQ ID NO：35)

nucleic acid combination 8 can detect methylation of cytosine at positions of chr2:126656204, chr2:126656193, chr2:126656191, chr2:126656170, chr2:126656167, chr2:126656164, chr2:126656131, chr2:126656129, chr2:126656127 on the forward strand of region 8.

Table 1 primer and probe sequences for each region of target Gene

/>

Example 9

This embodiment provides a method for diagnosing or aiding diagnosis of gastric cancer using any one or more of the kits of embodiments 1-8, comprising the steps of:

1. extraction of DNA template:

for tissue samples, QIAamp DNA FFPE Tissue Kit (56404) was used to extract DNA, and the specific procedure was performed according to the kit instructions.

For blood samples, plasma cfDNA extraction was performed using a magnetic bead serum/plasma free DNA (cfDNA) extraction kit (DP 709) from the company of the biochemical technology of the root of the heaven limited company, the specific procedure was performed according to the kit instructions. In addition, the extraction of the genomic DNA of the leucocytes was carried out using the blood/cell/tissue genomic DNA extraction kit (DP 304) from Tiangen Biochemical technology (Beijing) limited, see kit instructions for specific procedures.

2. Conversion of bisulphite

The extracted sample genome is subjected to bisulphite conversion, and the nucleic acid conversion kit is a nucleic acid conversion reagent (Huhan mechanical preparation 20200843) of the life technology Co.Ltd.Wohan Ai Misen, and specific experimental operation is described in the specification of the kit.

3. Methylation quantitative PCR reaction

The sample DNA after bisulfite conversion was used as a template, and the primers and probes in table 1 were used to prepare a reaction system according to the formulation of table 2, and a methylation quantitative PCR reaction was performed using Invitrogen Platinum II Taq hot start DNA polymerase, with the PCR reaction conditions shown in table 3. Each PCR reaction can detect the methylation level of a region of the GYPC gene in a sample, i.e., a reaction tube is added with a detection primer and probe corresponding to the target gene region, and also with a primer and probe of the internal reference gene ACTB, in addition to the necessary reaction components and templates. The probe of the detection target area is a Taqman probe, the reporter group at the 5 'end is FAM, the quenching group at the 3' end is MGB, the reporter group at the 5 'end of the ACTB probe is VIC, and the quenching group at the 3' end is BHQ1.

TABLE 2 ingredient list of each component formulation in PCR reaction System

TABLE 3 PCR reaction conditions

Negative and positive controls: when different areas of the target gene are detected respectively, the negative control and the positive control are detected synchronously. The negative control was purified water. The positive control preparation method comprises the following steps: and (3) artificially synthesizing the sequence which corresponds to the amplified region of the ACTB and is subjected to complete conversion by the bisulphite, and cloning the sequence onto a vector to form an artificially synthesized plasmid. The sequence corresponding to the completely methylated GYPC gene region 1-8 after bisulfite conversion is artificially synthesized and cloned to a vector respectively to form an artificially synthesized plasmid. Positive control of GYPC Gene region 1-8 was 10 ³ Copy/microliter ACTB synthetic plasmid and 10 ³ Copy/microliter of synthetic plasmids 1:1 of regions 1-8 were mixed, e.g., region 1 positive control was 10 ³ Copy/microliter ACTB synthetic plasmid and 10 ³ Copy/microliter of region 1 synthetic plasmid 1:1 were mixed.

Ct value reading: after the PCR is completed, a baseline is adjusted, a fluorescence value before a minimum Ct value of a sample in one PCR is advanced by 1-2 cycles is set as a baseline value, and a threshold value is set at the inflection point of an S-type amplification curve to obtain Ct values of all genes of the sample.

And (3) quality control: the negative control needs no amplification, the positive control needs a significant exponential growth period, and the Ct value of the positive control is between 26 and 30. The Ct value of the reference gene of the sample to be detected is less than or equal to 35, and after the negative control, the positive control and the reference gene meet the requirements, the experiment is effective, and the next sample result can be judged. Otherwise, when the experiment is invalid, the detection is needed again.

4. Analysis of PCR results

Result analysis and interpretation method: for a tissue sample, if the Ct value of a certain detection area on the sample is less than or equal to 38, namely the sample is considered to be detected to be methylated in the detection area, and if the Ct value of a certain detection area on the sample is more than 38, the sample is considered to be methylation negative in the detection area; for plasma samples, ROC (receiver operating characteristic curve) analysis was performed on gastric cancer patient samples and healthy human samples based on Ct values, recording sensitivity, specificity and AUC values at maximum about the mount index (Youden's index).

Experimental example 9

Cancer tissue samples of 58 gastric cancer patients and corresponding 58 paracancerous tissue samples were collected in a certain wuhan hospital, all of which were formalin-immersed, paraffin-embedded tissue samples. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized. Samples were subjected to genome extraction and bisulfite conversion as described in example 9, and the methylation status of each sample in each region was detected by PCR amplification using the primer pair and probe pair regions 1-8 in Table 1, respectively, in this example, the sensitivity was the proportion of methylation positives in samples positive for pathological results and the specificity was the proportion of methylation negatives in samples negative for pathological results. The PCR detection results are shown in Table 4.

TABLE 4 sensitivity and specificity of GYPC Gene regions 1-8 in tissue samples

As can be seen from Table 4, GYPC gene regions 1-8 showed different effects in detecting gastric cancer tissue samples and paracancestral tissue samples. Overall, the sensitivity of GYPC gene regions 1-8 in gastric cancer tissue samples was higher than 60% and their specificity in paracancerous tissue samples was higher than 62%. In addition, the sensitivity and specificity of GYPC gene region 2 (Chr 2: 126656237-126656378) and region 7 (Chr 2: 126656329-126656235) for detecting tissue samples are significantly higher than those of other regions, the sensitivity of these 2 regions in gastric cancer tissue samples is greater than 81%, and the specificity in paracancerous tissues is greater than 81%, so that the GYPC gene region Chr2:126656237-126656378 has better detection effect.

Experimental example 2

The plasma samples of gastric cancer patients and the healthy human plasma samples which are confirmed by tissue biopsy are respectively collected in a Wuhan hospital, 5mL of each patient is collected, and 85 cases of the plasma samples of gastric cancer patients and 104 cases of the healthy human plasma samples are collected. All samples were approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized. Plasma cfDNA extraction and bisulfite conversion were performed as provided in example 9, methylation quantitative PCR experiments were performed using specific primer and probe combinations for GYPC gene regions 1-8 of examples 1-8, ROC analysis was performed based on the Ct values obtained, and sensitivity, specificity and AUC values of gastric cancer patients were statistically determined using the methylation level of each region, as shown in table 5 and fig. 1.

TABLE 5 sensitivity, specificity and AUC values of GYPC Gene regions 1-8 in plasma samples

GYPC	Sensitivity of	Specificity (specificity)	AUC values
				Zone 1	64.7％	78.8％	0.721
Zone 2	80.0％	88.5％	0.844
				Zone 3	74.1％	81.7％	0.784
Zone 4	72.9％	81.7％	0.769
				Zone 5	76.5％	79.8％	0.785
Zone 6	70.6％	82.7％	0.756
				Zone 7	84.7％	82.7％	0.847
Zone 8	67.1％	80.8％	0.757

As can be seen from Table 5, the GYPC gene regions 1-8 can realize better differentiation between gastric cancer plasma samples and healthy human plasma samples, the AUC values detected in the regions are all above 0.72, the detection sensitivity is above 64%, and the specificity is above 78%. The AUC values detected in GYPC gene region 2 and region 7 are obviously higher than those in other regions by more than 0.84, and in a plasma sample, the detection sensitivity of the 2 regions to gastric cancer is more than or equal to 80%, the specificity is more than 80%, so that the detection effect of the GYPC gene region Chr2:126656237-126656378 is better than that of the whole CpG island.

The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above-described embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.

The above examples merely represent a few embodiments of the present application, which facilitate a specific and detailed understanding of the technical solutions of the present application, but are not to be construed as limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Further, it is understood that various changes and modifications of the present application may be made by those skilled in the art after reading the above teachings, and equivalents thereof are intended to fall within the scope of the present application. It should also be understood that, based on the technical solutions provided by the present application, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted as illustrative of the contents of the claims.

Sequence listing

<110> Wuhan Ai Misen life technologies Co., ltd

<120> application of reagent for detecting methylation level of GYPC gene CpG island region

<160> 35

<170> SIPOSequenceListing 1.0

<210> 1

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aacggttcgc gcggga 16

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tcaacccgaa caaaaaccgc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggtttttgtt cgggttgacg 20

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ccctaactac tacgaaccgc g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gagttacggt tacggacgtt ttg 23

<210> 6

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atcgcgcaac ccaaacg 17

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

acgcgtttcg gatttttacg 20

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cgaacgacac gccctaaaa 19

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tcgggcgata cgttttgg 18

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

acgactccaa ccccgattc 19

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

cgtttttttc gtttggaggt tc 22

<210> 12

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

taaaaaccgc gacccgc 17

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ttacggcggg tatttatcga g 21

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gcgatctcta cccgaactaa cg 22

<210> 15

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ttcgggggag ggtcgc 16

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ccgcgcgaaa aaaatataac c 21

<210> 17

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

cgagggttag gagttcggga gcg 23

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

tttcggtgag tattcgtcgt gggga 25

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

cggttcgtgt cgggttttta ggc 23

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

cgcgtttcga gttggagaag tcg 23

<210> 21

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

gcgcgtggag gttgcgcg 18

<210> 22

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

ggtacggatc gggatattag ggcg 24

<210> 23

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

gtcgtgttgt tggggttttt cgtcg 25

<210> 24

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

ttttgatttt cggcggcgag ag 22

<210> 25

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

aaggtggttg ggtggttgtt ttg 23

<210> 26

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

aataacaccc ccaccctgc 19

<210> 27

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

ggagtggttt ttgggtttg 19

<210> 28

<211> 134

<212> DNA

<213> person (Homo sapiens)

<400> 28

cggcccgcgc gggaggagtg tgacccaggt gccgcttcct ctcgccgccg agggtcagga 60

gcccgggagc gcgaccctcc cccggcccgg cctggcccgg cctggccagt ccccgcggtc 120

tctgcccggg ctga 134

<210> 29

<211> 142

<212> DNA

<213> person (Homo sapiens)

<400> 29

ggtctctgcc cgggctgacg cccaggaatg tggtcgacga gaagccccaa cagcacggcg 60

tggcctctca gcctcggtga gtacccgccg tggggaaggg tcctggggac ccactggagg 120

ccgcggcccg cagcagccag gg 142

<210> 30

<211> 119

<212> DNA

<213> person (Homo sapiens)

<400> 30

gagccacggc cacggacgcc ctggtgtccc ggtccgtgcc gggcctccag gcggaggagg 60

cgtccgctgg gctcagatcc ccgactccag ccccggttcc ccggcgcctg ggctgcgcg 119

<210> 31

<211> 83

<212> DNA

<213> person (Homo sapiens)

<400> 31

cgcgtcccgg acccctacgc gcagcctcca cgcgctccga gctggagaag ccgccagccc 60

gccctcccag ggcgtgtcgc ccg 83

<210> 32

<211> 133

<212> DNA

<213> person (Homo sapiens)

<400> 32

cgggcgacac gccctgggag ggcgggctgg cggcttctcc agctcggagc gcgtggaggc 60

tgcgcgtagg ggtccgggac gcgggacagg gactccgcgc agcccaggcg ccggggaacc 120

ggggctggag tcg 133

<210> 33

<211> 93

<212> DNA

<213> person (Homo sapiens)

<400> 33

cgcctcctcc gcctggaggc ccggcacgga ccgggacacc agggcgtccg tggccgtggc 60

tcggcccctg gctgctgcgg gccgcggcct cca 93

<210> 34

<211> 95

<212> DNA

<213> person (Homo sapiens)

<400> 34

ccacggcggg tactcaccga ggctgagagg ccacgccgtg ctgttggggc ttctcgtcga 60

ccacattcct gggcgtcagc ccgggcagag accgc 95

<210> 35

<211> 81

<212> DNA

<213> person (Homo sapiens)

<400> 35

ccgggggagg gtcgcgctcc cgggctcctg accctcggcg gcgagaggaa gcggcacctg 60

ggtcacactc ctcccgcgcg g 81

Claims

1. The application of the reagent for detecting the methylation level of the GYPC gene CpG island region in preparing a gastric cancer diagnosis kit.

2. The use according to claim 1, wherein the GYPC gene CpG island region comprises Chr2:126656121-126656595 with reference to grch 38.p13.

3. The use according to claim 2, wherein the GYPC gene CpG island region is selected from one or more of regions 1 to 8 defined as follows:

region 1: chr2:126656121-126656254, positive strand;

region 2: chr2:126656237-126656378, positive strand;

region 3: chr2:126656382-126656500, positive strand;

region 4: chr2:126656513-126656595, positive strand;

region 5: chr2, 126656595-126656463, negative strand;

region 6: chr2, 126656443-126656351, negative strand;

region 7: chr2, 126656329-126656235, negative strand;

region 8: chr2:126656205-126656125, negative strand.

4. A use according to any one of claims 1 to 3, wherein the reagent effects detection of the methylation level of the region by one or more of the following methods: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrosequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, methylation-sensitive restriction endonuclease, and fluorescent quantitation.

5. The use according to claim 4, wherein the reagent comprises a pair of detection primers for detecting one or more of the CpG island regions 1 to 8 of the GYPC gene and a detection probe corresponding to the pair of detection primers.

6. The use according to claim 5, wherein the detection primer pair and the detection probe corresponding to the detection primer pair comprise one or more of the following combinations:

7. The use according to claim 5, wherein the reagent further comprises a primer pair for detecting an internal reference gene comprising an ACTB gene and a probe corresponding to the primer pair, the primer pair for detecting the ACTB gene comprising primers shown in SEQ ID nos. 25-26, and the probe corresponding to the primer pair is shown in SEQ ID No. 27.

8. The use according to any one of claims 5 to 7, wherein the detection probes and the control probes are labelled with a fluorescent reporter group and a fluorescence quencher group.

9. The use according to any one of claims 1 to 3 and 5 to 7, wherein the reagent further comprises one or more of a DNA extraction reagent and a reagent for converting unmethylated cytosine bases to uracil.

10. A kit for diagnosing gastric cancer, comprising the reagent as defined in any one of claims 1 to 9, an amplification buffer, dNTPs, a DNA polymerase and Mg ²⁺ One or more of the following.