CN110964812B

CN110964812B - Application of HOXA9 methylation detection reagent in preparation of lung cancer diagnosis reagent

Info

Publication number: CN110964812B
Application number: CN201811152029.6A
Authority: CN
Inventors: 赵荣淞; 牛智通; 李仕良; 黄龙武; 吴幽治; 邹鸿志
Original assignee: Guangzhou Kangliming Biotechnology Co ltd
Current assignee: Guangzhou Kangliming Biotechnology Co ltd
Priority date: 2018-09-29
Filing date: 2018-09-29
Publication date: 2021-10-22
Anticipated expiration: 2038-09-29
Also published as: TWI789551B; TW202028473A; WO2020063899A1; CN110964812A

Abstract

The invention belongs to the field of gene diagnosis, and relates to an application of a detection reagent taking the methylation of HOXA9 as a detection object in preparing a lung cancer diagnostic reagent. According to the invention, HOXA9 is used as a tumor marker for detecting lung cancer, the sensitivity of the tumor marker in sputum is up to 74.3%, the specificity of the tumor marker is up to 95%, the detection sensitivity of the tumor marker is higher than that of the tumor marker for lung cancer reported in the prior art, the sensitivity of the tumor marker in lavage fluid is up to 61.9%, the specificity of the tumor marker is up to 95%, especially for adenocarcinoma, the sensitivity of the tumor marker is greatly improved, and the tumor marker has great application value for detecting and diagnosing adenocarcinoma.

Description

Application of HOXA9 methylation detection reagent in preparation of lung cancer diagnosis reagent

Technical Field

The invention belongs to the field of gene diagnosis, and particularly relates to an application of a human HOXA9 gene methylation diagnosis reagent in preparation of a lung cancer diagnosis reagent and a human HOXA9 gene methylation detection method.

Technical Field

Lung cancer is a malignant tumor of the lung that originates in the bronchial mucosa, glands or alveolar epithelium. The classification can be made according to the type of pathology: 1. small Cell Lung Cancer (SCLC): one particular pathological type of lung cancer has a marked propensity to metastasize at distant sites, with a poor prognosis, but most patients are sensitive to chemotherapy and radiotherapy. 2. Non-small cell lung cancer (non-small cell lung cancer, NSCLC): other pathological types of lung cancer besides small cell lung cancer include squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and the like. There are certain differences in biological behavior and clinical course. According to the occurrence position, the method can be divided into the following steps: 1. central lung cancer (central lung cancer): lung cancer that grows in the segmental bronchiectasis and above. 2. Peripheral lung cancer (periheral lung cancer): lung cancer that grows beyond the bronchial opening of the segment.

In recent years, the incidence and mortality of the lung cancer in China are gradually increased year by year due to the influence of factors such as aging population, air pollution, smoking and the like, and according to the annual report of 2017 Chinese tumor registration issued by the national cancer center, about 7 people per minute are diagnosed with the cancer nationally, wherein the incidence and mortality of the lung cancer are the first. China has become the world with the largest number of lung cancers, and experts predict that the number of lung cancers in China will reach 100 ten thousand in 2025. And according to epidemiological studies show that: smoking is an important factor causing lung cancer. About 80% -90% of lung cancers worldwide can be attributed to smoking. Compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day in the age of 45-64 years have relative risk of lung cancer of 4.27 and 8.61 respectively, and compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day for a long time have relative risk of lung cancer death of 6.14 and 10.73 respectively. Although the treatment technology of the lung cancer is changed day by day, the 5-year survival rate is only increased from 4% to about 12%, the existing antitumor drugs still only have the function of relieving the disease condition, the non-progress survival time of the patient is only prolonged by 3 months to 5 months on average, and for the first-stage lung cancer patient, the 5-year survival rate after the operation is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective methods for improving 5-year survival rate and reducing mortality rate of lung cancer.

The current clinical auxiliary diagnosis of lung cancer mainly comprises the following diagnosis methods, but the diagnosis methods cannot completely realize early detection and early diagnosis:

1. biochemical examination of blood: for primary lung cancer, there is currently no specific blood biochemical examination. The increase of blood alkaline phosphatase or blood calcium in lung cancer patients takes into account the possibility of bone metastasis, and the increase of blood alkaline phosphatase, glutamic-oxalacetic transaminase, lactate dehydrogenase or bilirubin takes into account the possibility of liver metastasis.

2. Tumor marker examination: (1) CEA: abnormally high levels of CEA are found in the serum of 30-70% of lung cancer patients, but are found mainly in later stage lung cancer patients. The current examination of CEA in serum is mainly used to estimate lung cancer prognosis and to monitor the course of treatment. (2) NSE: the kit is a preferred marker for small cell lung cancer, is used for diagnosing the small cell lung cancer and monitoring the treatment response, and has different reference values according to different detection methods and used reagents. 3) CYFRA 21-1: the first choice marker of the non-small cell lung cancer has the sensitivity of 60 percent on the diagnosis of the squamous cell lung cancer, and the reference value is different according to different detection methods and used reagents.

3. Imaging examination: (1) chest X-ray examination: chest orthoses and lateral pieces should be included. In primary hospitals, the positive chest radiograph is still the most basic and preferred image diagnosis method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT examination is performed. (2) And (3) CT examination: chest CT is the most common and important examination method for lung cancer, and is used for diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. The scope of a conditional hospital should include the adrenal gland during a chest CT scan of a lung cancer patient. Enhanced scanning should be used as much as possible, especially for patients with lung center type lesions. CT is the basic examination method for displaying brain metastasis, and patients with clinical symptoms or patients in the advanced stage should perform brain CT scanning and adopt enhanced scanning as much as possible. CT guided lung biopsy is an important diagnostic technique for lung cancer, and a conditional hospital can be used for the diagnosis of lung lesions which are difficult to characterize and the clinical diagnosis of lung cancer needs cytological and histological verification and other methods are difficult to obtain materials. (3) Ultrasonic examination: the kit is mainly used for finding whether the vital organs of the abdomen, the abdominal cavity and the retroperitoneal lymph nodes are transferred or not, and is also used for detecting the cervical lymph nodes. For lung lesions or chest wall lesions close to the chest wall, the cyst solidity can be identified and puncture biopsy can be carried out under ultrasonic guidance; ultrasound is also commonly used for pleural effusion extraction positioning. (4) Bone scanning: the sensitivity to the detection of the bone metastasis of the lung cancer is high, but the false positive rate is certain. The following can be used: preoperative examination of lung cancer; patients with local symptoms.

4. Other checks: (1) sputum cytology examination: the lung cancer is a simple and convenient noninvasive diagnosis method at present, the positive rate can be improved by about 60 percent through continuous smear examination, and the method is a routine diagnosis method for suspicious lung cancer cases. (2) Fiberbronchoscopy: one of the most important means in lung cancer diagnosis plays an important role in the qualitative and localized diagnosis of lung cancer and the selection of surgical schemes. Is a necessary routine examination item for a patient to be treated by surgery. And the bronchoscopy biopsy (TBNA) is beneficial to staging before treatment, but the technical difficulty and risk are higher, so that a person in need should go to a higher hospital for further examination. (3) And others: such as percutaneous lung puncture biopsy, thoracoscope biopsy, mediastinoscopic biopsy, hydrothorax cytology examination, etc., under the condition of an adaptation, the diagnosis can be assisted according to the existing conditions.

Multi-slice helical CT and Low Dose CT (LDCT) in imaging examinations are effective screening tools for finding early lung cancer and reducing mortality, and the national lung cancer screening study (NLST) in the united states has shown that LDCT can reduce mortality of 20% of lung cancer compared to chest X-ray screening. In clinical practice work, the success or failure of any lung cancer screening project is proved to depend on the identification of high risk groups, and a risk prediction model fusing multiple high risk factors is universally accepted as one of the methods for identifying the high risk groups of lung cancer. The risk model further improves the efficacy of lung cancer patients by assisting clinicians in improving interventions or treatments. Although the world has agreed that screening for high risk populations could reduce the current high mortality rate of lung cancer, high risk population definition remains an elusive problem. In order to maximize the benefit-to-injury ratio of lung cancer screening, the first critical issue is how to define the population at high risk; and secondly, screening the population by using what method, including definition of high risk factors, quantitative summarization of overall risks and selection of screening benefit threshold.

With the rapid development of the technology, the tumor marker detection becomes a new field of tumor diagnosis and treatment after the imaging diagnosis and the pathological diagnosis, and can have great influence on the diagnosis, the detection and the treatment of tumors. The tumor marker can be detected in body fluid or tissues and can reflect the existence, differentiation degree, prognosis estimation, personalized medicine, treatment effect and the like of tumors. Early lung cancer patients have no obvious symptoms and are difficult to detect by doctors and patients, and in addition, the early lung cancer patients have no obvious specific markers on blood or biochemical projects, so that early detection and early diagnosis are difficult to perform through a conventional diagnosis method, and the early lung cancer diagnosis, especially the screening of large-scale application population is difficult.

More and more studies have shown that two broad classes of mechanisms are involved in the process of tumor formation. One is the formation of mutations by changes in the nucleotide sequence of the DNA, a genetic mechanism. Tumors have been identified in the field of molecular biology as a genetic disease. Another is the epigenetic (epigenetics) mechanism, i.e., the change of gene expression level independent of DNA sequence change, and the role of it in the process of tumor formation is increasingly emphasized. The two mechanisms of genetics and epigenetics exist in a mutual crossing way, and the formation of tumors is promoted together. Aberrant methylation of genes occurs early in tumorigenesis and increases in the course of tumor progression. Analysis of the genome of 98 common primary human tumors revealed at least 600 abnormally methylated CpG islands per tumor.

Many studies have shown that promoter abnormal methylation is a frequent early event in the development of many tumors, and thus the methylation status of tumor-associated genes is an early sensitive indicator of tumorigenesis and is considered to be a promising molecular biomarker (biomarker). More importantly, the cancerous cells can release DNA into the peripheral blood. Free DNA is present in normal human peripheral blood on the nanogram scale. The research finds that abnormal methylation of the promoter of the tumor-related gene existing in the tumor tissue can be detected in peripheral blood plasma/serum and tumor-involved organ-related body fluid (such as saliva, sputum and the like). The biological samples are easy to obtain, and DNA in the biological samples can be sensitively detected after being massively amplified by a PCR technology, so that the methylation state of the promoter regions of certain tumor-related genes can be detected, and very valuable information can be provided for early diagnosis of tumors. There are many advantages to detecting promoter abnormal methylation compared to other types of tumor molecular markers. The abnormal methylation of a certain gene is a positive signal compared with a marker of allele deletion, and is easily distinguished from the negative background in normal tissues. Esteller et al examined the abnormal methylation state of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in 22 cases of non-small cell lung cancer (NSCLC) tumor tissues and serum, and found that 68% (15/22) tumor tissues have promoter methylation of at least one gene; in 15 cases of tissue positivity, the presence of abnormal promoter methylation was also detected in the serum in 11 cases. In addition, many researchers have also detected the methylation of the promoters of some tumor-related genes from tumor tissues and sera of patients with liver cancer, head and neck cancer, esophageal cancer and colon cancer, respectively.

The existing lung cancer detection technology is mainly low in sensitivity, high in false positive and invasive, and the existing conventional detection technology is difficult to detect early lung cancer.

Noninvasive detection of lung cancer, such as sputum, is more difficult. Although some researchers research the tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is very low when compared with the detection and evaluation of tumor markers of blood samples of other tumor patients. This is mainly due to the following reasons: firstly, the components of the sputum are relatively complex, and the differences of the components, the viscosity and the like of the sputum are relatively large under different diseases or environments of different people; sputum contains more components of non-lung cancer cells such as tracheal epithelial cells, bacteria, oral mucosa cells and the like, and a general sample processing method cannot effectively enrich sufficient DNA from lung cancer sources; ③ many smoking patients do not show expectoration. A study of the past 10 references by AJ Hubers et al in Molecular analysis for the diagnosis of lung cancer revealed that the median methylation degree of markers in lung cancer tissues was 48%, while the median methylation degree of sputum was 38%, and the results showed that the detection rate of methylated markers in tissues was significantly higher than that of sputum. Meanwhile, Rosalia cirrinone (Methylation profile in tumor and particulate samples of lung cancer treated by particulate computer-treated Methylation) reported that the detection rates of RARBeta2, P16 and RASSF1A in lung cancer tissues reach 65.5%, 41.4% and 51.7%, respectively, while the detection rates in sputum are only 44.4%, 5% and 5%, respectively.

At present, the omission rate of lung cancer is high. Especially, for the adenocarcinoma type, noninvasive detection of sputum is more difficult and has extremely low detection rate. This is because most of adenocarcinoma originates in small bronchi, and is peripheral lung cancer, and exfoliated cells in the deep lung are more difficult to expectorate by sputum. Therefore, the sputum detection means of the adenocarcinoma is almost zero at present.

Reducing the miss rate is particularly important in early tumor screening. If an early tumor screening product cannot screen all or most patients, missed patients will not be prompted with sufficient risk, thereby delaying the opportunity for treatment, which is a significant loss to the patient.

Although some tumor markers related to lung cancer have been found in the prior art, the detection reagent or detection means for these tumor markers are limited, so that the sensitivity and specificity of these tumor markers cannot meet the requirement, and therefore, further research on screening means capable of being applied to lung cancer in a practical manner is still needed in the art. However, while non-invasive screening has the unique advantage of sampling, it also has some limitations in other areas, for example, adenocarcinoma in lung cancer, which is generally considered by those skilled in the art to be unsuitable for non-invasive screening, due to the difficulty of expectoration of exfoliated cells from deep lung portions by sputum. On the other hand, even for other types of lung cancer, the non-invasive screening method reported at present is difficult to meet the requirements of clinical use. Although relevant research has progressed for many years, there is no noninvasive screening method for lung cancer that can be clinically advanced to date.

Disclosure of Invention

The invention aims to provide an application of a methylation detection reagent of a lung cancer tumor marker in preparing a lung cancer diagnosis reagent.

Another object of the present invention is to provide a method for detecting a tumor marker of lung cancer, which is less sensitive than a tumor marker of lung cancer in a tissue, in sputum and lavage fluid.

The invention also aims to provide application of a detection reagent for methylation of tumor markers with high sensitivity and specificity to adenocarcinoma in sputum and lavage fluid in preparing a lung cancer diagnostic reagent.

It is another object of the present invention to provide a method for detecting methylation of the HOXA9 gene.

The above object of the present invention is achieved by the following technical means:

the inventors have conducted extensive studies and have revealed a method for detecting methylation of a gene, which is human HOXA9 gene, to improve the detection rate of lung cancer. The inventors have not only demonstrated that detecting HOXA9 methylation in tissue samples has higher specificity and sensitivity for lung cancer detection, but also demonstrated that it has the same high specificity and sensitivity in sputum samples and lavage fluid samples. The inventor also optimizes the PCR amplification reaction procedure and further improves the detection effect. The inventors also optimized reagents and detection methods for detecting methylated DNA of the HOXA9 gene.

The invention provides an application of a detection reagent of HOXA9 gene methylation in preparing a lung cancer diagnostic reagent.

The HOXA9 gene is a member of the HOX (homeobox) gene family, belongs to the HOXA cluster gene on chromosome 7p15-p14, and like other HOX genes, contains a 180bp DNA fragment, transcribes a homology domain consisting of 60 amino acids. HOXA9 is a transcription regulation factor with coding sequence specificity, and has important functions in the space-time development of embryo, cell differentiation, proliferation and migration, malignant tumor evolution and apoptosis induction. At present, the abnormal expression of HOXA9 plays an important role in the occurrence and development of leukemia, and some cancers such as lung cancer and human glioma related to HOXA9 gene are reported.

Wherein the detection reagent for detecting the methylation of the HOXA9 gene detects the sequence of the HOXA9 gene modified by the transformation reagent. Wherein the conversion reagent is a reagent which deaminates cytosine in DNA to uracil while leaving 5-MeC substantially unaffected. Exemplary conversion reagents include one or more of a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a compound that generates a hydrazine salt, a bisulfite salt under appropriate reaction conditions. As an exemplary embodiment, the detection reagent for methylation of the HOXA9 gene detects a sequence modified by bisulfite.

Methylation is caused by adding one more methyl group on cytosine, and cytosine can be changed into uracil after being treated by bisulfite or hydrazinate, because uracil is similar to thymine and can be identified as thymine when PCR amplification is carried out, namely cytosine which is not methylated is changed into thymine (C is changed into T) on a PCR amplification sequence, and methylated cytosine (C) is not changed. The technique for detecting methylated genes by PCR is usually Methylation Specific PCR (MSP), wherein primers are designed for the treated methylated fragments (i.e., unchanged C in the fragments), PCR amplification is carried out, if amplification exists, methylation is indicated, and if amplification does not exist, methylation does not exist.

As an alternative embodiment, the detection region of the HOXA9 gene to which the detection reagent for methylation of the HOXA9 gene is directed is a CG-rich region or a non-CG-rich region or a CTCF (CTCF-binding sites) region of the HOXA9 gene. In a preferred embodiment, the detection region to which the detection reagent for methylation of HOXA9 gene is directed is a CG-rich region or CTCF (CTCF-binding sites) region of HOXA9 gene.

Alternatively, the detection region of the detection reagent for detecting the methylation of the HOXA9 gene aiming at the HOXA9 gene is the HOXA9 gene body or the promoter region thereof.

As a preferred embodiment of the present invention, the detection reagent for methylation of the HOXA9 gene comprises, for the detection region, SEQ ID NO: 22 (region 1), SEQ ID NO: 24 (region 2) or SEQ ID NO: 26 (region 3). As a more preferred embodiment, the reagent comprises SEQ ID NO: 22, or a sequence shown in fig. 22.

The inventor finds that the selection of the HOXA9 gene detection region can affect the detection efficiency of the tumor, the detection results of the primer pairs designed in different regions are obviously different according to the primer designed in the CG enrichment region of the HOXA9 gene, and the detection rate of the good region to the tumor is 50-60% higher than that of the poor region. The inventor finds that the detection result of the GC enrichment region or the CTCF (CTCF-binding sites) region is obviously better than that of the non-hypermethylated region through experimental comparison.

The reagent for detecting methylation of the HOXA9 gene comprises an amplification primer. As an alternative embodiment, the primer is selected from SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 33. SEQ ID NO: 34. SEQ ID NO: 36. SEQ ID NO: 37. SEQ ID NO: 39. SEQ ID NO: 40. SEQ ID NO: 42. SEQ ID NO: 43. SEQ ID NO: 45. SEQ ID NO: 46. SEQ ID NO: 48. SEQ ID NO: 49. SEQ ID NO: 51. SEQ ID NO: 52. SEQ ID NO: 54. SEQ ID NO: 55. SEQ ID NO: 57. SEQ ID NO: 58. As a preferred embodiment, the primer is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

The reagent for detecting methylation of HOXA9 gene of the present invention further comprises a probe. As an alternative embodiment, the probe is as set forth in SEQ ID NO: 3. SEQ ID NO: 32. SEQ ID NO: 35. SEQ ID NO: 38. SEQ ID NO: 41. SEQ ID NO: 44. SEQ ID NO: 47. SEQ ID NO: 50. SEQ ID NO: 53. SEQ ID NO: 56 or SEQ ID NO: shown at 59. In a preferred embodiment, the probe is as set forth in SEQ ID NO: 3, respectively. As a preferred mode of the present invention, for convenience of clinical use, the fluorescent group labeled with the detection probe may be VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; the quenching group can be TAMRA, BHQ, MGB, Dabcyl and the like, so that the method is suitable for a multi-channel PCR detection system commonly used for clinical detection at present and realizes multicolor fluorescence detection in one reaction tube.

As a preferred embodiment, the reagent for detecting methylation of HOXA9 gene of the present invention comprises SEQ ID NO: 1 and SEQ ID NO: 2 and the primer pair shown as SEQ ID NO: 3, or a salt thereof.

As an alternative embodiment, the inventive detection of methylation of the HOXA9 gene further comprises bisulfite, bisulfite or hydrazonium salts for modification of methylated cytosine in HOXA9 to thymine. Of course, the reagent of the present invention may not be contained. Can be purchased independently when used.

As an alternative embodiment, the detection of methylation of the HOXA9 gene of the invention further comprises DNA polymerase, dNTPs, Mg²⁺One or more of ions and buffer solution; preferably, the DNA polymerase, dNTPs and Mg are contained²⁺Ions and buffer for carrying out amplification reaction on HOXA9 gene.

As an alternative embodiment, the present invention also contains a detection reagent for detecting methylation of the HOXA9 gene. Preferably, the reference gene is beta-actin or COL2A1, and in addition to these two reference genes, other methylation detection reference genes of the prior art can be used. Furthermore, the detection reagent of the reference gene beta-actin contains a primer and a probe aiming at the reference gene. In a preferred embodiment, the detection reagent for the reference gene comprises SEQ ID NO: 16. SEQ ID NO: 17, and the primer set shown in SEQ ID NO: 18 in the above list. The detection reagent of the reference gene COL2A1 comprises SEQ ID NO: 60(TTTTGGATTTAAGGGGAAGATAAA), SEQ ID NO: 61(TTTTTCCTTCTCTACATCTTTCTACCT), and the primer set of SEQ ID NO: 62 (AAGGGAAATTGAGAAATGAGAGAAGGGA).

In another aspect, the present invention provides a method for detecting DNA methylation of the HOXA9 gene, comprising the steps of:

(1) processing a sample to be detected by bisulfite or hydrazine to obtain a modified sample to be detected;

(2) and (3) carrying out HOXA9 gene methylation detection on the modified sample to be detected in the step (1) by using the HOXA9 gene methylation detection.

Alternatively, detection is performed using methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific PCR (qssp). Other DNA methylation detection methods reported in the prior art can also be applied to the present invention. Methylation detection methods of the prior art are incorporated into the present invention by the USSN62/175,916 patent.

In another aspect, the present invention provides a system for detecting/diagnosing/prognosing lung cancer, comprising:

a means for detecting DNA methylation of the HOXA9 gene, and,

b. and a result judging means.

Preferably, the DNA methylation detection component of the HOXA9 gene comprises a detection reagent for detecting the methylation of the HOXA9 gene;

preferably, the result judging means is used for outputting the risk of lung cancer and/or the type of lung cancer according to the DNA methylation result of the HOXA9 gene detected by the detecting means;

in a preferred embodiment, the disease risk is determined by comparing the methylation results of the test sample and the normal sample by the result determination component, and when the methylation of the test sample and the methylation of the normal sample have a significant difference or a very significant difference, the result determination component outputs that the disease risk of the test sample is high.

In the present invention, the detection sample of the detection reagent for detecting methylation of HOXA9 gene is selected from sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, prostatic fluid, tears or feces. In a preferred embodiment, the detection sample of the reagent for detecting methylation of HOXA9 gene is selected from sputum, tissue or lung lavage fluid. In a more preferred embodiment, the detection sample of the detection reagent for methylation of HOXA9 gene is selected from sputum or lung lavage fluid.

The methylation level of the HOXA9 gene in the tissue is highly related to the incidence of lung cancer. In 185 tissues, compared with the normal group and the whole lung cancer group of the HOXA9 gene, the specificity is up to 95%, and the sensitivity is 78.6%, although the sensitivity is lower than that of the other tumor marker SHOX2 (sensitivity is 80.6%) gene in the experiment of the invention, the surprising finding is that the methylation level of the HOXA9 gene detected in sputum and lung lavage fluid keeps higher correlation with the onset of lung cancer, and in the sputum, the sensitivity of HOXA9 is 74.3%, and the specificity is 95%; in lung lavage, sensitivity was 61.9% and specificity was 95%.

None of the various molecular markers studied by the inventors was a significant reduction in the detection sensitivity or specificity of sputum samples versus tissue samples. For example, several of SHOX2, PCDHGA12, HOXD8, GATA3 were reported to be associated with lung cancer, with SHOX2 having a detection sensitivity in tissues of 80.6% higher than that of HOXA9, and a sensitivity in sputum that was greatly reduced to 51.4% significantly lower than 74.3% of the HOXA9 gene (note, normal group versus all cancer groups). Therefore, when sputum is used as a sample for detection, the HOXA9 gene is particularly suitable as a tumor marker.

The research finds that the various lung cancer markers only show good detection sensitivity and specificity in tissues; however, in sputum and lung lavage fluid samples, no matter how to design and optimize detection regions, detection primers, probes and the like, the sensitivity is still greatly reduced, and the diagnosis of lung cancer is seriously influenced.

The HOXA9 gene also keeps high sensitivity and specificity of up to 95% in sputum and lung lavage fluid samples, so that the gene can be used as a reliable lung cancer marker in the sputum and lung lavage fluid samples.

In the present invention, the lung cancer is selected from Small Cell Lung Cancer (SCLC) and non-small cell lung cancer (non-small cell lung cancer, NSCLC); further, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma or large cell carcinoma. In a preferred embodiment, the lung cancer is selected from adenocarcinoma.

Experiments prove that the HOXA9 gene has high specificity and high sensitivity in various lung cancers, and has higher sensitivity than other tumor markers even in lung adenocarcinoma, for example, the detection sensitivity of HOXA9 in sputum is 55.6%, and the sensitivity of SHOX2 is 11.1% (see Table 6 in example 2), which further indicates that HOXA9 is particularly suitable for detecting sputum as a detection sample, particularly for detecting lung adenocarcinoma. At present, the omission rate of lung adenocarcinoma is high. On one hand, as the lung adenocarcinoma is easy to occur in women and people who do not smoke, the incidence rate is lower than that of squamous carcinoma and undifferentiated carcinoma, the onset age is smaller, and the number of women is relatively more frequent; on the other hand, most adenocarcinomas originate from small bronchi and are peripheral lung cancers, and exfoliated cells in the deep lung are more difficult to expectorate through sputum; in yet another aspect, early stages of lung adenocarcinoma are generally free of overt clinical symptoms. Therefore, detection of lung adenocarcinoma is more difficult and valuable.

The invention has the beneficial effects that:

1. the invention not only can use the tissue as a detection sample, but also has higher sensitivity in sputum and lung lavage fluid, and can simply and conveniently use the sputum and the lung lavage fluid as the detection sample to reliably diagnose the lung cancer. The sputum sample is very easy to obtain, and does not cause any pain or inconvenience to the patient. The sample volume is very small, the sampling process is very convenient and has no influence on patients. Meanwhile, the sample is convenient to mail or bring to a hospital for examination.

2. The invention is used for detecting various types of lung cancer, and has higher sensitivity relative to other markers aiming at adenocarcinoma which is difficult to detect.

3. The invention does not need to consider the detected object and age and has wide application range.

4. The invention detects and diagnoses cancer through methylation level, more and more researches prove that methylation change is an early event in the tumorigenesis process, and early lesions are easier to detect by detecting methylation abnormality.

Drawings

FIG. 1 ROC curves for detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in all tissue specimens;

FIG. 2 ROC curves for detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in sputum samples;

FIG. 3 ROC curves for detection of HOXA9 and SHOX2-n3 in all sputum specimens;

FIG. 4 shows the amplification curves of HOXA9 and SHOX2_ n3 in sputum specimen (A is the amplification chart of HOXA9, B is the amplification chart of SHOX2_ n 3;

FIG. 5 ROC curves for detection of HOXA9 and SHOX2_ n3 in all lavage samples;

FIG. 6 shows the amplification curves of HOXA9 and SHOX2_ n3 in lavage fluid specimens (A is the amplification chart of HOXA9, and B is the amplification chart of SHOX2_ n 3).

Detailed Description

The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.

The sample to be tested of the present invention comprises: alveolar lavage fluid, tissue from the lesion, pleural fluid, sputum, etc., blood, serum, plasma, urine, prostatic fluid, feces, saliva, tears, etc.

A "primer" or "probe" in the present invention refers to an oligonucleotide comprising a region complementary to a sequence of at least 6 contiguous nucleotides of a target nucleic acid molecule (e.g., a target gene). In some embodiments, the primer or probe comprises a region complementary to a sequence of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous or non-contiguous blocked nucleotides of the target molecule. When a primer or probe comprises a region that is "complementary to at least x consecutive nucleotides of a target molecule," the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

The "diagnosis" of the present invention includes, in addition to early diagnosis of lung cancer, diagnosis of lung cancer in the middle and late stages, and also includes screening of lung cancer, risk assessment, prognosis, disease identification, diagnosis of disease stage, and selection of therapeutic targets.

The use of the lung cancer marker HOXA9 enables early diagnosis of lung cancer. When it is determined that a gene methylated in cancer cells is methylated in cells that are clinically or morphologically normal in appearance, this indicates that the cells in the normal appearance are progressing toward cancer. Thus, lung cancer can be diagnosed at an early stage by methylation of the lung cancer specific gene HOXA9 in normally represented cells.

As an alternative to stage diagnosis of the condition, diagnosis may be made by measuring the degree of methylation of HOXA9 obtained from a sample as it progresses through different stages or stages of lung cancer. A particular stage of lung cancer in a sample can be detected by comparing the degree of methylation of the HOXA9 gene of nucleic acids isolated from the sample at each stage of lung cancer to the degree of methylation of the HOXA9 gene of one or more nucleic acids isolated from the sample in lung tissue free of cell proliferative abnormalities.

Example 1: detection of target Gene selection

The methylated DNA as a detection target has obvious advantages, and compared with protein markers, the DNA can be amplified and is easy to detect; compared with the mutation-like markers, the sites where DNA methylation occurs are located at specific sites of the gene, generally in the promoter region, which makes detection easier and more convenient. In order to complete the invention, the inventor selects better HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 from hundreds of candidate genes as candidate detection genes and beta-actin gene as an internal reference gene through multiple rounds of screening, researches the distribution condition of methylation sites of each gene, and designs detected primer probes for real-time fluorescent quantitative methylation specific polymerase chain reaction (qMSP) detection respectively. The gene detection primer probes are as follows:

the detection primers and probes for HOXA9 were:

SEQ ID NO: 1HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 2HOXA9-R2 primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 3HOXA9-P2 probe:

FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

the detection primers and probes for SHOX2 were:

SEQ ID NO: 4SHOX2 primer F: TTTAAAGGGTTCGTCGTTTAAGTC

SEQ ID NO: 5SHOX2 primer R: AAACGATTACTTTCGCCCG

SEQ ID NO: 6SHOX2 Probe:

FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

the detection primers and probes of the PCDHGA12 are as follows:

SEQ ID NO: 7PCDHGA12 primer F: TTGGTTTTTACGGTTTTCGAC

SEQ ID NO: 8PCDHGA12 primer R: AAATTCTCCGAAACGCTCG

SEQ ID NO: 9PCDHGA12 probe:

FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

the detection primers and probes for HOXD8 were:

SEQ ID NO: 10HOXD8 primer F: TTAGTTTCGGCGCGTAGC

SEQ ID NO: 11HOXD8 primer R: CCTAAAACCGACGCGATCTA

SEQ ID NO: 12HOXD8 probe:

FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

the detection primers and probes of GATA3 are:

SEQ ID NO: 13GATA3 primer F: TTTCGGTAGCGGGTATTGC

SEQ ID NO: 14GATA3 primer R: AAAATAACGACGAACCAACCG

SEQ ID NO: 15GATA3 Probe:

FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

the detection primer and the probe of the beta-actin are as follows:

SEQ ID NO: 16 beta-actin primer F: TTTTGGATTGTGAATTTGTG

SEQ ID NO: 17 beta-actin primer R: AAAACCTACTCCTCCCTTAAA

SEQ ID NO: 18 β -actin probe: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 Experimental procedures:

1. extraction of DNA

Collecting the specimens of lung cancer patients and non-tumor patients respectively including paraffin tissue specimens, sputum specimens and lavage fluid specimens, pretreating the specimens and separating cells, and extracting DNA according to the instruction of HiPure FFPE DNA Kit (D3126-03) of the MeyBiochemical company.

2. DNA bisulfite treatment

EZ DNA Methylation using ZYMO RESEARCH Biochemical kit^TMKIT (D5002) instructions for bisulphite modification.

3. Amplification and detection

TABLE 1 compounding System

An amplification system:

TABLE 2PCR reaction procedure

4. The result of the detection

4.1 detection results in Paraffin tissue

Sample information: the total number of lung tissue samples was 185, including 87 normal tissue samples, 98 cancer tissue samples, 15 squamous carcinomas in 98 cancer group samples, 81 adenocarcinoma samples, and 2 unidentified lung carcinomas in which there were 73 cancer and paracancer control samples.

ROC plot 1 of the results of detection of HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 in all tissue specimens. The statistical results of the detection of each gene in the tissues are shown in Table 3.

TABLE 3 results of the assays in the organization

From the above results, it can be seen that, in the tissue samples, no matter the lung cancer was comparatively analyzed as a whole, or according to the subtype of the lung cancer, the detection effect of SHOX2 and HOXA9 was the best, the detection effect of PCDHGA12 and GATA3 was the second best, and the detection effect of HOXD8 was the worst, and the sensitivity only reached 40.8%.

According to the above results, in order to study the detection of different genes in the sputum, 5 markers HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 were further screened in the sputum, because the sputum is more significant as a non-invasive detection sample.

Example 2: detection of HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 genes in sputum

Sample information: the total number of the sputum samples tested was 90, wherein 55 samples of the normal control group, 35 samples of the cancer group, 12 samples of squamous carcinoma, 6 samples of small cell carcinoma, 9 samples of adenocarcinoma, 2 samples of large cell carcinoma and 6 samples of lung cancer which is not classified clearly are included in the 35 samples of cancer group.

The test process comprises the following steps:

a. sputum specimens of lung cancer patients and non-lung cancer patients were collected, and after being de-thickened with DTT, the cells were separated by centrifugation, washed 2 times with PBS, and then DNA was extracted using a DNA extraction Kit (HiPure FFPE DNA Kit, D3126-03) from Meiji Bio Inc. (Magen).

b. The bisulphite modification of DNA was carried out using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Bio Inc.

c. The liquid preparation system is as follows:

TABLE 4 liquid formulation system

d. The amplification system was as follows:

TABLE 5 amplification System

e. The detection results are as follows:

TABLE 6 detection results in sputum

The ROC curves of HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 detected in the sputum specimen are shown in fig. 2, and the statistical results are shown in table 6, and it can be seen from the above results that, when 5 genes are simultaneously detected and compared in the sputum specimen, the detection effect of HOXA9 is superior to that of the other 4 genes regardless of whether the lung cancer is compared and analyzed as a whole or according to the subtype of the lung cancer. Particularly, the detection effect on adenocarcinoma is that the detection rate of HOXA9 is far higher than that of other genes. Adenocarcinoma is generally peripheral, and due to the dendritic physiological structure of bronchi, exfoliated cells in the deep lung are more difficult to expectorate through sputum, and most tumor markers are ineffective or have reduced efficacy when the sputum is used as a detection sample, for example, in the present invention, SHOX2, which has the highest sensitivity to adenocarcinoma in tissues, has the sensitivity greatly reduced to 11.1% in the sputum, so that the detection of the part is more difficult and meaningful.

Example 3: detection of HOXA9 and SHOX2 genes in sputum

There are a number of documents showing that SHOX2 can be used as a marker for detecting lung cancer, and there are patents [ CN 201510203539-method and kit for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication ], SHOX2 has a high detection rate in samples of alveolar lavage fluid, lesion site tissue, pleural fluid, sputum, and the like. In order to verify the detection effect of HOXA9, in this example, the detection efficiency of SHOX2 gene was determined using primer and probe sequences disclosed in patent CN201510203539, and SHOX2 gene was expressed as SHOX2_ n3, to be distinguished from SHOX2 gene detected using self-designed primers and probes in examples 1 and 2 of the present invention.

The gene detection primer probes are as follows:

the detection primers and probes for HOXA9 were:

SEQ ID NO: 1HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 2HOXA9-R2 primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 3HOXA9-P2 probe:

FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

the detection primers and probes for SHOX2_ n3 were:

SEQ ID NO: 19SHOX2_ n3 primer F: TTTGGATAGTTAGGTAATTTTCG

SEQ ID NO: 20SHOX2_ n3 primer R: CGTACACGCCTATACTCGTACG

SEQ ID NO: 21SHOX2_ n3.2 Probe:

FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. the liquid preparation system is as follows:

TABLE 7 compounding System

	HOXA9	SHOX2_n3	β-actin
				Reaction component	Addition amount (ul)	Addition amount (ul)	Addition amount (ul)
Upstream primer (100uM)	0.125	0.125	0.125
				Downstream primer (100uM)	0.125	0.125	0.125
Probe (100uM)	0.05	0.05	0.05
				Magnesium ion (25mM)	4	5	5
dNTPs(10mM)	1	1	1
				Taq polymerase (5unit/ul)	0.5	0.5	0.5
5 Xbuffer solution	5	5	5
				Sterilized water	13.2	12.2	12.2
Template DNA	1	1	1
				Total volume	25	25	25

b. The amplification system was as follows:

TABLE 8 amplification System

TABLE 9SHOX2_ n3 reaction procedure

c. The detection results are as follows:

calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA9 threshold value of 2.3 and a SHOX2_ n3 threshold value of 1.3 as standards for judging a cancer group and a control group, and judging the methylation copy number of each gene in the specimen to be positive "+" when the converted ratio exceeds a set threshold value and judging the methylation copy number to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of 90 sputum specimens were as follows:

TABLE 10 test results

d. Analysis of results

TABLE 11 statistical results

The ROC curve of the detection of HOXA9 and SHOX2_ n3 in all sputum specimens is shown in FIG. 3, the amplification curve of HOXA9 and SHOX2_ n3 in the sputum specimens is shown in FIG. 4, and the statistical results are shown in Table 11. from the above results, it can be seen that the detection effect of HOXA9 is superior to that of the SHOX2 gene in the sputum samples, whether the lung cancer is comparatively analyzed as a whole or according to the subtype of the lung cancer. Particularly, the detection effect on adenocarcinoma is that the detection rate of HOXA9 is far higher than that of SHOX2 gene by 33.3%. Adenocarcinoma is generally peripheral, and due to the dendritic physiological structure of the bronchi, exfoliated cells in the deep lung are more difficult to expectorate through sputum. The invention discovers a marker which can detect adenocarcinoma by taking sputum as a sample for the first time and can greatly increase the sensitivity to 55.6%, and the breakthrough has great significance for detecting adenocarcinoma.

Example 4: detection of HOXA9 and SHOX2 genes in lavage fluid

Sample information: the total number of alveolar lavage fluid samples tested was 79, 58 samples of the normal control group, 21 samples of the cancer group, 6 samples of squamous cell carcinoma, 4 samples of small cell carcinoma, and 11 samples of adenocarcinoma in the 21 cancer group.

The test process comprises the following steps:

a. alveolar lavage fluid specimens of patients diagnosed with lung cancer and non-lung cancer were collected, cells were centrifuged, and then DNA was extracted using a DNA extraction Kit (HiPure FFPE DNA Kit, D3126-03) from Meiji Bio Inc. (Magen).

c. The amplification detection system is as follows:

TABLE 12 amplification System

d. The detection system is as follows:

TABLE 13 reaction procedure for HOXA9 and beta-actin

TABLE 14SHOX2_ n3 reaction procedure

e. The detection results are as follows:

calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA9 threshold value of 0.5 and a SHOX2_ n3 threshold value of 0.6 as standards for judging a cancer group and a control group, and judging the methylation copy number of each gene in the specimen to be positive "+" when the converted ratio exceeds a set threshold value and judging the methylation copy number to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of the detection of 79 lavage samples are as follows:

TABLE 15 test results

Table 16 analysis results

The ROC curves for HOXA9 and SHOX2_ n3 in all lavage samples are shown in FIG. 5, the amplification curves are shown in FIG. 6, and the statistics are shown in Table 16. From the above results, it can be seen that, in lavage fluid specimens, HOXA9 and SHOX2 were detected simultaneously, lung cancer was analyzed by comparison as a whole, the detection rate of HOXA9 was 61.9% and higher than 52.4% of SHOX2, and by comparison according to the subtype of lung cancer, the detection rate of HOXA9 was higher than that of SHOX2_ n3 in adenocarcinoma and small cell carcinoma, and since adenocarcinoma is generally peripheral, alveolar lavage fluid does not easily contact with deep pulmonary alveoli or cancer tissues due to the dendritic physiological structure of bronchi, and thus detection of this part was more difficult and meaningful. Furthermore, for small cell carcinoma, the sensitivity of HOXA9 was up to 100%, significantly higher than 75.0% of SHOX 2.

By combining the above 4 embodiments, it can be fully demonstrated that HOXA9 has better detection effect on lung cancer detection and diagnosis, especially on biological samples such as sputum and alveolar lavage fluid. Can be more easily applied to large-scale population screening. Has more excellent social and economic values.

Example 5: effect of detection region, primer and probe of HOXA9 on detection Effect

Various research data show that the methylation state and distribution of the same gene are not uniform, so that for the same gene, methylation primers and probe detection systems designed by selecting different regions have different diagnostic detection efficiencies on the same sample, the same tumor has different diagnostic detection efficiencies, even the selected regions are not suitable for completely having no diagnostic effect on the tumor, and the inventor repeatedly researches and compares a plurality of detection regions, and partial exemplary detection regions are shown in the following table 17.

TABLE 17 sequences to be detected

We designed different methylation primers and probes according to sequence region 1, region 2 and region 3, and the information of each primer and probe is shown in Table 18, wherein group 1, group 2, group 3, group 4 and group 5 are methylation primers and probes designed according to region 1; group 6, group 7, group 8 are methylation primers and probes designed according to region 2; groups 9, 10, 11 are methylation primers and probes designed based on region 3 (see Table 20 for primer and probe sequences).

The above 11 primer probe sets were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma samples were detected in 25 cancer group samples. The results are shown in the following table.

TABLE 18 results of measurements in tissues

The results show that regardless of the design of primers and probes for regions 2 and 3, the detection sensitivity for these two regions can only reach 32% at the highest, whereas regardless of the primers and probes designed according to the present invention, the detection sensitivity for region 1 can reach 40% at the lowest and 76% at the highest. Thus, the detection rate for region 1 was significantly higher than for regions 2 and 3 (see table 18).

Based on the detection results of each set of primer probes, preferred detection sequences are shown in Table 19 below.

TABLE 19 optimized test sequences

Second, influence of primer and probe on detection effect

In addition to the detection effect influenced by the detection region, the primers and probes also have great influence on the detection effect of the tumor marker, and in the research process, the inventor designs a plurality of pairs of primers and corresponding probes to find the probes and primers which improve the detection sensitivity and specificity as much as possible, so that the detection reagent of the invention can be practically applied to clinical detection. The partial primers and detection probes are shown in Table 20 below, and the detection results are shown in Table 21. All primers and probes were synthesized by England Shafer (Shanghai) trade Limited.

TABLE 20 primers and probes

TABLE 21 results of measurements in tissues

The above 11 primer probe sets were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma samples were detected in 25 cancer group samples. The results show that group 1, group 2, group 4, and group 5 all have better detectable rates.

In order to further verify the detection rate of the sputum, 22 sputum specimens were selected for verification, including 7 normal controls, 15 lung cancer controls, 7 squamous cancers, 7 adenocarcinoma and 1 large cell cancer in 15 lung cancers, and the detection results are shown in table 22 below.

TABLE 22 test results in sputum

Group of	Primer probe combination	Specificity of	Sensitivity of the reaction
				Group 1	H9-F2,H9-R2,H9-P2	100％	66.7％
Group 2	H9-F3,H9-R3,H9-P3	100％	44.6％
				Group 4	H9-F5,H9-R5,H9-P5	100％	33.3％
Group 5	H9-F6,H9-R6,H9-P6	100％	40.0％

From the results of 22 sputum specimens, group 1: the detection rates of H9-F2, H9-R2 and H9-P2 are the highest and reach 66.7 percent. Although the sensitivity of both group 1 and group 2 in the tissue sample can reach 76%, the sensitivity of group 2 in the sputum detection sample is greatly reduced to 44.6%, which proves that the design of a detection reagent with high sensitivity is particularly difficult for the sputum sample.

Finally, the most preferred primer probe sequences are shown in Table 23 below according to the detection results of each primer probe set.

TABLE 23 optimized primers

Sequence listing

<110> Congliming Biotechnology, Inc. of Guangzhou City

Application of <120> HOXA9 methylation detection reagent in preparation of lung cancer diagnosis reagent

<130> PT20180905-DD-P

<160> 62

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttagtttttt cggtaggcgg c 21

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaacgccaaa caccgtcg 18

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgttggtcg agtatttcga ttttagttc 29

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tttaaagggt tcgtcgttta agtc 24

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaacgattac tttcgcccg 19

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttagaaggta ggaggcggaa aattag 26

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttggttttta cggttttcga c 21

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaattctccg aaacgctcg 19

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

attcggtgcg tataggtatc gcgc 24

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttagtttcgg cgcgtagc 18

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cctaaaaccg acgcgatcta 20

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aaaacttacg atcgtctacc ctccg 25

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttcggtagc gggtattgc 19

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaaataacga cgaaccaacc g 21

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cgcgtttatg taggagtggt tgaggttc 28

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ttttggattg tgaatttgtg 20

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aaaacctact cctcccttaa a 21

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttgtgtgttg ggtggtggtt 20

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tttggatagt taggtaattt tcg 23

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

cgtacacgcc tatactcgta cg 22

<210> 21

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ccccgatcga acaaacgaaa c 21

<210> 22

<211> 345

<212> DNA

<213> Homo sapiens

<400> 22

aatttccgtg ggtcgggccg ggcgggccag gcgctgggca cggtgatggc caccactggg 60

gccctgggca actactacgt ggactcgttc ctgctgggcg ccgacgccgc ggatgagctg 120

agcgttggcc gctatgcgcc ggggaccctg ggccagcctc cccggcaggc ggcgacgctg 180

gccgagcacc ccgacttcag cccgtgcagc ttccagtcca aggcgacggt gtttggcgcc 240

tcgtggaacc cagtgcacgc ggcgggcgcc aacgctgtac ccgctgcggt gtaccaccac 300

catcaccacc acccctacgt gcacccccag gcgcccgtgg cggcg 345

<210> 23

<211> 345

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aattttcgtg ggtcgggtcg ggcgggttag gcgttgggta cggtgatggt tattattggg 60

gttttgggta attattacgt ggattcgttt ttgttgggcg tcgacgtcgc ggatgagttg 120

agcgttggtc gttatgcgtc ggggattttg ggttagtttt ttcggtaggc ggcgacgttg 180

gtcgagtatt tcgattttag ttcgtgtagt ttttagttta aggcgacggt gtttggcgtt 240

tcgtggaatt tagtgtacgc ggcgggcgtt aacgttgtat tcgttgcggt gtattattat 300

tattattatt atttttacgt gtatttttag gcgttcgtgg cggcg 345

<210> 24

<211> 1898

<212> DNA

<213> Homo sapiens

<400> 24

gacaggacgg ggccatttcg gagttcattg tgtcggccac ttccctcttc caggcgcggg 60

tgcaggaagg ggcacccagt cggtatccgc gcggcttggc agcctcgctg gtatttggga 120

gtcccagccg gaagtgtgtc agggtgtttg agggggggat tactggaact gctggtgagg 180

atgaaggcaa aagagagaga gagagatgga agcgcccgag gccgccagcc tcgccgccag 240

ggaagtgggc taatgaaaaa cacactgttg caggcacagt atccacacgt gaatttgatt 300

acccctgttc taggagtcgc tgctttctgt taggaattgg gggcaggggg agtttccttc 360

caattaacgg agtggcggcg accttttaat ttacccccaa cgggtgagaa ataaacttcc 420

ccaacgtggc caggcccagg aatgggactg gagtcgatgc ccttttaccc ctccccgttc 480

taatttccag ccctggcctt gagctgtggc tgcctctctt tgggccttgt acctctccgc 540

cgagtctccg ggccccgtag gtaaccaagg cgaggcccgg agtagcagct ggaaagggag 600

gaaggagccc tgaaaggctc acgcggcccc gggacaggcc acatcggtgc gggcctccca 660

ggttccggag ctgcggggtc tcttaggcga ggctgccttt tcccaaaccg aacttgcctt 720

ccattcatgc cacttgtagt tttttcccca gctgggattc acggagcgca accaggcttg 780

cagcgctcat ggttagagcc tctgaggctg gagcacaggg ctgggtcgcc agccgcctgc 840

gcctgggaat cctgattgcc agctgatgag aaaggcgggc tgggcgcgcg tgtgcgtggg 900

gtcgagggcc ggggaccgag cgcgccgcac aaccaaccag gccctcaaaa ccttcgccct 960

ggtggcggct ggccgctccc tcctggccag ctcctccgtg gggtcctcgt agcaaaggcg 1020

aatttaaggg ttgcccgggc gcccctcgct ccaggcgggt agctgtgggg acctacaccc 1080

gcggtactcc ctgagcggcc ggtccctgcc tggagtgccc tggtagggcc ggcggcggct 1140

ccgtttggga cggatcctgc gttgaatttg acttttcgag ggcggccgcg ggtaaactcg 1200

cctctcccgg ggaccgcagg gattatttac agggagctcg ccaaccaaac acaacagtct 1260

aacctttcca agtcctcgta aatttttaca gctgggagcc acggcgaggc aaacgaatct 1320

gttggtcgtt tccgacttcc cgccagcctg tgtggcttct gaaacaataa ctccttatga 1380

aatatcataa atatagattt aaatacagta gagcgacaat gcgatttggc tgctttttta 1440

tggcttcaat tattgtctaa ttttatgtga ggggctccgc tggccgcact cgcacgcggg 1500

acccgcgcct tcttgatggc gtgattaatt gtgatataaa atagtccgct taagaagtgt 1560

gtgtatgggg ggggagacgg gagagtacag agacaaggct agatttgatc ttttaatcgt 1620

cgttggccac aattaaaaca aaccccatcg tagagcggca cgatcccttt acataaaaac 1680

atatggcttt tgctataaaa attatgactg caaaacatcg gaccattaat agcgtgcgga 1740

gtgatttacg cgttattgtt ctgctggacg ggcacgtgac gcgcacggcc aatgggggcg 1800

cgggcgccgg caacttatta ggtgactgta cttccccccc ggtgccacca agttgttaca 1860

tgaaatctgc agtttcataa tttccgtggg tcgggccg 1898

<210> 25

<211> 1898

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gataggacgg ggttatttcg gagtttattg tgtcggttat tttttttttt taggcgcggg 60

tgtaggaagg ggtatttagt cggtattcgc gcggtttggt agtttcgttg gtatttggga 120

gttttagtcg gaagtgtgtt agggtgtttg agggggggat tattggaatt gttggtgagg 180

atgaaggtaa aagagagaga gagagatgga agcgttcgag gtcgttagtt tcgtcgttag 240

ggaagtgggt taatgaaaaa tatattgttg taggtatagt atttatacgt gaatttgatt 300

atttttgttt taggagtcgt tgttttttgt taggaattgg gggtaggggg agtttttttt 360

taattaacgg agtggcggcg attttttaat ttatttttaa cgggtgagaa ataaattttt 420

ttaacgtggt taggtttagg aatgggattg gagtcgatgt ttttttattt tttttcgttt 480

taatttttag ttttggtttt gagttgtggt tgtttttttt tgggttttgt attttttcgt 540

cgagttttcg ggtttcgtag gtaattaagg cgaggttcgg agtagtagtt ggaaagggag 600

gaaggagttt tgaaaggttt acgcggtttc gggataggtt atatcggtgc gggtttttta 660

ggtttcggag ttgcggggtt ttttaggcga ggttgttttt ttttaaatcg aatttgtttt 720

ttatttatgt tatttgtagt ttttttttta gttgggattt acggagcgta attaggtttg 780

tagcgtttat ggttagagtt tttgaggttg gagtataggg ttgggtcgtt agtcgtttgc 840

gtttgggaat tttgattgtt agttgatgag aaaggcgggt tgggcgcgcg tgtgcgtggg 900

gtcgagggtc ggggatcgag cgcgtcgtat aattaattag gtttttaaaa ttttcgtttt 960

ggtggcggtt ggtcgttttt ttttggttag ttttttcgtg gggttttcgt agtaaaggcg 1020

aatttaaggg ttgttcgggc gtttttcgtt ttaggcgggt agttgtgggg atttatattc 1080

gcggtatttt ttgagcggtc ggtttttgtt tggagtgttt tggtagggtc ggcggcggtt 1140

tcgtttggga cggattttgc gttgaatttg atttttcgag ggcggtcgcg ggtaaattcg 1200

tttttttcgg ggatcgtagg gattatttat agggagttcg ttaattaaat ataatagttt 1260

aattttttta agttttcgta aatttttata gttgggagtt acggcgaggt aaacgaattt 1320

gttggtcgtt ttcgattttt cgttagtttg tgtggttttt gaaataataa ttttttatga 1380

aatattataa atatagattt aaatatagta gagcgataat gcgatttggt tgttttttta 1440

tggttttaat tattgtttaa ttttatgtga ggggtttcgt tggtcgtatt cgtacgcggg 1500

attcgcgttt ttttgatggc gtgattaatt gtgatataaa atagttcgtt taagaagtgt 1560

gtgtatgggg ggggagacgg gagagtatag agataaggtt agatttgatt ttttaatcgt 1620

cgttggttat aattaaaata aattttatcg tagagcggta cgattttttt atataaaaat 1680

atatggtttt tgttataaaa attatgattg taaaatatcg gattattaat agcgtgcgga 1740

gtgatttacg cgttattgtt ttgttggacg ggtacgtgac gcgtacggtt aatgggggcg 1800

cgggcgtcgg taatttatta ggtgattgta tttttttttc ggtgttatta agttgttata 1860

tgaaatttgt agttttataa ttttcgtggg tcgggtcg 1898

<210> 26

<211> 947

<212> DNA

<213> Homo sapiens

<400> 26

cccaggcgcc cgtggcggcg gcggcgccgg acggcaggta catgcgctcc tggctggagc 60

ccacgcccgg tgcgctctcc ttcgcgggct tgccctccag ccggccttat ggcattaaac 120

ctgaaccgct gtcggccaga aggggtgact gtcccacgct tgacactcac actttgtccc 180

tgactgacta tgcttgtggt tctcctccag ttgatagaga aaaacaaccc agcgaaggcg 240

ccttctctga aaacaatgct gagaatgaga gcggcggaga caagcccccc atcgatccca 300

gtaagtgtct cctcccttca aatccgccgc cgcctccacg ccggcctccc ggatctgctg 360

gcccgccagg tttctctcga gcctgccttc gtcctcgctg gaagcctctc gagttggggc 420

caggagccag aagttggtgt ttgggacgcc tcagataggg ccccaagtct ggagagcagt 480

gaagagcggc ccgcagggct acgggagagg aggcggctgc tgcagcgaga gggggcgggg 540

cgggcacttc gggacgagcc aagactggcc gcccctctcc ttggctgccc aggcccagga 600

ccgagatact ttgggccgtt cttcgaaagc agtgcagccc agagagcctt ttgtacaact 660

agattgtccg tgagcggcgg cagccagggc agccggagct gggacgctgg gggagacggc 720

cgattccttc cacttcttgc cttcggccag tggcggcgta aatcctgcca agatgaggct 780

gcgggcgacc cgggccacaa gggtccccat gacagattat tcaaataagc cacagacgtg 840

atcagcggcc ttagggcgcc ctgacggctt gcccagctcc gaaggccttc caggaaggtt 900

aaataaggag tggggggcgt agagggacag gttgggaaag aaagacg 947

<210> 27

<211> 947

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tttaggcgtt cgtggcggcg gcggcgtcgg acggtaggta tatgcgtttt tggttggagt 60

ttacgttcgg tgcgtttttt ttcgcgggtt tgttttttag tcggttttat ggtattaaat 120

ttgaatcgtt gtcggttaga aggggtgatt gttttacgtt tgatatttat attttgtttt 180

tgattgatta tgtttgtggt ttttttttag ttgatagaga aaaataattt agcgaaggcg 240

ttttttttga aaataatgtt gagaatgaga gcggcggaga taagtttttt atcgatttta 300

gtaagtgttt ttttttttta aattcgtcgt cgtttttacg tcggtttttc ggatttgttg 360

gttcgttagg tttttttcga gtttgttttc gttttcgttg gaagtttttc gagttggggt 420

taggagttag aagttggtgt ttgggacgtt ttagataggg ttttaagttt ggagagtagt 480

gaagagcggt tcgtagggtt acgggagagg aggcggttgt tgtagcgaga gggggcgggg 540

cgggtatttc gggacgagtt aagattggtc gttttttttt ttggttgttt aggtttagga 600

tcgagatatt ttgggtcgtt tttcgaaagt agtgtagttt agagagtttt ttgtataatt 660

agattgttcg tgagcggcgg tagttagggt agtcggagtt gggacgttgg gggagacggt 720

cgattttttt tattttttgt tttcggttag tggcggcgta aattttgtta agatgaggtt 780

gcgggcgatt cgggttataa gggtttttat gatagattat ttaaataagt tatagacgtg 840

attagcggtt ttagggcgtt ttgacggttt gtttagtttc gaaggttttt taggaaggtt 900

aaataaggag tggggggcgt agagggatag gttgggaaag aaagacg 947

<210> 28

<211> 972

<212> DNA

<213> Homo sapiens

<400> 28

agcccggggc ggggtggggc tggagctcct gtctcttggc cagctgaatg gaggcccagt 60

ggcaacacag gtcctgcctg gggatcaggt ctgctctgca ccccaccttg ctgcctggag 120

ccgcccacct gacaacctct catccctgct ctgcagatcc ggtcccatcc ccactgccca 180

ccccaccccc ccagcactcc acccagttca acgttccacg aacccccaga accagccctc 240

atcaacaggc agcaagaagg gccccccgcc catcgcccca caacgccagc cgggtgaacg 300

ttggcaggtc ctgaggcagc tggcaagacg cctgcagctg aaagatacaa ggccagggac 360

aggacagtcc catccccagg aggcagggag tatacaggct ggggaagttt gcccttgcgt 420

ggggtggtga tggaggaggc tcagcaagtc ttctggactg tgaacctgtg tctgccactg 480

tgtgctgggt ggtggtcatc tttcccacca ggctgtggcc tctgcaacct tcaagggagg 540

agcaggtccc attggctgag cacagccttg taccgtgaac tggaacaagc agcctccttc 600

ctggccacag gttccatgtc cttatatgga ctcatctttg cctattgcga cacacactca 660

gtgaacacct actacgcgct gcaaagagcc ccgcaggcct gaggtgcccc cacctcacca 720

ctcttcctat ttttgtgtaa aaatccagct tcttgtcacc acctccaagg agggggagga 780

ggaggaaggc aggttcctct aggctgagcc gaatgcccct ctgtggtccc acgccactga 840

tcgctgcatg cccaccacct gggtacacac agtctgtgat tcccggagca gaacggaccc 900

tgcccacccg gtcttgtgtg ctactcagtg gacagaccca aggcaagaaa gggtgacaag 960

gacagggtct tc 972

<210> 29

<211> 972

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

agttcggggc ggggtggggt tggagttttt gttttttggt tagttgaatg gaggtttagt 60

ggtaatatag gttttgtttg gggattaggt ttgttttgta ttttattttg ttgtttggag 120

tcgtttattt gataattttt tatttttgtt ttgtagattc ggttttattt ttattgttta 180

ttttattttt ttagtatttt atttagttta acgttttacg aatttttaga attagttttt 240

attaataggt agtaagaagg gtttttcgtt tatcgtttta taacgttagt cgggtgaacg 300

ttggtaggtt ttgaggtagt tggtaagacg tttgtagttg aaagatataa ggttagggat 360

aggatagttt tatttttagg aggtagggag tatataggtt ggggaagttt gtttttgcgt 420

ggggtggtga tggaggaggt ttagtaagtt ttttggattg tgaatttgtg tttgttattg 480

tgtgttgggt ggtggttatt ttttttatta ggttgtggtt tttgtaattt ttaagggagg 540

agtaggtttt attggttgag tatagttttg tatcgtgaat tggaataagt agtttttttt 600

ttggttatag gttttatgtt tttatatgga tttatttttg tttattgcga tatatattta 660

gtgaatattt attacgcgtt gtaaagagtt tcgtaggttt gaggtgtttt tattttatta 720

ttttttttat ttttgtgtaa aaatttagtt ttttgttatt atttttaagg agggggagga 780

ggaggaaggt aggttttttt aggttgagtc gaatgttttt ttgtggtttt acgttattga 840

tcgttgtatg tttattattt gggtatatat agtttgtgat tttcggagta gaacggattt 900

tgtttattcg gttttgtgtg ttatttagtg gatagattta aggtaagaaa gggtgataag 960

gatagggttt tt 972

<210> 30

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aattttcgtg ggtcgggtc 19

<210> 31

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

ccaaacaccg tcgccttaa 19

<210> 32

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

acgtggattc gtttttgttg ggc 23

<210> 33

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

cgtcgcggat gagttgagc 19

<210> 34

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

cacgaacgcc taaaaataca cg 22

<210> 35

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tggtcgttat gcgtcgggga tt 22

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

agcgttggtc gttatgcgtc 20

<210> 37

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ccaaacaccg tcgccttaaa c 21

<210> 38

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

gacgttggtc gagtatttcg attttag 27

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

cgacgttggt cgagtatttc 20

<210> 40

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gccacgaacg cctaaaaat 19

<210> 41

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ttagtttaag gcgacggtgt ttgg 24

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

cgttttggtg gcggttggtc 20

<210> 43

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

aataatccct acgatccccg a 21

<210> 44

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

gggcgttttt cgttttaggc gg 22

<210> 45

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

tcgtttggga cggattttgc 20

<210> 46

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

acaaattcgt ttacctcgcc g 21

<210> 47

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

attcgttttt ttcggggatc gtagg 25

<210> 48

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

aatagcgtgc ggagtgattt ac 22

<210> 49

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

cgacccgacc cacgaaaat 19

<210> 50

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

cgttattgtt ttgttggacg ggtacg 26

<210> 51

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

tttaggcgtt cgtggcggc 19

<210> 52

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

cccttctaac cgacaacgat tc 22

<210> 53

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

cggacggtag gtatatgcgt ttttgg 26

<210> 54

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

aattcgtcgt cgtttttacg tc 22

<210> 55

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

tcccgtaacc ctacgaaccg 20

<210> 56

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

tcggatttgt tggttcgtta ggtttttttc 30

<210> 57

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

ttagattgtt cgtgagcggc 20

<210> 58

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

ttataacccg aatcgcccg 19

<210> 59

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

ttgggacgtt gggggagacg gt 22

<210> 60

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

ttttggattt aaggggaaga taaa 24

<210> 61

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

tttttccttc tctacatctt tctacct 27

<210> 62

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

aagggaaatt gagaaatgag agaaggga 28

Claims

The application of a detection reagent for HOXA9 gene methylation in preparing a lung cancer diagnostic reagent; the detection region of the detection reagent for detecting the methylation of the HOXA9 gene is a sequence shown as SEQ ID NO. 22, and the detection sample of the detection reagent for detecting the methylation of the HOXA9 gene is sputum; the detection reagent for HOXA9 gene methylation contains an amplification primer;

the primer is selected from SEQ ID NO: 1 and SEQ ID NO: 2. SEQ ID NO: 30 and SEQ ID NO: 31. SEQ ID NO: 33 and SEQ ID NO: 34. SEQ ID NO: 36 and SEQ ID NO: 37. SEQ ID NO: 39 and SEQ ID NO: 40.
2. The use of claim 1, wherein the lung cancer is selected from small cell lung cancer or non-small cell lung cancer.
3. The use of claim 2, wherein the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma, or large cell carcinoma.
4. The use of claim 1, wherein the reagent for detecting methylation of HOXA9 gene is used for detecting the sequence of HOXA9 gene modified by a transforming agent.
5. The use according to claim 4, wherein the conversion reagent is selected from one or more of the group consisting of hydrazine salt, bisulfite and bisulfite.
6. The use of claim 1, wherein the reagent for detecting methylation of HOXA9 gene further comprises a probe.
7. The use of claim 6, wherein said probe is selected from the group consisting of SE Q ID NO: 3. SEQ ID NO: 32. SEQ ID NO: 35. SEQ ID NO: 38 or SEQ ID NO: 41.
8. The use of claim 1, wherein the detection reagent for methylation of the HOXA9 gene further comprises bisulfite, or hydrazinium salt.
9. The use of claim 1, wherein the detection reagent for methylation of HOXA9 gene further comprises DNA polymerase, dNTPs, Mg²⁺Ions and buffer.
10. The use of claim 1, wherein the reagent for detecting methylation of HOXA9 gene further comprises a reagent for detecting internal reference gene.
11. The use according to claim 10, wherein the reference gene is β -actin or COL2a 1.
12. The use of claim 10, wherein the detection reagent for the reference gene comprises primers and probes for the reference gene.
13. The use of claim 11, wherein the detection reagent for reference gene β -actin comprises SEQ ID NO: 16. SEQ ID NO: 17, and the primer set shown in SEQ ID NO: 18, or a probe as shown in figure 18.
14. The use of claim 11, wherein the detection reagent for COL2a1 comprises SEQ ID NO: 60. SEQ ID NO: 61, and the primer set of SEQ ID NO: 62, and (b) a probe as shown in (b).