CN110964810B

CN110964810B - Application of HOXA7 and HOXA9 methylation detection reagent in preparation of lung cancer diagnostic reagent

Info

Publication number: CN110964810B
Application number: CN201811150352.XA
Authority: CN
Inventors: 牛智通; 李仕良; 黄龙武; 赵荣淞; 吴幽治; 赵霞; 邹鸿志
Original assignee: Guangzhou Kangliming Biotechnology Co ltd
Current assignee: Guangzhou Kangliming Biotechnology Co ltd
Priority date: 2018-09-29
Filing date: 2018-09-29
Publication date: 2022-04-29
Anticipated expiration: 2038-09-29
Also published as: WO2020063901A1; TWI751439B; TW202028463A; CN110964810A

Abstract

The invention belongs to the field of gene diagnosis, and relates to an application of a detection reagent which takes sputum as a detection sample and takes methylation of HOXA7 and HOXA9 as detection objects in preparation of a lung cancer diagnosis reagent. According to the invention, HOXA7 and HOXA9 are jointly used as tumor markers for detecting lung cancer in sputum for the first time, the sensitivity of the lung cancer tumor markers in the sputum is as high as 97.1%, the specificity of the lung cancer tumor markers is as high as 90.9%, the detection sensitivity of the lung cancer tumor markers is higher than that of the lung cancer tumor markers reported in the prior art, especially the sensitivity of the lung cancer tumor markers in adenocarcinoma is even up to 100%, and the lung cancer tumor markers have great application values in detection and diagnosis of the adenocarcinoma.

Description

Application of HOXA7 and HOXA9 methylation detection reagent in preparation of lung cancer diagnostic reagent

Technical Field

The invention belongs to the field of gene diagnosis, and particularly relates to an application of a human HOXA7 and human HOXA9 gene methylation detection reagent in preparation of a lung cancer diagnosis reagent, and a method for detecting methylation of a human HOXA7 gene and a HOXA9 gene.

Technical Field

Lung cancer is a malignant tumor of the lung that originates in the bronchial mucosa, glands or alveolar epithelium. The classification can be made according to the type of pathology: 1. small Cell Lung Cancer (SCLC): one particular pathological type of lung cancer has a marked propensity to metastasize at distant sites, with a poor prognosis, but most patients are sensitive to chemotherapy and radiotherapy. 2. Non-small cell lung cancer (non-small cell lung cancer, NSCLC): other pathological types of lung cancer besides small cell lung cancer include squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and the like. There are certain differences in biological behavior and clinical course. According to the occurrence position, the method can be divided into the following steps: 1. central lung cancer (central lung cancer): lung cancer that grows in the segmental bronchiectasis and above. 2. Peripheral lung cancer (periheral lung cancer): lung cancer that grows beyond the bronchial opening of the segment.

In recent years, the incidence and mortality of the lung cancer in China are gradually increased year by year due to the influence of factors such as aging population, air pollution, smoking and the like, and according to the annual report of 2017 Chinese tumor registration issued by the national cancer center, about 7 people per minute are diagnosed with the cancer nationally, wherein the incidence and mortality of the lung cancer are the first. China has become the world with the largest number of lung cancers, and experts predict that the number of lung cancers in China will reach 100 ten thousand in 2025. And according to epidemiological studies show that: smoking is an important factor causing lung cancer. About 80% -90% of lung cancers worldwide can be attributed to smoking. Compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day in the age of 45-64 years have relative risk of lung cancer of 4.27 and 8.61 respectively, and compared with non-smokers, 1-19 cigarettes and more than 20 cigarettes smoked per day for a long time have relative risk of lung cancer death of 6.14 and 10.73 respectively. Although the treatment technology of the lung cancer is changed day by day, the 5-year survival rate is only increased from 4% to about 12%, the existing antitumor drugs still only have the function of relieving the disease condition, the non-progress survival time of the patient is only prolonged by 3 months to 5 months on average, and for the first-stage lung cancer patient, the 5-year survival rate after the operation is as high as about 60% to 70%. Therefore, early diagnosis and early surgery of lung cancer are one of the most effective methods for improving 5-year survival rate and reducing mortality rate of lung cancer.

The current clinical auxiliary diagnosis of lung cancer mainly comprises the following diagnosis methods, but the diagnosis methods cannot completely realize early detection and early diagnosis:

1. biochemical examination of blood: for primary lung cancer, there is currently no specific blood biochemical examination. The increase of blood alkaline phosphatase or blood calcium in lung cancer patients takes into account the possibility of bone metastasis, and the increase of blood alkaline phosphatase, glutamic-oxalacetic transaminase, lactate dehydrogenase or bilirubin takes into account the possibility of liver metastasis.

2. Tumor marker examination: (1) CEA: abnormally high levels of CEA are found in the serum of 30-70% of lung cancer patients, but are found mainly in later stage lung cancer patients. The current examination of CEA in serum is mainly used to estimate lung cancer prognosis and to monitor the course of treatment. (2) NSE: the kit is a preferred marker for small cell lung cancer, is used for diagnosing the small cell lung cancer and monitoring the treatment response, and has different reference values according to different detection methods and used reagents. 3) CYFRA 21-1: the first choice marker of the non-small cell lung cancer has the sensitivity of 60 percent on the diagnosis of the squamous cell lung cancer, and the reference value is different according to different detection methods and used reagents.

3. Imaging examination: (1) chest X-ray examination: chest orthoses and lateral pieces should be included. In primary hospitals, the positive chest radiograph is still the most basic and preferred image diagnosis method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT examination is performed. (2) And (3) CT examination: chest CT is the most common and important examination method for lung cancer, and is used for diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. The scope of a conditional hospital should include the adrenal gland during a chest CT scan of a lung cancer patient. Enhanced scanning should be used as much as possible, especially for patients with lung center type lesions. CT is the basic examination method for displaying brain metastasis, and patients with clinical symptoms or patients in the advanced stage should perform brain CT scanning and adopt enhanced scanning as much as possible. CT guided lung biopsy is an important diagnostic technique for lung cancer, and a conditional hospital can be used for the diagnosis of lung lesions which are difficult to characterize and the clinical diagnosis of lung cancer needs cytological and histological verification and other methods are difficult to obtain materials. (3) Ultrasonic examination: the kit is mainly used for finding whether the vital organs of the abdomen, the abdominal cavity and the retroperitoneal lymph nodes are transferred or not, and is also used for detecting the cervical lymph nodes. For lung lesions or chest wall lesions close to the chest wall, the cyst solidity can be identified and puncture biopsy can be carried out under ultrasonic guidance; ultrasound is also commonly used for pleural effusion extraction positioning. (4) Bone scanning: the sensitivity to the detection of the bone metastasis of the lung cancer is high, but the false positive rate is certain. The following can be used: preoperative examination of lung cancer; patients with local symptoms.

4. Other checks: (1) sputum cytology examination: the lung cancer is a simple and convenient noninvasive diagnosis method at present, the positive rate can be improved by about 60 percent through continuous smear examination, and the method is a routine diagnosis method for suspicious lung cancer cases. (2) Fiberbronchoscopy: one of the most important means in lung cancer diagnosis plays an important role in the qualitative and localized diagnosis of lung cancer and the selection of surgical schemes. Is a necessary routine examination item for a patient to be treated by surgery. And the bronchoscopy biopsy (TBNA) is beneficial to staging before treatment, but the technical difficulty and risk are higher, so that a person in need should go to a higher hospital for further examination. (3) And others: such as percutaneous lung puncture biopsy, thoracoscope biopsy, mediastinoscopic biopsy, hydrothorax cytology examination, etc., under the condition of an adaptation, the diagnosis can be assisted according to the existing conditions.

Multi-slice helical CT and Low Dose CT (LDCT) in imaging examinations are effective screening tools for finding early lung cancer and reducing mortality, and the national lung cancer screening study (NLST) in the united states has shown that LDCT can reduce mortality of 20% of lung cancer compared to chest X-ray screening. In clinical practice work, the success or failure of any lung cancer screening project is proved to depend on the identification of high risk groups, and a risk prediction model fusing multiple high risk factors is universally accepted as one of the methods for identifying the high risk groups of lung cancer. The risk model further improves the efficacy of lung cancer patients by assisting clinicians in improving interventions or treatments. Although the world has agreed that screening for high risk populations could reduce the current high mortality rate of lung cancer, high risk population definition remains an elusive problem. In order to maximize the benefit-to-injury ratio of lung cancer screening, the first critical issue is how to define the population at high risk; and secondly, screening the population by using what method, including definition of high risk factors, quantitative summarization of overall risks and selection of screening benefit threshold.

With the rapid development of the technology, the tumor marker detection becomes a new field of tumor diagnosis and treatment after the imaging diagnosis and the pathological diagnosis, and can have great influence on the diagnosis, the detection and the treatment of tumors. The tumor marker can be detected in body fluid or tissues and can reflect the existence, differentiation degree, prognosis estimation, personalized medicine, treatment effect and the like of tumors. Early lung cancer patients have no obvious symptoms and are difficult to detect by doctors and patients, and in addition, the early lung cancer patients have no obvious specific markers on blood or biochemical projects, so that early detection and early diagnosis are difficult to perform through a conventional diagnosis method, and the early lung cancer diagnosis, especially the screening of large-scale application population is difficult.

More and more studies have shown that two broad classes of mechanisms are involved in the process of tumor formation. One is the formation of mutations by changes in the nucleotide sequence of the DNA, a genetic mechanism. Tumors have been identified in the field of molecular biology as a genetic disease. Another is the epigenetic (epigenetics) mechanism, i.e., the change of gene expression level independent of DNA sequence change, and the role of it in the process of tumor formation is increasingly emphasized. The two mechanisms of genetics and epigenetics exist in a mutual crossing way, and the formation of tumors is promoted together. Aberrant methylation of genes occurs early in tumorigenesis and increases in the course of tumor progression. Analysis of the genome of 98 common primary human tumors revealed at least 600 abnormally methylated CpG islands per tumor.

Many studies have shown that promoter abnormal methylation is a frequent early event in the development of many tumors, and thus the methylation status of tumor-associated genes is an early sensitive indicator of tumorigenesis and is considered to be a promising molecular biomarker (biomarker). More importantly, the cancerous cells can release DNA into the peripheral blood. Free DNA is present in normal human peripheral blood on the nanogram scale. The research finds that abnormal methylation of the promoter of the tumor-related gene existing in the tumor tissue can be detected in peripheral blood plasma/serum and tumor-involved organ-related body fluid (such as saliva, sputum and the like). The biological samples are easy to obtain, and DNA in the biological samples can be sensitively detected after being massively amplified by a PCR technology, so that the methylation state of the promoter regions of certain tumor-related genes can be detected, and very valuable information can be provided for early diagnosis of tumors. There are many advantages to detecting promoter abnormal methylation compared to other types of tumor molecular markers. The abnormal methylation regions of the promoter of a certain gene in different types of tumors are the same, so that the detection is more convenient; in addition, compared to markers such as allelic deletion, aberrant methylation is a positive signal and is readily distinguishable from the negative background in normal tissue. Esteller et al examined the abnormal methylation state of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in 22 cases of non-small cell lung cancer (NSCLC) tumor tissues and serum, and found that 68% (15/22) tumor tissues have promoter methylation of at least one gene; in 15 cases of tissue positivity, the presence of abnormal promoter methylation was also detected in the serum in 11 cases. In addition, many researchers have also detected the methylation of the promoters of some tumor-related genes from tumor tissues and sera of patients with liver cancer, head and neck cancer, esophageal cancer and colon cancer, respectively.

The existing lung cancer detection technology is mainly low in sensitivity, high in false positive and invasive, and the existing conventional detection technology is difficult to detect early lung cancer.

Noninvasive detection of lung cancer, such as sputum, is more difficult. Although some researchers research the tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is very low when compared with the detection and evaluation of tumor markers of blood samples of other tumor patients. This is mainly due to the following reasons: firstly, the components of the sputum are relatively complex, and the differences of the components, the viscosity and the like of the sputum are relatively large under different diseases or environments of different people; sputum contains more components of non-lung cancer cells such as tracheal epithelial cells, bacteria, oral mucosa cells and the like, and a general sample processing method cannot effectively enrich sufficient DNA from lung cancer sources; ③ many smoking patients do not show expectoration. A study of the past 10 references by A J Hubers et al in Molecular analysis for the diagnosis of lung cancer revealed that the median methylation degree of markers in lung cancer tissues was 48% and the median methylation degree of sputum was 38%, and the results showed that the detection rate of methylated markers in tissues was significantly higher than that of sputum. Meanwhile, Rosalia cirrinone (Methylation profile in tumor and particulate samples of lung cancer treated by particulate computer-treated Methylation) reported that the detection rates of RARBeta2, P16 and RASSF1A in lung cancer tissues reach 65.5%, 41.4% and 51.7%, respectively, while the detection rates in sputum are only 44.4%, 5% and 5%, respectively.

At present, the omission factor of lung cancer is generally higher, especially, for adenocarcinoma type, noninvasive detection of sputum is more difficult, and the detection rate is extremely low. This is because most of adenocarcinoma originates in small bronchi, and is peripheral lung cancer, and exfoliated cells in the deep lung are more difficult to expectorate by sputum. Therefore, the sputum detection means of the adenocarcinoma is almost zero at present.

Reducing the miss rate is particularly important in early tumor screening. If an early tumor screening product cannot screen all or most patients, missed patients will not be prompted with sufficient risk, thereby delaying the opportunity for treatment, which is a significant loss to the patient.

Although some tumor markers related to lung cancer have been found in the prior art, the detection reagent or detection means for these tumor markers are limited, so that the sensitivity and specificity of these tumor markers cannot meet the requirement, and therefore, further research on screening means capable of being applied to lung cancer in a practical manner is still needed in the art. However, while non-invasive screening has the unique advantage of sampling, it also has some limitations in other areas, for example, adenocarcinoma in lung cancer, which is generally considered by those skilled in the art to be unsuitable for non-invasive screening, due to the difficulty of expectoration of exfoliated cells from deep lung portions by sputum. On the other hand, even for other types of lung cancer, the non-invasive screening method reported at present is difficult to meet the requirements of clinical use. Although relevant research has progressed for many years, there is no noninvasive screening method for lung cancer that can be clinically advanced to date.

Disclosure of Invention

The present invention aims to provide a lung tumor marker.

It is another object of the present invention to provide a lung tumor marker that can be detected non-invasively.

Another object of the present invention is to provide a lung tumor marker that can reduce the missed detection rate

The invention also aims to provide application of the HOXA7 and HOXA9 genes or nucleic acid fragments thereof in preparing tumor diagnostic reagents.

It is also an object of the present invention to provide a tumor marker having high sensitivity and specificity against adenocarcinoma in a non-invasive manner.

It is also an object of the present invention to provide a reagent/kit and method for detecting methylation of HOXA7 and HOXA9 genes.

The invention also aims to provide a lung tumor detection reagent/kit with strong specificity and high sensitivity.

The invention also aims to provide a lung tumor detection reagent/kit with wide application range on lung cancer.

The invention provides the following scheme:

in one aspect, the invention provides a HOXA7 gene or a nucleic acid fragment thereof, and application of the HOXA9 gene or a nucleic acid fragment thereof in preparing a tumor diagnostic reagent.

The inventors of the present invention have conducted intensive studies to disclose, for the first time, a method for simultaneously detecting methylation of a HOXA7 gene and a HOXA9 gene or nucleic acid fragments thereof to increase the detection rate of lung cancer. Particularly, the method that the joint methylation detection of the HOXA7 gene and the HOXA9 gene can realize noninvasive method for greatly improving the detection rate is disclosed for the first time. Especially for small cell carcinoma, the miss rate is 0, which is an effect that no technology can compare with the prior art.

The methylated genes are human HOXA7 gene and human HOXA9 gene. The inventors have not only verified that detection of methylation of the HOXA7 and HOXA9 genes in tissue samples has high specificity and sensitivity for lung cancer detection, but also verified that the same high specificity and sensitivity is obtained in sputum samples and lavage fluid samples.

The invention also optimizes the reagent and the detection method for detecting the methylated DNA of the HOXA7 and HOXA9 genes, and further improves the detection effect.

There are a very large number of known lung cancer markers, such as CHRDL1, JAK1, p-EphB1, FABP1, p-LCK, SOST, p-ZAP70, BARD1, UHRF1, MiRNA-4731-3p, miRNA-6729-5p, AKAP4, ABCB1, AKT1, ALK, APC, ATIC, and the like. The effect of joint detection between markers is not expected. Because most tumor markers have only relevance to tumor diagnosis and no specificity, the combined detection of several tumor markers has greater significance in tumor diagnosis. At present, the detection of tumors in clinic basically adopts multi-marker combined detection for auxiliary diagnosis, for example, the liver cancer adopts AFP, CEA, free-b-hCG, CA199 and CA242 combined detection; the colorectal cancer is detected by combination of CEA, CA242, CA199 and the like.

Both HOXA7 and HOXA9 genes are members of the HOX (homeobox) gene family, belong to the HOXA cluster gene on chromosome 7p15-p14, and, like the other HOX genes, each contain a 180bp DNA fragment, transcribing a homology domain consisting of 60 amino acids. HOXA7 plays a regulatory role in the proliferation and differentiation of normal hematopoietic cells, and it is now widely studied that abnormal expression of HOXA7 plays an important role in the development and progression of leukemia, and it has been partially reported that methylation of HOXA7 gene is associated with lung cancer. HOXA9 is a transcription regulation factor with coding sequence specificity, and has important functions in the space-time development of embryo, cell differentiation, proliferation and migration, malignant tumor evolution and apoptosis induction. At present, the abnormal expression of HOXA9 plays an important role in the occurrence and development of leukemia, and some cancers such as lung cancer and human glioma related to HOXA9 gene are reported.

Currently, no combination of the HOXA7 and HOXA9 genes has been reported as a tumor marker for lung cancer. The present invention detects lung cancer for the first time based on the HOXA7 and HOXA9 genes, or their nucleic acid fragments. When the two are jointly detected, the detection rate of the lung cancer is greatly improved.

In another aspect, the invention provides the use of a detection reagent for methylation of HOXA7 and HOXA9 genes in the preparation of a lung cancer diagnostic reagent.

In a preferred embodiment, the methylated detection reagent contains and is administered as a non-invasive sample, such as sputum, lung lavage, tears or stool.

In a preferred embodiment, the methylation detection provided by the invention is a diagnostic reagent for small cell carcinoma or adenocarcinoma; in particular, it is a diagnostic reagent for small cell cancer.

Further, the detection reagent for detecting the methylation of the HOXA7 gene and the HOXA9 gene detects the sequences of the HOXA7 gene and the HOXA9 gene modified by the transformation reagent. Wherein the conversion reagent is a reagent which deaminates cytosine in DNA to uracil while leaving 5-MeC substantially unaffected. Exemplary conversion reagents include one or more of a hydrazine salt, a bisulfite salt (e.g., sodium bisulfite and the like), a bisulfite salt (e.g., sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite and the like), or a compound that generates a hydrazine salt, a bisulfite salt under appropriate reaction conditions. As an exemplary embodiment, the detection reagent for methylation of HOXA7 and HOXA9 genes detects sequences modified by bisulfite.

Methylation is caused by adding one more methyl group on cytosine, and cytosine can be changed into uracil after being treated by bisulfite or hydrazinate, because uracil is similar to thymine and can be identified as thymine when PCR amplification is carried out, which is shown in PCR amplification sequences, methylated cytosine is changed into thymine (C is changed into T), and methylated cytosine (C) is not changed. The technique for detecting methylated genes by PCR is usually Methylation Specific PCR (MSP), wherein primers are designed for the treated methylated fragments (i.e., unchanged C in the fragments), PCR amplification is carried out, if amplification exists, methylation is indicated, and if amplification does not exist, methylation does not exist.

As an alternative embodiment, the detection region for H for which the detection reagents for methylation of the HOXA7 and HOXA9 genes are directed is a CG-rich region or a non-CG-rich region or a CTCF (CTCF-binding sites) region of the gene. In a preferred embodiment, the detection region of the reagent is a CG-rich region or a CTCF (CTCF-binding sites) region of a gene.

Alternatively, the detection regions to which the detection reagents for methylation of the HOXA7 and HOXA9 genes are directed are the gene bodies (gene bodies) or the promoter regions thereof.

As a preferred embodiment of the present invention, the detection region of the methylated detection reagent for HOXA7 comprises SEQ ID NO: 25 or SEQ ID NO: 27, or a sequence set forth in seq id no; the detection region of the reagent against HOXA9 comprises SEQ ID NO: 29. SEQ ID NO: 31 or SEQ ID NO: 33, or a sequence shown in seq id no. As a more preferred embodiment, the detection region of the reagent against HOXA7 comprises SEQ ID NO: 27, and the detection region of said reagent against HOXA9 comprises the sequence shown in SEQ ID NO: 29, or a sequence shown in fig. 29.

The methylation detection reagent also comprises a primer pair for detecting the HOXA7 gene and the HOXA9 gene. As an alternative embodiment, the primer pair for detecting the HOXA7 gene is selected from SEQ ID NO:1-2, SEQ ID NO: 37-38, SEQ ID NO: 40-41, SEQ ID NO: 43-44, or SEQ ID NO: 46-47, SEQ ID NO: 49-50, SEQ ID NO: 52-53, SEQ ID NO: 55-56, SEQ ID NO: 58-59 or SEQ ID NO: 61-62; the primer pair for detecting the HOXA9 gene is selected from SEQ ID NO: 4-5, SEQ ID NO: 64-65, SEQ ID NO: 67-68, SEQ ID NO: 70-71, SEQ ID NO: 73-74, SEQ ID NO: 76-77, SEQ ID NO: 79-80, SEQ ID NO: 82-83, SEQ ID NO: 85-86, SEQ ID NO: 88-89 or SEQ ID NO: 91-92.

As a preferred embodiment, the primer pair for detecting the HOXA7 gene is selected from SEQ ID NO: 1-2; the primer pair for detecting the HOXA9 gene is selected from SEQ ID NO: 4-5.

The methylation detection reagent also comprises probes for detecting the HOXA7 gene and the HOXA9 gene. As an alternative embodiment, the probe for detecting HOXA7 gene is selected from SEQ ID NO: 3. SEQ ID NO: 39. SEQ ID NO: 42. SEQ ID NO: 45. SEQ ID NO: 48. SEQ ID NO: 51. SEQ ID NO: 54. SEQ ID NO: 57. SEQ ID NO: 60 or SEQ ID NO: 63; the probe for detecting the HOXA9 gene is selected from SEQ ID NO: 6. SEQ ID NO: 66. SEQ ID NO: 69. SEQ ID NO: 72. SEQ ID NO: 75. SEQ ID NO: 78. SEQ ID NO: 81. SEQ ID NO: 84. SEQ ID NO: 87. SEQ ID NO: 90 or SEQ ID NO: 93, respectively. As a preferred embodiment, the probe for detecting HOXA7 gene is selected from SEQ ID NO: 3; the probe for detecting the HOXA9 gene is selected from SEQ ID NO: 6. As a preferred mode of the present invention, for convenience of clinical use, the fluorescent group labeled with the detection probe may be VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; the quenching group can be TAMRA, BHQ, MGB, Dabcyl and the like, so that the method is suitable for a multi-channel PCR detection system commonly used for clinical detection at present and realizes multicolor fluorescence detection in one reaction tube.

In a preferred embodiment, the methylated detection reagent of the invention comprises SEQ ID NO:1 and SEQ ID NO: 2, and SEQ ID NO: 4 and SEQ ID NO: 5, and the primer set shown as SEQ ID NO: 3 and SEQ ID NO: 6, and (b) a probe shown in (b).

In an alternative embodiment, the methylation assay of the invention further comprises a detection reagent for an internal reference gene.

Preferably, the reference gene is beta-actin or COL2A1, and in addition to these two reference genes, other methylation detection reference genes of the prior art can be used. Furthermore, the detection reagent of the reference gene comprises a primer and a probe aiming at the reference gene. In a preferred embodiment, the detection reagent for the reference gene beta-actin comprises SEQ ID NO: 19. SEQ ID NO: 20, and the primer set shown in SEQ ID NO: 21 in the above container. The detection reagent of the reference gene COL2A1 comprises SEQ ID NO: 94(TTTTGGATTTAAGGGGAAGATAAA), SEQ ID NO: 95(TTTTTCCTTCTCTACATCTTTCTACCT), and the primer set of SEQ ID NO: 96 (AAGGGAAATTGAGAAATGAGAGAAGGGA).

As an alternative embodiment, the methylated detection reagents of the invention further comprise a bisulfite, bisulfite or hydrazinate salt, which modifies unmethylated cytosine to thymine. Of course, the reagent of the present invention may be omitted and purchased separately at the time of use.

As an alternative embodiment, the methylated detection reagent of the invention further comprises DNA polymerase, dNTPs and Mg²⁺One or more of ions and buffer solution; preferably, the DNA polymerase, dNTPs and Mg are contained²⁺Ions and buffer were used for amplification reactions of the HOXA7 and HOXA9 genes.

In preferred embodiments, the test sample of the methylated test agent is selected from sputum, lung lavage, lung tissue, pleural fluid, blood, serum, plasma, urine, prostatic fluid, tears or stool, and the like. In a preferred embodiment, the test sample is selected from sputum, lung tissue or lung lavage. In a more preferred embodiment, the test sample is selected from sputum or pulmonary lavage.

In another aspect, the present invention provides a method for detecting DNA methylation of the HOXA7 gene and the HOXA9 gene, comprising the steps of:

(1) processing a sample to be detected by bisulfite or hydrazine to obtain a modified sample to be detected;

(2) detecting the methylation condition of HOXA7 gene and HOXA9 gene of the modified sample to be detected in the step (1) by using the methylation detection or kit;

alternatively, detection is performed using methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific PCR (qssp). Other DNA methylation detection methods reported in the prior art can also be applied to the present invention. Methylation detection methods of the prior art are incorporated into the present invention by the USSN62/175,916 patent.

In another aspect, the present invention provides a system for diagnosing lung cancer, comprising:

DNA methylation detection means for the HOXA7 gene and the HOXA9 gene, and,

b. a result judgment means;

the DNA methylation detection component of the HOXA7 gene and the HOXA9 gene contains the methylation detection reagent;

the result judging component is used for detecting the DNA methylation results of the HOXA7 gene and the HOXA9 gene according to the detection component and outputting the risk of the lung cancer and/or the type of the lung cancer;

more preferably, the disease risk is determined by comparing the methylation results of the test sample and the normal sample by the result determination component, and when the methylation of the test sample and the methylation of the normal sample have a significant difference or a very significant difference, the result determination component outputs that the disease risk of the test sample is high.

In the present invention, the lung cancer is selected from small cell lung cancer (SCL) or non-small cell lung cancer (non-small cell lung cancer, NSCL); further, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma or large cell carcinoma. In a preferred embodiment, the lung cancer is selected from small cell lung cancer or adenocarcinoma.

Although methylation of the HOXA7 and HOXA9 genes, respectively, has been reported in the prior art to be methylated in lung cancer. However, the reports of tumor markers of lung cancer are not limited, and the HOXA7 and HOXA9 genes are combined for the first time among a plurality of reported methylation genes possibly related to lung cancer, and the tumor markers of lung cancer are used as the tumor markers of lung cancer, so that the lung cancer detection rate is greatly improved.

For sputum samples, the specificity of individual detection of HOXA7 and HOXA9 genes on all lung cancers reaches 95%, and the sensitivity of individual detection of HOXA7 gene and HOXA9 gene on lung cancers is 88.6% and 74.3%, respectively. By combining the detection of HOXA7 and HOXA9, the sensitivity of the lung cancer is improved to 97.1 percent, and the high sensitivity is very rare in the existing lung cancer markers. In clinical settings, high sensitivity is critical as a tool for early screening. The technical serious deficiency in the field of the current early screening of lung cancer, particularly the non-invasive screening, is mainly caused by the lack of a detection method with high sensitivity. The sensitivity reported at present is generally about 45% -75%.

In addition, the combined detection of the HOXA7 gene and the HOXA9 gene has high specificity and sensitivity for different types of lung cancer, including squamous cell carcinoma, large cell carcinoma and adenocarcinoma in small cell lung cancer and non-small cell lung cancer, has wide application range, and can be used as tumor markers of all lung cancers. The existing lung cancer markers for clinical use can only be generally applicable to detection of one type of lung cancer, such as NSE used for diagnosis of small cell lung cancer and monitoring of treatment response, while CYFRA21-1 is the first choice marker for non-small cell lung cancer.

In small cell carcinoma, 100% sensitivity was obtained by non-invasive screening with combined detection of HOXA7 gene and HOXA9 gene, whether in sputum or lavage samples. Such a 0 miss rate is a huge breakthrough in the art.

In lung adenocarcinoma, the combined detection of the HOXA7 gene and the HOXA9 gene has especially improved sensitivity, which reaches 100 percent of sensitivity, compared with other tumor markers. At present, the omission rate of lung adenocarcinoma is high. On one hand, as the lung adenocarcinoma is easy to occur in women and people who do not smoke, the incidence rate is lower than that of squamous carcinoma and undifferentiated carcinoma, the onset age is smaller, and the number of women is relatively more frequent; on the other hand, most adenocarcinomas originate from small bronchi and are peripheral lung cancers, and exfoliated cells in the deep lung are more difficult to expectorate through sputum; in yet another aspect, early stages of lung adenocarcinoma are generally free of overt clinical symptoms. Therefore, detection of lung adenocarcinoma is more difficult and valuable.

The inventor finds out through experiments that the detection sensitivity of the combined detection of the HOXA7 and the HOXA9 genes in the sputum reaches 100 percent, and the detection sensitivity is the level of the extremely high sensitivity in the adenocarcinoma detection field (as a contrast, the sensitivity of the SHOX2 gene to adenocarcinoma is 33.3 percent). The conventional tumor marker has high sensitivity to adenocarcinoma even in a tissue, but when sputum is used as a detection sample, the sensitivity is greatly reduced, and the effect of the tumor marker is lost. For example, the SHOX2 gene has 79.0% of sensitivity to adenocarcinoma in a tissue sample and is the gene with the highest sensitivity to adenocarcinoma in the tumor markers studied by the invention, but the SHOX2 gene has the sensitivity to adenocarcinoma greatly reduced to 33.3% in a sputum sample.

In lung lavage fluid, the combined detection of HOXA7 and HOXA9 genes also has a sensitivity to adenocarcinoma as high as 81.8%, which is even higher than its sensitivity in tissue samples, which is rarely the case.

Thus, the combined detection of the HOXA7 and HOXA9 genes is of great advantage for adenocarcinoma, and the preferred detection samples are sputum and lung lavage. The sputum and the lung lavage fluid are used as detection samples, the sensitivity of the sputum and the lung lavage fluid is more outstanding than that of other markers, especially when the sputum is used as the detection samples, the detection sensitivity of squamous carcinoma, adenocarcinoma and small cell carcinoma reaches 100%, the detection of the patient abnormity can be found in time, the diagnosis of the adenocarcinoma can be confirmed by further combining other detection means, the simplicity of clinical tumor screening is greatly reduced, a specific tumor marker does not need to be used for specific types of lung cancer, and the lung lavage fluid and the sputum sample are obtained without wound, so that the HOXA7 and the HOXA9 are combined to detect various types of lung cancer such as adenocarcinoma, and the like, and the detection method has great application significance.

The invention has the beneficial effects that:

1. the invention not only can use tissues as detection samples, but also has high sensitivity in sputum and lung lavage fluid, and the sensitivity of the sputum and lung lavage fluid is even higher than that of the tissues for certain lung cancer types, so that the sputum and lung lavage fluid can be simply and conveniently used as the detection samples to reliably diagnose the lung cancer. Sputum and lung lavage samples are very easy to obtain and do not cause any pain or inconvenience to the patient. The sample volume is very small, the sampling process is very convenient and has no influence on patients. Meanwhile, the sample is convenient to mail or bring to a hospital for examination.

2. The kit can detect various types of lung cancer, and has higher sensitivity relative to other markers for adenocarcinoma which is difficult to detect.

3. The invention does not need to consider the detected object and age and has wide application range.

4. The invention detects and diagnoses cancer through methylation level, more and more researches prove that methylation change is an early event in the tumorigenesis process, and early lesions are easier to detect by detecting methylation abnormality.

Drawings

FIG. 1 ROC curves detected in all tissue specimens with HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and combinations of HOXA7 and HOXA 9;

FIG. 2 ROC curves detected in all sputum specimens with HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and combinations of HOXA7 and HOXA 9;

FIG. 3 ROC curves detected in all sputum specimens in combination with HOXA7, HOXA9, and SHOX2_ n3, and HOXA7 and HOXA 9;

FIG. 4 amplification curves of HOXA7, HOXA9 and SHOX2_ n3 in sputum specimen (A is an amplification map of HOXA7, B is an amplification map of HOXA9, and C is an amplification map of SHOX2_ n 3);

FIG. 5 ROC curves detected in all lavage fluid specimens with HOXA7, HOXA9, SHOX2_ n3, and combinations of HOXA7 and HOXA 9;

FIG. 6 shows the amplification curves of HOXA7, HOXA9 and SHOX2_ n3 in lavage fluid specimens (A is the amplification chart of HOXA7, B is the amplification chart of HOXA9, and C is the amplification chart of SHOX2_ n 3).

Detailed Description

The sample to be tested of the present invention comprises: alveolar lavage fluid, tissue from the lesion, pleural fluid, sputum, etc., blood, serum, plasma, urine, prostatic fluid, feces, saliva, tears, feces, etc.

A "primer" or "probe" in the present invention refers to an oligonucleotide comprising a region complementary to a sequence of at least 6 contiguous nucleotides of a target nucleic acid molecule (e.g., a target gene). In some embodiments, the primer or probe comprises a region that is complementary to a sequence of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the target molecule. When a primer or probe comprises a region that is "complementary to at least x consecutive nucleotides of a target molecule," the primer or probe is at least 95% complementary to at least x consecutive or non-consecutive blocked nucleotides of the target molecule. In some embodiments, the primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

The "diagnosis" in the present invention includes, in addition to the early diagnosis of lung cancer, the diagnosis of the middle and late stages of lung cancer, and also includes screening of lung cancer, risk assessment, prognosis, disease identification, diagnosis of the stage of the disease, and selection of therapeutic targets.

The use of the lung cancer markers HOXA7 and HOXA9 made early diagnosis of lung cancer possible. When it is determined that a gene methylated in cancer cells is methylated in cells that are clinically or morphologically normal in appearance, this indicates that the cells in the normal appearance are progressing toward cancer. Thus, lung cancer can be diagnosed at an early stage by methylation of lung cancer specific genes HOXA7 and HOXA9 in normally represented cells.

Among them, early diagnosis refers to the possibility of finding cancer before metastasis, preferably before morphological changes of tissues or cells can be observed.

As an alternative embodiment to the stage of the condition, a diagnosis can be made by measuring the degree of methylation of HOXA7 and HOXA9 obtained from a sample, by progression of lung cancer at different stages or stages. A particular stage of lung cancer in a sample can be detected by comparing the degree of methylation of the HOXA7 gene and the HOXA9 gene of nucleic acids isolated from the sample at each stage of lung cancer to the degree of methylation of the HOXA7 gene and the HOXA9 gene of one or more nucleic acids isolated from the sample in lung tissue free of cell proliferative abnormalities.

The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.

Example 1: detection of target Gene selection

Methylated DNA as a detection target has the obvious advantages that compared with protein markers, DNA can be amplified and is easy to detect; compared with the mutation markers, the DNA methylation sites are located at specific parts of the gene, generally in the promoter region, so that the detection is easier and more convenient. In order to accomplish the present invention, the inventors screened a large number of genes, selected representative HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 as candidate test genes, and β -actin as an internal reference gene, studied the distribution of methylation sites of each gene, and designed primer probes for real-time fluorescent quantitative methylation-specific polymerase chain reaction (qsmp) tests, respectively. The gene detection primer probes are as follows:

the detection primers and probes for HOXA7 were:

SEQ ID NO:1 HOXA7-F2 primer F: TAAAGGCGTTTGCGATAAGAC

SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG

SEQ ID NO: 3 HOXA7-P2 probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

The detection primers and probes for HOXA9 were:

SEQ ID NO: 4 HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 5 HOXA9-R2 primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 6 HOXA9-P2 Probe:

FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

the detection primers and probes for SHOX2 were:

SEQ ID NO: 7 SHOX2 primer F: TTTAAAGGGTTCGTCGTTTAAGTC

SEQ ID NO: 8 SHOX2 primer R: AAACGATTACTTTCGCCCG

SEQ ID NO: 9SHOX2 Probe:

FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

the detection primers and probes of the PCDHGA12 are as follows:

SEQ ID NO: 10 PCDHGA12 primer F: TTGGTTTTTACGGTTTTCGAC

SEQ ID NO: 11 PCDHGA12 primer R: AAATTCTCCGAAACGCTCG

SEQ ID NO: 12 PCDHGA12 probe:

FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

the detection primers and probes for HOXD8 were:

SEQ ID NO: 13 HOXD8 primer F: TTAGTTTCGGCGCGTAGC

SEQ ID NO: 14 HOXD8 primer R: CCTAAAACCGACGCGATCTA

SEQ ID NO: 15 HOXD8 probe:

FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

the detection primers and probes of GATA3 are:

SEQ ID NO: 16 GATA3 primer F: TTTCGGTAGCGGGTATTGC

SEQ ID NO: 17 GATA3 primer R: AAAATAACGACGAACCAACCG

SEQ ID NO: 18 GATA3 probe:

FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

the detection primer and the probe of the beta-actin are as follows:

SEQ ID NO: 19 beta-actin primer F: TTTTGGATTGTGAATTTGTG

SEQ ID NO: 20 beta-actin primer R: AAAACCTACTCCTCCCTTAAA

SEQ ID NO: 21 β -actin probe: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 Experimental procedures:

1. extraction of DNA

Collecting the specimens of lung cancer patients and non-tumor patients respectively including paraffin tissue specimens, sputum specimens and lavage fluid specimens, pretreating the specimens and separating cells, and extracting DNA according to the instruction of HiPure FFPE DNA Kit (D3126-03) of the MeyBiochemical company.

2. DNA modification

EZ DNA Methylation using ZYMO RESEARCH Biochemical kit^TMKIT (D5002) instructions for bisulphite modification.

3. Amplification and detection

Liquid preparation system

TABLE 1 compounding System

An amplification system:

TABLE 2 PCR reaction procedure

4. The result of the detection

4.1 detection results in Paraffin tissue

Sample information: the total number of lung tissue samples was 185, including 87 normal tissue samples, 98 cancer tissue samples, 15 squamous carcinomas in 98 cancer group samples, 81 adenocarcinoma samples, and 2 unidentified lung carcinomas in which there were 73 cancer and paracancer control samples.

ROC plot 1 for the detection of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and HOXA7 and HOXA9 combinations in all tissue specimens. The statistical results of the detection of each gene in the tissues are shown in Table 3.

TABLE 3 results of the assays in the organization

TABLE 3 test results in the organization

From the above results, it can be seen that, in the tissue samples, no matter the lung cancer was comparatively analyzed as a whole, or according to the subtype of the lung cancer, the detection effects of SHOX2 and HOXA9 were the best, the detection effects of HOXA7, PCDHGA12 and GATA3 were the second best, and the detection effect of HOXD8 was the worst, and the sensitivity was only 40.8%.

Although the combined detection has been applied in the prior art, the combined detection has not been synergistic, such as Hubers et al (DNA hypermethylation analysis in sputum for diagnosis of cancer in sputum) research that RASSF1A,3OST2 and PHACTR3 alone have 42.5%, 31.5% and 28.8% of sensitivity, 3 has only 67.1% of sensitivity and 96.5% of specificity is reduced to 89.5% of sensitivity, and the results show that the combined detection of lung cancer markers has no synergistic enhancement. Similarly, in the present invention, two-by-two combinations of HOXA7, HOXA9 and HOXD8, which are the same HOXA family, only the combination of HOXA7& HOXA9, whether in all cancers, squamous cancers or in lung cancers that are difficult to detect, had higher sensitivity than the other combinations, while the combination of the other HOXA families had no significant enhancement effect.

Based on the above results, in order to investigate the detection of different genes in sputum, the inventors further screened 6 markers HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 in sputum.

Example 2: detection of combinations of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3, and HOXA7 and HOXA9 in sputum

Sample information: the total number of the sputum samples tested was 90, wherein 55 samples of the normal control group, 35 samples of the cancer group, 12 samples of squamous carcinoma, 6 samples of small cell carcinoma, 9 samples of adenocarcinoma, 2 samples of large cell carcinoma and 6 samples of lung cancer which is not classified clearly are included in the 35 samples of cancer group.

The test process comprises the following steps:

a. sputum specimens of lung cancer patients and non-lung cancer patients were collected, and after being de-thickened with DTT, the cells were separated by centrifugation, washed 2 times with PBS, and then DNA was extracted using a DNA extraction Kit (HiPure FFPE DNA Kit, D3126-03) from Meiji Bio Inc. (Magen).

b. Bisulfite modification of DNA was performed using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Biopsis.

c. The liquid preparation system is as follows:

TABLE 4 liquid formulation system

d. The amplification system was as follows:

TABLE 5 amplification System

e. The detection results are as follows:

TABLE 6 detection results in sputum

TABLE 6 detection results in sputum

The ROC curves of the combination of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3 and HOXA7 and HOXA9 in all sputum samples are shown in fig. 2, the statistical results are shown in table 6, and from the above results, it can be seen that, when the 6 genes are simultaneously detected in the sputum samples for comparison, the combined detection effect of the HOXA7 and HOXA9 is better than that of the other 4 genes or the HOXA7 and the HOXA9 which are respectively and independently detected, no matter the lung cancer is compared as a whole or according to the subtype of the lung cancer; and also superior to the combination of HOXA7& HOXD8 and HOXA9& HOXD 8.

Particularly, the combination of HOXA7 and HOXA9 has better detection rate and sensitivity even reaching 100% compared with other genes, and the high sensitivity can basically realize 0 omission ratio of early screening of the adenocarcinoma, so that patients can be accurately indicated by risks, treated early and the mortality rate of the adenocarcinoma is reduced. The sensitivity of the existing tumor marker in the lung cancer to the adenocarcinoma is only 14.3%, while the sensitivity of the existing tumor marker to the adenocarcinoma is only 88.9% when HOXA7 or HOXA9 is detected alone, and the sensitivity of the existing tumor marker to the adenocarcinoma is improved to 100% when the two are detected in a combined manner, so that the two have cooperativity.

The detection results of the genes are compared, and the two optimal genes HOXA7 and HOXA9 have obvious synergistic effect on improving the detection positive rate of the system, and particularly show that the detection rate of the adenocarcinoma is obviously improved. Adenocarcinoma is generally peripheral, and due to the dendritic physiological structure of the bronchi, exfoliated cells in the deep lung are more difficult to expectorate through sputum, and thus detection of this part is more difficult and meaningful.

Example 3: detection of HOXA7, HOXA9 and SHOX2 genes in sputum

There are a number of documents showing that SHOX2 can be used as a marker for detecting lung cancer, and there are patents [ CN201510203539 a method and kit-application publication ] for diagnosing methylation of human SHOX2 gene and human RASSF1A gene ], SHOX2 has a high detection rate in samples of alveolar lavage fluid, lesion site tissue, pleural effusion, sputum, and the like. To verify the detection effects of HOXA7 and HOXA9, the present inventors simultaneously detected the HOXA7 and HOXA9SHOX2_ n3 genes. In this example, the detection efficiency of the SHOX2 gene was distinguished from the SHOX2 gene detected in examples 1 and 2 of the present invention using self-designed primers and probes using the primer and probe sequences disclosed in patent CN201510203539 and expressing the SHOX2 gene as SHOX2_ n3.

The gene detection primer probes are as follows:

the detection primers and probes for HOXA7 were:

SEQ ID NO:1 HOXA7-F2 primer F: TAAAGGCGTTTGCGATAAGAC

SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG

SEQ ID NO: 3 HOXA7-P2 probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

The detection primers and probes for HOXA9 were:

SEQ ID NO: 4 HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC

SEQ ID NO: 5 HOXA9-R2 primer R: AAACGCCAAACACCGTCG

SEQ ID NO: 6 HOXA9-P2 Probe:

FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

the detection primers and probes for SHOX2_ n3 were:

SEQ ID NO: 22 SHOX2_ n3 primer F: TTTGGATAGTTAGGTAATTTTCG

SEQ ID NO: 23 SHOX2_ n3 primer R: CGTACACGCCTATACTCGTACG

SEQ ID NO: 24 SHOX2_ n3.2 Probe:

FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. the liquid preparation system is as follows:

TABLE 7 compounding System

	HOXA7	HOXA9	SHOX2_n3	β-actin
					Reaction component	Addition amount (ul)	Addition amount (ul)	Addition amount (ul)	Addition amount (ul)
Upstream primer (100uM)	0.125	0.125	0.125	0.125
					Downstream primer (100uM)	0.125	0.125	0.125	0.125
Probe (100uM)	0.05	0.05	0.05	0.05
					Magnesium ion (25mM)	5	4	5	5
dNTPs(10mM)	1	1	1	1
					Taq polymerase (5unit/ul)	0.5	0.5	0.5	0.5
5X slowFlushing liquid	5	5	5	5
					Sterilized water	12.2	13.2	12.2	12.2
Template DNA	1	1	1	1
					Total volume	25	25	25	25

b. The amplification system was as follows:

TABLE 8 amplification System

TABLE 9SHOX2_ n3 reaction procedure

c. The detection results are as follows:

calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA7 threshold value of 0.77, a HOXA9 threshold value of 2.3 and a SHOX2_ n3 threshold value of 1.3 as standards for judging a cancer group and a control group, judging the converted ratio to be positive "+" when the converted ratio exceeds a set threshold value, and judging the ratio to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of 90 sputum specimens were as follows:

TABLE 10 test results

Note that: "+" is positive for methylated DNA and "-" is negative for methylated DNA; when the specimen is cooperatively detected, the specimen is judged to be negative if the specimen is negative, and the specimen is judged to be positive if the specimen is positive or both the specimen and the specimen are positive.

d. Analysis of results

TABLE 11 statistical results

The ROC curves of the combination of HOXA7 and HOXA9 and the amplification curves of SHOX2_ n3 in all sputum specimens are shown in fig. 3, the amplification curves of HOXA7, HOXA9 and SHOX2_ n3 in the sputum specimens are shown in fig. 4, and the statistical results are shown in table 11, and from the above results, it can be seen that, in the sputum specimens, the lung cancer as a whole is compared and analyzed, or the lung cancer subtypes are compared and analyzed, the detection effects of HOXA7 and HOXA9 are superior to that of the SHOX2 gene, and the positive detection rate can be effectively improved by the combination of HOXA7 and HOXA9, and the positive detection rate is 97.1% in all specimens, wherein the detection sensitivity reaches 100% for squamous cell carcinoma, adenocarcinoma and small cell carcinoma. Such high sensitivity is achieved in many types of lung cancer, and certainly has greater versatility when used in clinical testing. Particularly, the sensitivity of the combination of HOXA7 and HOXA9 for detecting adenocarcinoma is up to 100%, while the sensitivity of the existing primers and probes for detecting SHOX2 for detecting adenocarcinoma is only 33.3%. The adenocarcinoma is generally peripheral, and due to the arborescent physiological structure of the bronchus, exfoliated cells in the deep lung are more difficult to expectorate through sputum, but the invention firstly discovers a marker which can detect the adenocarcinoma by taking the sputum as a sample and can greatly increase the sensitivity to 100%, and the breakthrough has important significance for the detection of the adenocarcinoma.

Example 4: detection of HOXA7, HOXA9 and SHOX2 genes in lavage fluid

Sample information: the total number of alveolar lavage fluid samples tested was 79, 58 samples of the normal control group, 21 samples of the cancer group, 6 samples of squamous cell carcinoma, 4 samples of small cell carcinoma, and 11 samples of adenocarcinoma in the 21 cancer group.

The test process comprises the following steps:

a. alveolar lavage fluid specimens of patients diagnosed with lung cancer and non-lung cancer were collected, cells were centrifuged, and then DNA was extracted using a DNA extraction Kit from magenta (HiPure FFPE DNA Kit, D3126-03).

b. The bisulphite modification of DNA was carried out using the DNA conversion Kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH Bio Inc.

c. The amplification detection system is as follows:

TABLE 12 amplification System

d. The detection system is as follows:

TABLE 13 reaction procedures for HOXA7 and HOXA9

TABLE 14 SHOX2_ n3 reaction procedure

e. The detection results are as follows:

calculating the methylation copy number of each gene in a specimen by using a standard curve, judging the methylation degree of two groups of samples by adopting a ratio of the methylation copy number to the ACTB copy number 100, finally selecting a HOXA7 threshold value of 0.7, a HOXA9 threshold value of 0.5 and a SHOX2_ n3 threshold value of 0.6 as a standard for judging a cancer group and a control group, judging the converted ratio to be positive "+" when the converted ratio exceeds a set threshold value, and judging the ratio to be negative "-" when the converted ratio is equal to or less than the set threshold value. According to this standard, the results of the detection of 79 lavage samples are as follows:

TABLE 15 test results

TABLE 16 statistical results

The ROC curves of the combination of HOXA7 and HOXA9 and the amplification curves of SHOX2_ n3 in all lavage fluid specimens are shown in fig. 5, and the amplification curves of HOXA7, HOXA9 and SHOX2_ n3 in all lavage fluid specimens are shown in fig. 6, and the statistical results are shown in table 16, from which it can be seen that, in the lavage fluid specimens, the detection effects of HOXA7 and HOXA9 are superior to those of the SHOX2 gene regardless of the comparative analysis of lung cancer as a whole or the comparative analysis of subtypes according to lung cancer, and that the positive detection rate is increased by the combination of HOXA7 and HOXA9, and that in all specimens, the positive detection rate is 85.7%. Particularly, in the detection effect on adenocarcinoma, the combined detection sensitivity of HOXA7 and HOXA9 on adenocarcinoma is as high as 81.8%, which is far higher than 36.4% of SHOX2, and is also higher than the sensitivity of HOXA7 and HOXA9 genes on adenocarcinoma in tissues, which is rare and rare. Adenocarcinoma is generally peripheral, and due to the dendritic physiological structure of the bronchi, exfoliated cells in the deep lung are more difficult to expectorate through sputum, and thus detection of this part is more difficult and meaningful.

Furthermore, in lavage fluid, sensitivity to small cell carcinoma reached 100%, regardless of HOXA7 or HOXA9, or SHOX2, which was only 75%. Such a 0-omission factor is of great significance for early screening of small cell carcinoma.

By combining the above 4 embodiments, it can be fully demonstrated that the combination of HOXA7 and HOXA9 has better detection effect on lung cancer detection and diagnosis, especially on biological samples such as sputum and alveolar lavage fluid. Can be more easily applied to large-scale population screening. Has more excellent social and economic values.

Example 5: primer design and optimization of HOXA7 and HOXA9

Various research data show that the methylation state and distribution of the same gene are not uniform, so that for the same gene, methylation primers and probe detection systems designed by selecting different regions have different diagnostic detection efficiencies on the same sample, the same tumor has different diagnostic detection efficiencies, even the selected regions are not suitable for completely having no diagnostic effect on the tumor, and after repeated research and comparison, the sequences of the regions of parts of HOXA7 and HOXA9 are as follows:

TABLE 17 HOXA7 sequences to be detected

TABLE 17 sequences to be detected HOXA9

We designed different methylation primers and probes based on region 1, region 2 of the HOXA7 sequence, and region 1, region 2 and region 3 of the HOXA9 sequence, and the information of each primer and probe is shown in Table 19.

For the HOXA7 sequence, where groups 8, 9, 10 are methylation primers and probes designed according to region 1; group 1, group 2, group 3, group 4, group 5, group 6, and group 7 are methylation primers and probes designed based on region 2.

Methylation primers and probes designed for HOXA9 sequence wherein group 1, group 2, group 3, group 4 and group 5 are based on region 1; group 6, group 7, group 8 are methylation primers and probes designed according to region 2; groups 9, 10, 11 are methylation primers and probes designed based on region 3.

The following primer probe combinations were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma were detected in 25 cancer group samples. The results are shown in Table 18 below.

TABLE 18 results of detection of primers HOXA7 in tissues

The results show that the detection sensitivity for HOXA7 can only reach 48% at the highest regardless of how the primers and probes are designed for region 1, while the detection sensitivity for region 2 can reach 56% at the lowest and 80% at the highest regardless of which primers and probes are designed by the present invention. Thus, the detection rate of HOXA7 was significantly higher in region 2 than in region 1 (see Table 18).

For HOXA9, regardless of how the primers and probes were designed for regions 2 and 3, the detection sensitivity for these two regions was only up to 32%, whereas for region 1, regardless of which primers and probes were designed according to the present invention, the detection sensitivity was 40% at the lowest and up to 76%. Thus, the detection rate of HOXA7 was significantly higher in region 1 than in regions 2 and 3 (see Table 18).

Second, influence of primer and probe on detection effect

In addition to the detection effect influenced by the detection region, the primers and probes also have great influence on the detection effect of the tumor marker, and in the research process, the inventor designs a plurality of pairs of primers and corresponding probes to find the probes and primers which improve the detection sensitivity and specificity as much as possible, so that the detection reagent of the invention can be practically applied to clinical detection. The partial primers and probes are shown in Table 19 below, and the results of the measurements are shown in Table 20. All primers and probes were synthesized by England Shafer (Shanghai) trade Limited.

TABLE 19 primers and probes of HOXA7

Primers and probes of Table 19 HOXA9

TABLE 20 results of HOXA7 detection in tissues

Group of	Primer probe combination	Specificity of	Sensitivity of the reaction
				Group 1	H7-F2,H7-R2,H7-P2	100％	80％
Group 2	H7-F3,H7-R3,H7-P3	100％	76％
				Group 3	H7-F4,H7-R4,H7-P4	100％	56％
Group 4	H7-F5,H7-R5,H7-P5	100％	72％
				Group 5	H7-F6,H7-R6,H7-P6	100％	80％
Group 6	H7-F7,H7-R7,H7-P7	100％	72％
				Group 7	H7-F8,H7-R8,H7-P8	100％	56％
Group 8	H7-F9,H7-R9,H7-P9	100％	48％
				Group 9	H7-F10,H7-R10,H7-P10	100％	16％
Group
	10	H7-F11,H7-R11,H7-P11	100％	24％

TABLE 20 detection of HOXA9 in tissue

Group of	Primer probe combination	Specificity of	Sensitivity of the reaction
				Group 1	H9-F2,H9-R2,H9-P2	100％	76％
Group 2	H9-F3,H9-R3,H9-P3	100％	76％
				Group 3	H9-F4,H9-R4,H9-P4	100％	40％
Group 4	H9-F5,H9-R5,H9-P5	100％	60％
				Group 5	H9-F6,H9-R6,H9-P6	100％	68％
Group 6	H9-F7,H9-R7,H9-P7	100％	32％
				Group 7	H9-F8,H9-R8,H9-P8	100％	20％
Group 8	H9-F9,H9-R9,H9-P9	100％	12％
				Group 9	H9-F10,H9-R10,H9-P10	100％	16％
Group
	10	H9-F11,H9-R11,H9-P11	100％	24％
Group 11					H9-F12,H9-R12,H9-P12	100％	24％

In the present invention, the tissue samples were verified using the primers and probes shown in Table 19. The above 10 primer probe combinations were tested on 36 lung tissue samples, wherein 11 normal tissue samples, 25 cancer tissue samples, 4 squamous carcinomas and 21 adenocarcinoma samples were selected from 25 cancer group samples. The results of the tests are shown in table 20 above,

the results showed that groups 1, 2, 4, 5 and 6 of HOXA7 all had better detectable rates. Groups 1, 2, 4 and 5 of HOXA9 all had better detectable rates.

In order to further verify the detection rate of the sputum, 22 sputum samples were selected and verified by using the primers and probes in table 19, wherein the samples include 7 normal controls, 15 lung cancer controls, 7 squamous cell carcinomas, 7 adenocarcinomas and 1 large cell carcinoma in 15 lung cancers, and the detection results are shown in table 21 below.

TABLE 21 results of detection of HOXA7 in sputum

The results of the assay from 22 sputum specimens showed that group 1 of HOXA 7: the detection rates of H7-F2, H7-R2 and H7-P2 are the highest and reach 73.3 percent. Although the sensitivity of both group 1 and group 5 in the tissue samples reached 80%, the sensitivity of group 5 dropped significantly to 53.3% for the sputum test samples.

Group 1 of HOXA 9: the detection rates of H9-F2, H9-R2 and H9-P2 are the highest and reach 66.7 percent. Although the sensitivity of both group 1 and group 2 in the tissue samples reached 76%, the sensitivity of group 2 dropped significantly to 44.6% for the sputum test samples.

The final preferred primers are shown in Table 22 below.

TABLE 22 optimized primers and probes

Sequence listing

<110> Congliming Biotechnology, Inc. of Guangzhou City

Application of <120> HOXA7 and HOXA9 methylation detection reagent in preparation of lung cancer diagnostic reagent

<160> 129

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

taaaggcgtt tgcgataaga c 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

taacccgcct aacgactacg 20

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agggcgcgtt gtatggcgc 19

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttagtttttt cggtaggcgg c 21

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaacgccaaa caccgtcg 18

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acgttggtcg agtatttcga ttttagttc 29

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tttaaagggt tcgtcgttta agtc 24

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaacgattac tttcgcccg 19

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttagaaggta ggaggcggaa aattag 26

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttggttttta cggttttcga c 21

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaattctccg aaacgctcg 19

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

attcggtgcg tataggtatc gcgc 24

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttagtttcgg cgcgtagc 18

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cctaaaaccg acgcgatcta 20

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aaaacttacg atcgtctacc ctccg 25

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tttcggtagc gggtattgc 19

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aaaataacga cgaaccaacc g 21

<210> 18

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cgcgtttatg taggagtggt tgaggttc 28

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ttttggattg tgaatttgtg 20

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaaacctact cctcccttaa a 21

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ttgtgtgttg ggtggtggtt 20

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tttggatagt taggtaattt tcg 23

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cgtacacgcc tatactcgta cg 22

<210> 24

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccccgatcga acaaacgaaa c 21

<210> 25

<211> 880

<212> DNA

<213> Homo sapiens

<400> 25

accacatggc tccagtttgc ggtggcaatc tctctgcagc tgcaagagat gctgcgcctt 60

ccccgtctgg atccgagtct aagtccggcc tgtcgcccac tggacctggg tgagagaaga 120

cttgggcaga gtcgatctgc tcatagctga gtcctgccca caaggccacc gcggggcagg 180

ctgttgcggg ggacagagac ccttccaggg tctgggcagg cggacaggag agggatgggg 240

aggatcccaa gcttggtcca gggctcacta gcaggagtcg gcgggggggc ggggtggggg 300

gtgctgcgtg gggccgggcc gcctggcgtc cgcagacccc agtgcggagg ttggccgcca 360

gctgggcgct cccgcggagc ctccaggtct ttttccgcgg gacgcgccag gcccgccggg 420

cgcgggcgga ttctttggcc gcatatttga gcctcttgcc cttccattct aggcggctgc 480

gggccctgcg gagcgagacc acctgtgagg actgctgaga ttggcggagg cggtcatgtg 540

ggcggtcacg tgctgcggcg agctccgtcc aaaagaaaat ggggtttggt gtaaatctgg 600

gggtgtaatg ttatcatata tcactctacc tcgtaaaacc gacactgaaa gctgccggac 660

aacaaatcac aggtcaaaat tatgagttct tcgtattatg tgaacgcgct ttttagcaaa 720

tatacggcgg gggcttctct gttccaaaat gccgagccga cttcttgctc ctttgctccc 780

aactcacaga gaagcggcta cggggcgggc gccggcgcct tcgcctcgac cgttccgggc 840

ttatacaatg tcaacagccc cctttatcag agcccctttg 880

<210> 26

<211> 880

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

attatatggt tttagtttgc ggtggtaatt tttttgtagt tgtaagagat gttgcgtttt 60

tttcgtttgg attcgagttt aagttcggtt tgtcgtttat tggatttggg tgagagaaga 120

tttgggtaga gtcgatttgt ttatagttga gttttgttta taaggttatc gcggggtagg 180

ttgttgcggg ggatagagat ttttttaggg tttgggtagg cggataggag agggatgggg 240

aggattttaa gtttggttta gggtttatta gtaggagtcg gcgggggggc ggggtggggg 300

gtgttgcgtg gggtcgggtc gtttggcgtt cgtagatttt agtgcggagg ttggtcgtta 360

gttgggcgtt ttcgcggagt ttttaggttt tttttcgcgg gacgcgttag gttcgtcggg 420

cgcgggcgga ttttttggtc gtatatttga gttttttgtt tttttatttt aggcggttgc 480

gggttttgcg gagcgagatt atttgtgagg attgttgaga ttggcggagg cggttatgtg 540

ggcggttacg tgttgcggcg agtttcgttt aaaagaaaat ggggtttggt gtaaatttgg 600

gggtgtaatg ttattatata ttattttatt tcgtaaaatc gatattgaaa gttgtcggat 660

aataaattat aggttaaaat tatgagtttt tcgtattatg tgaacgcgtt ttttagtaaa 720

tatacggcgg gggttttttt gttttaaaat gtcgagtcga ttttttgttt ttttgttttt 780

aatttataga gaagcggtta cggggcgggc gtcggcgttt tcgtttcgat cgtttcgggt 840

ttatataatg ttaatagttt tttttattag agtttttttg 880

<210> 27

<211> 326

<212> DNA

<213> Homo sapiens

<400> 27

cgtccggcta cggcctgggc gccgacgcct acggcaacct gccctgcgcc tcctacgacc 60

aaaacatccc cgggctctgc agtgacctcg ccaaaggcgc ctgcgacaag acggacgagg 120

gcgcgctgca tggcgcggct gaggccaatt tccgcatcta cccctggatg cggtcttcag 180

gtaggcgcag tcgctaggcg ggccaggctg gcggagcggg accgggagcg gggagcgcag 240

cgctggggag cgcggagcgc ggggcgcggg gccggaagag cggagccagg ctgttgcgag 300

ccggtagccc cgtgactccc ggcgca 326

<210> 28

<211> 326

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cgttcggtta cggtttgggc gtcgacgttt acggtaattt gttttgcgtt ttttacgatt 60

aaaatatttt cgggttttgt agtgatttcg ttaaaggcgt ttgcgataag acggacgagg 120

gcgcgttgta tggcgcggtt gaggttaatt ttcgtattta tttttggatg cggtttttag 180

gtaggcgtag tcgttaggcg ggttaggttg gcggagcggg atcgggagcg gggagcgtag 240

cgttggggag cgcggagcgc ggggcgcggg gtcggaagag cggagttagg ttgttgcgag 300

tcggtagttt cgtgattttc ggcgta 326

<210> 29

<211> 345

<212> DNA

<213> Homo sapiens

<400> 29

aatttccgtg ggtcgggccg ggcgggccag gcgctgggca cggtgatggc caccactggg 60

gccctgggca actactacgt ggactcgttc ctgctgggcg ccgacgccgc ggatgagctg 120

agcgttggcc gctatgcgcc ggggaccctg ggccagcctc cccggcaggc ggcgacgctg 180

gccgagcacc ccgacttcag cccgtgcagc ttccagtcca aggcgacggt gtttggcgcc 240

tcgtggaacc cagtgcacgc ggcgggcgcc aacgctgtac ccgctgcggt gtaccaccac 300

catcaccacc acccctacgt gcacccccag gcgcccgtgg cggcg 345

<210> 30

<211> 345

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aattttcgtg ggtcgggtcg ggcgggttag gcgttgggta cggtgatggt tattattggg 60

gttttgggta attattacgt ggattcgttt ttgttgggcg tcgacgtcgc ggatgagttg 120

agcgttggtc gttatgcgtc ggggattttg ggttagtttt ttcggtaggc ggcgacgttg 180

gtcgagtatt tcgattttag ttcgtgtagt ttttagttta aggcgacggt gtttggcgtt 240

tcgtggaatt tagtgtacgc ggcgggcgtt aacgttgtat tcgttgcggt gtattattat 300

tattattatt atttttacgt gtatttttag gcgttcgtgg cggcg 345

<210> 31

<211> 1898

<212> DNA

<213> Homo sapiens

<400> 31

gacaggacgg ggccatttcg gagttcattg tgtcggccac ttccctcttc caggcgcggg 60

tgcaggaagg ggcacccagt cggtatccgc gcggcttggc agcctcgctg gtatttggga 120

gtcccagccg gaagtgtgtc agggtgtttg agggggggat tactggaact gctggtgagg 180

atgaaggcaa aagagagaga gagagatgga agcgcccgag gccgccagcc tcgccgccag 240

ggaagtgggc taatgaaaaa cacactgttg caggcacagt atccacacgt gaatttgatt 300

acccctgttc taggagtcgc tgctttctgt taggaattgg gggcaggggg agtttccttc 360

caattaacgg agtggcggcg accttttaat ttacccccaa cgggtgagaa ataaacttcc 420

ccaacgtggc caggcccagg aatgggactg gagtcgatgc ccttttaccc ctccccgttc 480

taatttccag ccctggcctt gagctgtggc tgcctctctt tgggccttgt acctctccgc 540

cgagtctccg ggccccgtag gtaaccaagg cgaggcccgg agtagcagct ggaaagggag 600

gaaggagccc tgaaaggctc acgcggcccc gggacaggcc acatcggtgc gggcctccca 660

ggttccggag ctgcggggtc tcttaggcga ggctgccttt tcccaaaccg aacttgcctt 720

ccattcatgc cacttgtagt tttttcccca gctgggattc acggagcgca accaggcttg 780

cagcgctcat ggttagagcc tctgaggctg gagcacaggg ctgggtcgcc agccgcctgc 840

gcctgggaat cctgattgcc agctgatgag aaaggcgggc tgggcgcgcg tgtgcgtggg 900

gtcgagggcc ggggaccgag cgcgccgcac aaccaaccag gccctcaaaa ccttcgccct 960

ggtggcggct ggccgctccc tcctggccag ctcctccgtg gggtcctcgt agcaaaggcg 1020

aatttaaggg ttgcccgggc gcccctcgct ccaggcgggt agctgtgggg acctacaccc 1080

gcggtactcc ctgagcggcc ggtccctgcc tggagtgccc tggtagggcc ggcggcggct 1140

ccgtttggga cggatcctgc gttgaatttg acttttcgag ggcggccgcg ggtaaactcg 1200

cctctcccgg ggaccgcagg gattatttac agggagctcg ccaaccaaac acaacagtct 1260

aacctttcca agtcctcgta aatttttaca gctgggagcc acggcgaggc aaacgaatct 1320

gttggtcgtt tccgacttcc cgccagcctg tgtggcttct gaaacaataa ctccttatga 1380

aatatcataa atatagattt aaatacagta gagcgacaat gcgatttggc tgctttttta 1440

tggcttcaat tattgtctaa ttttatgtga ggggctccgc tggccgcact cgcacgcggg 1500

acccgcgcct tcttgatggc gtgattaatt gtgatataaa atagtccgct taagaagtgt 1560

gtgtatgggg ggggagacgg gagagtacag agacaaggct agatttgatc ttttaatcgt 1620

cgttggccac aattaaaaca aaccccatcg tagagcggca cgatcccttt acataaaaac 1680

atatggcttt tgctataaaa attatgactg caaaacatcg gaccattaat agcgtgcgga 1740

gtgatttacg cgttattgtt ctgctggacg ggcacgtgac gcgcacggcc aatgggggcg 1800

cgggcgccgg caacttatta ggtgactgta cttccccccc ggtgccacca agttgttaca 1860

tgaaatctgc agtttcataa tttccgtggg tcgggccg 1898

<210> 32

<211> 1898

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

gataggacgg ggttatttcg gagtttattg tgtcggttat tttttttttt taggcgcggg 60

tgtaggaagg ggtatttagt cggtattcgc gcggtttggt agtttcgttg gtatttggga 120

gttttagtcg gaagtgtgtt agggtgtttg agggggggat tattggaatt gttggtgagg 180

atgaaggtaa aagagagaga gagagatgga agcgttcgag gtcgttagtt tcgtcgttag 240

ggaagtgggt taatgaaaaa tatattgttg taggtatagt atttatacgt gaatttgatt 300

atttttgttt taggagtcgt tgttttttgt taggaattgg gggtaggggg agtttttttt 360

taattaacgg agtggcggcg attttttaat ttatttttaa cgggtgagaa ataaattttt 420

ttaacgtggt taggtttagg aatgggattg gagtcgatgt ttttttattt tttttcgttt 480

taatttttag ttttggtttt gagttgtggt tgtttttttt tgggttttgt attttttcgt 540

cgagttttcg ggtttcgtag gtaattaagg cgaggttcgg agtagtagtt ggaaagggag 600

gaaggagttt tgaaaggttt acgcggtttc gggataggtt atatcggtgc gggtttttta 660

ggtttcggag ttgcggggtt ttttaggcga ggttgttttt ttttaaatcg aatttgtttt 720

ttatttatgt tatttgtagt ttttttttta gttgggattt acggagcgta attaggtttg 780

tagcgtttat ggttagagtt tttgaggttg gagtataggg ttgggtcgtt agtcgtttgc 840

gtttgggaat tttgattgtt agttgatgag aaaggcgggt tgggcgcgcg tgtgcgtggg 900

gtcgagggtc ggggatcgag cgcgtcgtat aattaattag gtttttaaaa ttttcgtttt 960

ggtggcggtt ggtcgttttt ttttggttag ttttttcgtg gggttttcgt agtaaaggcg 1020

aatttaaggg ttgttcgggc gtttttcgtt ttaggcgggt agttgtgggg atttatattc 1080

gcggtatttt ttgagcggtc ggtttttgtt tggagtgttt tggtagggtc ggcggcggtt 1140

tcgtttggga cggattttgc gttgaatttg atttttcgag ggcggtcgcg ggtaaattcg 1200

tttttttcgg ggatcgtagg gattatttat agggagttcg ttaattaaat ataatagttt 1260

aattttttta agttttcgta aatttttata gttgggagtt acggcgaggt aaacgaattt 1320

gttggtcgtt ttcgattttt cgttagtttg tgtggttttt gaaataataa ttttttatga 1380

aatattataa atatagattt aaatatagta gagcgataat gcgatttggt tgttttttta 1440

tggttttaat tattgtttaa ttttatgtga ggggtttcgt tggtcgtatt cgtacgcggg 1500

attcgcgttt ttttgatggc gtgattaatt gtgatataaa atagttcgtt taagaagtgt 1560

gtgtatgggg ggggagacgg gagagtatag agataaggtt agatttgatt ttttaatcgt 1620

cgttggttat aattaaaata aattttatcg tagagcggta cgattttttt atataaaaat 1680

atatggtttt tgttataaaa attatgattg taaaatatcg gattattaat agcgtgcgga 1740

gtgatttacg cgttattgtt ttgttggacg ggtacgtgac gcgtacggtt aatgggggcg 1800

cgggcgtcgg taatttatta ggtgattgta tttttttttc ggtgttatta agttgttata 1860

tgaaatttgt agttttataa ttttcgtggg tcgggtcg 1898

<210> 33

<211> 947

<212> DNA

<213> Homo sapiens

<400> 33

cccaggcgcc cgtggcggcg gcggcgccgg acggcaggta catgcgctcc tggctggagc 60

ccacgcccgg tgcgctctcc ttcgcgggct tgccctccag ccggccttat ggcattaaac 120

ctgaaccgct gtcggccaga aggggtgact gtcccacgct tgacactcac actttgtccc 180

tgactgacta tgcttgtggt tctcctccag ttgatagaga aaaacaaccc agcgaaggcg 240

ccttctctga aaacaatgct gagaatgaga gcggcggaga caagcccccc atcgatccca 300

gtaagtgtct cctcccttca aatccgccgc cgcctccacg ccggcctccc ggatctgctg 360

gcccgccagg tttctctcga gcctgccttc gtcctcgctg gaagcctctc gagttggggc 420

caggagccag aagttggtgt ttgggacgcc tcagataggg ccccaagtct ggagagcagt 480

gaagagcggc ccgcagggct acgggagagg aggcggctgc tgcagcgaga gggggcgggg 540

cgggcacttc gggacgagcc aagactggcc gcccctctcc ttggctgccc aggcccagga 600

ccgagatact ttgggccgtt cttcgaaagc agtgcagccc agagagcctt ttgtacaact 660

agattgtccg tgagcggcgg cagccagggc agccggagct gggacgctgg gggagacggc 720

cgattccttc cacttcttgc cttcggccag tggcggcgta aatcctgcca agatgaggct 780

gcgggcgacc cgggccacaa gggtccccat gacagattat tcaaataagc cacagacgtg 840

atcagcggcc ttagggcgcc ctgacggctt gcccagctcc gaaggccttc caggaaggtt 900

aaataaggag tggggggcgt agagggacag gttgggaaag aaagacg 947

<210> 34

<211> 947

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tttaggcgtt cgtggcggcg gcggcgtcgg acggtaggta tatgcgtttt tggttggagt 60

ttacgttcgg tgcgtttttt ttcgcgggtt tgttttttag tcggttttat ggtattaaat 120

ttgaatcgtt gtcggttaga aggggtgatt gttttacgtt tgatatttat attttgtttt 180

tgattgatta tgtttgtggt ttttttttag ttgatagaga aaaataattt agcgaaggcg 240

ttttttttga aaataatgtt gagaatgaga gcggcggaga taagtttttt atcgatttta 300

gtaagtgttt ttttttttta aattcgtcgt cgtttttacg tcggtttttc ggatttgttg 360

gttcgttagg tttttttcga gtttgttttc gttttcgttg gaagtttttc gagttggggt 420

taggagttag aagttggtgt ttgggacgtt ttagataggg ttttaagttt ggagagtagt 480

gaagagcggt tcgtagggtt acgggagagg aggcggttgt tgtagcgaga gggggcgggg 540

cgggtatttc gggacgagtt aagattggtc gttttttttt ttggttgttt aggtttagga 600

tcgagatatt ttgggtcgtt tttcgaaagt agtgtagttt agagagtttt ttgtataatt 660

agattgttcg tgagcggcgg tagttagggt agtcggagtt gggacgttgg gggagacggt 720

cgattttttt tattttttgt tttcggttag tggcggcgta aattttgtta agatgaggtt 780

gcgggcgatt cgggttataa gggtttttat gatagattat ttaaataagt tatagacgtg 840

attagcggtt ttagggcgtt ttgacggttt gtttagtttc gaaggttttt taggaaggtt 900

aaataaggag tggggggcgt agagggatag gttgggaaag aaagacg 947

<210> 35

<211> 972

<212> DNA

<213> Homo sapiens

<400> 35

agcccggggc ggggtggggc tggagctcct gtctcttggc cagctgaatg gaggcccagt 60

ggcaacacag gtcctgcctg gggatcaggt ctgctctgca ccccaccttg ctgcctggag 120

ccgcccacct gacaacctct catccctgct ctgcagatcc ggtcccatcc ccactgccca 180

ccccaccccc ccagcactcc acccagttca acgttccacg aacccccaga accagccctc 240

atcaacaggc agcaagaagg gccccccgcc catcgcccca caacgccagc cgggtgaacg 300

ttggcaggtc ctgaggcagc tggcaagacg cctgcagctg aaagatacaa ggccagggac 360

aggacagtcc catccccagg aggcagggag tatacaggct ggggaagttt gcccttgcgt 420

ggggtggtga tggaggaggc tcagcaagtc ttctggactg tgaacctgtg tctgccactg 480

tgtgctgggt ggtggtcatc tttcccacca ggctgtggcc tctgcaacct tcaagggagg 540

agcaggtccc attggctgag cacagccttg taccgtgaac tggaacaagc agcctccttc 600

ctggccacag gttccatgtc cttatatgga ctcatctttg cctattgcga cacacactca 660

gtgaacacct actacgcgct gcaaagagcc ccgcaggcct gaggtgcccc cacctcacca 720

ctcttcctat ttttgtgtaa aaatccagct tcttgtcacc acctccaagg agggggagga 780

ggaggaaggc aggttcctct aggctgagcc gaatgcccct ctgtggtccc acgccactga 840

tcgctgcatg cccaccacct gggtacacac agtctgtgat tcccggagca gaacggaccc 900

tgcccacccg gtcttgtgtg ctactcagtg gacagaccca aggcaagaaa gggtgacaag 960

gacagggtct tc 972

<210> 36

<211> 972

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

agttcggggc ggggtggggt tggagttttt gttttttggt tagttgaatg gaggtttagt 60

ggtaatatag gttttgtttg gggattaggt ttgttttgta ttttattttg ttgtttggag 120

tcgtttattt gataattttt tatttttgtt ttgtagattc ggttttattt ttattgttta 180

ttttattttt ttagtatttt atttagttta acgttttacg aatttttaga attagttttt 240

attaataggt agtaagaagg gtttttcgtt tatcgtttta taacgttagt cgggtgaacg 300

ttggtaggtt ttgaggtagt tggtaagacg tttgtagttg aaagatataa ggttagggat 360

aggatagttt tatttttagg aggtagggag tatataggtt ggggaagttt gtttttgcgt 420

ggggtggtga tggaggaggt ttagtaagtt ttttggattg tgaatttgtg tttgttattg 480

tgtgttgggt ggtggttatt ttttttatta ggttgtggtt tttgtaattt ttaagggagg 540

agtaggtttt attggttgag tatagttttg tatcgtgaat tggaataagt agtttttttt 600

ttggttatag gttttatgtt tttatatgga tttatttttg tttattgcga tatatattta 660

gtgaatattt attacgcgtt gtaaagagtt tcgtaggttt gaggtgtttt tattttatta 720

ttttttttat ttttgtgtaa aaatttagtt ttttgttatt atttttaagg agggggagga 780

ggaggaaggt aggttttttt aggttgagtc gaatgttttt ttgtggtttt acgttattga 840

tcgttgtatg tttattattt gggtatatat agtttgtgat tttcggagta gaacggattt 900

tgtttattcg gttttgtgtg ttatttagtg gatagattta aggtaagaaa gggtgataag 960

gatagggttt tt 972

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

gcgtttgcga taagacggac 20

<210> 38

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

ccaacctaac ccgcctaacg 20

<210> 39

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

cgttgtatgg cgcggttgag g 21

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

cgttcggtta cggtttgggc 20

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

gccctcgtcc gtcttatcgc 20

<210> 42

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

tcgacgttta cggtaatttg ttttgcg 27

<210> 43

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

atttcgttaa aggcgtttgc 20

<210> 44

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

tccgccaacc taacccg 17

<210> 45

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

cggacgaggg cgcgttgtat 20

<210> 46

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

cgttaaaggc gtttgcgata agac 24

<210> 47

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

tacgctcccc gctcccgat 19

<210> 48

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

gacggacgag ggcgcgttgt atg 23

<210> 49

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

caacgctacg ctccccgct 19

<210> 50

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

gcgataagac ggacgagggc 20

<210> 51

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

ccgatcccgc tccgccaacc 20

<210> 52

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

cgttaggcgg gttaggttgg c 21

<210> 53

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

gccgaaaatc acgaaactac cg 22

<210> 54

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

agcgggatcg ggagcggg 18

<210> 55

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

tcgggtcgtt tggcgttc 18

<210> 56

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

aacctaacgc gtcccgcg 18

<210> 57

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

ttggtcgtta gttgggcgtt ttcgc 25

<210> 58

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

ggcgttcgta gattttagtg c 21

<210> 59

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

caaataatct cgctccgca 19

<210> 60

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

ggtcgttagt tgggcgtttt cg 22

<210> 61

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

gcgttaggtt cgtcgggc 18

<210> 62

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

aaactcgccg caacacgtaa 20

<210> 63

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

cggatttttt ggtcgtatat ttgagt 26

<210> 64

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

aattttcgtg ggtcgggtc 19

<210> 65

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

ccaaacaccg tcgccttaa 19

<210> 66

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 66

acgtggattc gtttttgttg ggc 23

<210> 67

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 67

cgtcgcggat gagttgagc 19

<210> 68

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 68

cacgaacgcc taaaaataca cg 22

<210> 69

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 69

tggtcgttat gcgtcgggga tt 22

<210> 70

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 70

agcgttggtc gttatgcgtc 20

<210> 71

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 71

ccaaacaccg tcgccttaaa c 21

<210> 72

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 72

gacgttggtc gagtatttcg attttag 27

<210> 73

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 73

cgacgttggt cgagtatttc 20

<210> 74

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 74

gccacgaacg cctaaaaat 19

<210> 75

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 75

ttagtttaag gcgacggtgt ttgg 24

<210> 76

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 76

cgttttggtg gcggttggtc 20

<210> 77

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 77

aataatccct acgatccccg a 21

<210> 78

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 78

gggcgttttt cgttttaggc gg 22

<210> 79

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 79

tcgtttggga cggattttgc 20

<210> 80

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 80

acaaattcgt ttacctcgcc g 21

<210> 81

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 81

attcgttttt ttcggggatc gtagg 25

<210> 82

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 82

aatagcgtgc ggagtgattt ac 22

<210> 83

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 83

cgacccgacc cacgaaaat 19

<210> 84

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 84

cgttattgtt ttgttggacg ggtacg 26

<210> 85

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 85

tttaggcgtt cgtggcggc 19

<210> 86

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 86

cccttctaac cgacaacgat tc 22

<210> 87

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 87

cggacggtag gtatatgcgt ttttgg 26

<210> 88

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 88

aattcgtcgt cgtttttacg tc 22

<210> 89

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 89

tcccgtaacc ctacgaaccg 20

<210> 90

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 90

tcggatttgt tggttcgtta ggtttttttc 30

<210> 91

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 91

ttagattgtt cgtgagcggc 20

<210> 92

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 92

ttataacccg aatcgcccg 19

<210> 93

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 93

ttgggacgtt gggggagacg gt 22

<210> 94

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 94

ttttggattt aaggggaaga taaa 24

<210> 95

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 95

tttttccttc tctacatctt tctacct 27

<210> 96

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 96

aagggaaatt gagaaatgag agaaggga 28

<210> 97

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 97

aattttcgtg ggtcgggtc 19

<210> 98

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 98

ccaaacaccg tcgccttaa 19

<210> 99

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 99

acgtggattc gtttttgttg ggc 23

<210> 100

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 100

cgtcgcggat gagttgagc 19

<210> 101

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 101

cacgaacgcc taaaaataca cg 22

<210> 102

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 102

tggtcgttat gcgtcgggga tt 22

<210> 103

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 103

agcgttggtc gttatgcgtc 20

<210> 104

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 104

ccaaacaccg tcgccttaaa c 21

<210> 105

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 105

gacgttggtc gagtatttcg attttag 27

<210> 106

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 106

cgacgttggt cgagtatttc 20

<210> 107

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 107

gccacgaacg cctaaaaat 19

<210> 108

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 108

ttagtttaag gcgacggtgt ttgg 24

<210> 109

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 109

cgttttggtg gcggttggtc 20

<210> 110

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 110

aataatccct acgatccccg a 21

<210> 111

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 111

gggcgttttt cgttttaggc gg 22

<210> 112

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 112

tcgtttggga cggattttgc 20

<210> 113

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 113

acaaattcgt ttacctcgcc g 21

<210> 114

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 114

attcgttttt ttcggggatc gtagg 25

<210> 115

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 115

aatagcgtgc ggagtgattt ac 22

<210> 116

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 116

cgacccgacc cacgaaaat 19

<210> 117

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 117

cgttattgtt ttgttggacg ggtacg 26

<210> 118

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 118

tttaggcgtt cgtggcggc 19

<210> 119

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 119

cccttctaac cgacaacgat tc 22

<210> 120

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 120

cggacggtag gtatatgcgt ttttgg 26

<210> 121

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 121

aattcgtcgt cgtttttacg tc 22

<210> 122

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 122

tcccgtaacc ctacgaaccg 20

<210> 123

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 123

tcggatttgt tggttcgtta ggtttttttc 30

<210> 124

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 124

ttagattgtt cgtgagcggc 20

<210> 125

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 125

ttataacccg aatcgcccg 19

<210> 126

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 126

ttgggacgtt gggggagacg gt 22

<210> 127

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 127

ttttggattt aaggggaaga taaa 24

<210> 128

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 128

tttttccttc tctacatctt tctacct 27

<210> 129

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 129

aagggaaatt gagaaatgag agaaggga 28

Claims

The application of a detection reagent for detecting the methylation of HOXA7 gene and HOXA9 gene in preparing a lung cancer diagnostic reagent; the methylation detection reagent is characterized by comprising a primer pair and a probe for detecting a HOXA7 gene and a HOXA9 gene; the primer pair for detecting the HOXA7 gene is shown as SEQ ID NO:1-2, and the probe is shown as SEQ ID NO: 3 is shown in the specification; the primer pair for detecting the HOXA9 gene is shown as SEQ ID NO: 4-5, and the probe is shown as SEQ ID NO: and 6.
2. The use of claim 1, wherein the detection reagent for methylation of HOXA7 and HOXA9 genes detects sequences of HOXA7 gene and HOXA9 gene modified with a transforming reagent.
3. The use according to claim 2, wherein the conversion reagent is selected from one or more of bisulfite and bisulphite.
4. The use of claim 1, wherein the methylated detection reagent further comprises a detection reagent for an internal reference gene.
5. The use of claim 4, wherein the internal reference is β -actin.
6. The use of claim 4, wherein the detection reagent for the reference gene comprises a primer and a probe for the reference gene.
7. The use of claim 5, wherein the detection reagent for the reference gene β -actin comprises the nucleotide sequence of SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 in the above container.
8. The use of claim 1, wherein the methylated detection reagent further comprises bisulfite, bisbisulfite.
9. The use of claim 1, wherein the methylated detection reagent further comprises DNA polymerase, dNTPs, Mg²⁺Ions and buffer.
10. The use of claim 1, wherein the test sample of methylated test agent is selected from sputum, lung lavage, lung tissue, pleural fluid, blood, serum, plasma, urine, saliva, prostatic fluid, tears, or stool.
11. A system for diagnosing lung cancer, said system comprising:

DNA methylation detection means for the HOXA7 gene and the HOXA9 gene, and,

b. a result judgment means;

the DNA methylation detection means of the HOXA7 gene and the HOXA9 gene comprises the methylated detection reagent for use according to any one of claims 1 to 10.
12. The diagnostic system as claimed in claim 11, wherein the result judging means is adapted to output the risk of lung cancer based on the results of DNA methylation of HOXA7 gene and HOXA9 gene detected by the detecting means.
13. The system of claim 12, wherein the risk of disease is determined by comparing the methylation results of the test sample and the normal sample by the result determination component, and the result determination component outputs that the risk of disease is high when the methylation of the test sample and the methylation of the normal sample have a significant difference or a very significant difference.
14. The use according to any one of claims 1 to 10 or the diagnostic system according to any one of claims 11 to 13, wherein the lung cancer is selected from small cell lung cancer or non-small cell lung cancer.
15. The use or diagnostic system of claim 14, wherein the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma or large cell carcinoma.
16. The use according to any one of claims 1 to 10 or the diagnostic system according to any one of claims 11 to 13, wherein the lung cancer is selected from adenocarcinoma.