TW202028463A - Use of HOXA7 and HOXA9 methylation detection reagent in preparing lung cancer diagnostic reagent - Google Patents

Abstract

An application of a detection reagent by using the sputum as a detection sample and using HOXA7 and HOXA9 methylation as a detection object in preparing a lung cancer diagnostic reagent. HOXA7 and HOXA9 are together used as markers for detecting the lung cancer in the sputum for the first time. The sensitivity of HOXA7 and HOXA9 in the sputum is 97.1%, and the specificity thereof is 90.9%. The detection sensitivity thereof is greater than that of the existing lung cancer markers, especially, the sensitivity thereof is even 100% for adenocarcinoma. HOXA7 and HOXA9 have a great application value of detection of adenocarcinoma.

Description

Use of HOXA7 and HOXA9 methylation detection reagents in preparing lung cancer diagnostic reagents

The present disclosure belongs to the field of genetic diagnosis. More specifically, the present disclosure relates to the use of human HOXA7 and human HOXA9 gene methylation detection reagents in preparing lung cancer diagnostic reagents, and a method for human HOXA7 and HOXA9 gene methylation detection.

Lung cancer is a malignant tumor of the lung originating from bronchial mucosa, glands or alveolar epithelium. According to the pathological types, it can be divided into: 1. Small cell lung cancer (SCLC): A special pathological type of lung cancer, which has obvious tendency of distant metastasis and poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy. 2. Non-small cell lung cancer (NSCLC): In addition to small cell lung cancer, other pathological types of lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are certain differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1. Central lung cancer: Lung cancer that grows in the lung segment and above the bronchus opening. 2. Peripheral lung cancer: lung cancer that grows beyond the opening of the bronchus in the lung segment.

Early diagnosis and early surgery of lung cancer is one of the most effective methods to improve the 5-year survival rate of lung cancer and reduce the mortality rate.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can fully achieve early detection and early diagnosis:

1. Blood biochemical test: There is currently no specific blood biochemical test for primary lung cancer. Elevated blood alkaline phosphatase or blood calcium in patients with lung cancer considers the possibility of bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase or bilirubin may consider the possibility of liver metastasis.

2. Tumor marker examination: (1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but they are mainly seen in patients with advanced lung cancer. At present, the examination of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. (2) NSE: is the first choice marker for small cell lung cancer. It is used for the diagnosis and monitoring of treatment response of small cell lung cancer. The reference value is different depending on the detection method and reagents used. 3) CYFRA21-1: is the first choice marker for non-small cell lung cancer, with a sensitivity of up to 60% in the diagnosis of lung squamous cell carcinoma. The reference value is different depending on the detection method and reagents used.

3. Imaging examination: (1) Chest X-ray examination: It should include frontal and lateral chest radiographs. In primary hospitals, chest radiographs are still the most basic and preferred imaging method for lung cancer diagnosis. Once lung cancer is diagnosed or suspected, chest CT is performed. (2) CT examination: Chest CT is the most commonly used and most important examination method for lung cancer. It is used for the diagnosis and differential diagnosis, staging and follow-up of lung cancer. Hospitals with conditions should include the adrenal glands when performing chest CT scans for lung cancer patients. Enhanced scanning should be used as much as possible, especially for patients with central lung disease. CT is the basic examination method to show brain metastases. Patients with clinical symptoms or advanced patients should undergo brain CT scan, and use enhanced scan as much as possible. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Hospitals with conditions can use it for the diagnosis of lung lesions that are difficult to characterize. The clinical diagnosis of lung cancer needs to be confirmed by cytology and histology, but other methods are difficult to obtain. Case. (3) Ultrasound examination: It is mainly used to find out whether there are metastases in the important organs of the abdomen and the lymph nodes in the abdominal cavity and retroperitoneum. It is also used in the examination of the cervical lymph nodes. For lung lesions or chest wall lesions adjacent to the chest wall, the cysts and solids can be identified and ultrasound-guided needle biopsy can be performed; ultrasound is also often used for pleural fluid extraction and positioning. (4) Bone scan: It is highly sensitive to the detection of lung cancer bone metastases, but has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

4. Other examinations: (1) Sputum cytology examination: The current simple and convenient non-invasive diagnosis method for lung cancer, continuous smear examination can increase the positive rate by about 60%, which is a routine diagnosis method for suspected lung cancer cases. (2) Fiberoptic bronchoscopy: one of the most important methods in the diagnosis of lung cancer, plays an important role in the qualitative diagnosis of lung cancer and the selection of surgical options. It is a necessary routine examination item for patients who are to undergo surgical treatment. The bronchoscopy needle biopsy (TBNA) is good for pre-treatment staging, but due to technical difficulties and risks, those in need should be transferred to a higher-level hospital for further examination. (3) Others: such as percutaneous lung biopsy, thoracoscopic biopsy, mediastinoscopy biopsy, pleural effusion cytology, etc., if there are indications, they can be used according to existing conditions to assist diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools for detecting early lung cancer and reducing mortality. The Nationwide Lung Cancer Screening Study (NLST) has shown that LDCT can reduce compared to chest X-ray screening 20% of lung cancer mortality. It has been proved in clinical practice that the success or failure of any lung cancer screening project depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized worldwide as one of the methods for identifying high-risk groups of lung cancer. The risk model can further improve the efficacy of lung cancer patients by assisting clinicians to improve interventions or treatment methods. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still a difficult problem to solve. In order to maximize the benefit-harm ratio of lung cancer screening, the key question is how to define the population at high risk; the second is what method is used to screen the population, including the definition of high-risk factors and overall risk Quantitative summary and selection of screening benefit cutoffs.

Existing lung cancer detection techniques mainly have low sensitivity, high false positives, and are invasive, and it is difficult to detect early lung cancer with conventional detection techniques.

Non-invasive detection of lung cancer, such as sputum detection, is more difficult. Although some researchers have studied tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is very low compared with the detection and evaluation of tumor markers in blood samples of other tumor patients. This is mainly due to the following reasons: ①The composition of sputum is more complicated, and the composition and viscosity of sputum in different people under different diseases or environments are quite different; ②The sputum contains more tracheal epithelial cells and bacteria. Mucosal cells and other non-lung cancer cell components, general sample processing methods cannot effectively enrich the DNA from lung cancer in sufficient numbers; ③Many smokers do not show sputum expectoration. AJ Hubers et al. in "Molecular sputum analysis for the diagnosis of lung cancer" in the past 10 literature studies showed that the median methylation degree of markers in lung cancer tissue was 48%, while the median of sputum The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that of sputum. At the same time, Rosalia Cirincione (Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, and 51.7, respectively. %, and only 44.4%, 5%, 5% in sputum.

At present, the missed detection rate of lung cancer is generally high, especially for the type of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate in smaller bronchial tubes, which are peripheral lung cancers. Exfoliated cells in the deep lung are more difficult to expectorate through sputum. Therefore, the current detection methods for adenocarcinoma are almost zero.

Reducing the missed detection rate is especially important in the early screening of tumors. If an early tumor screening product fails to screen out all or most of the patients, those who missed the test will not be able to get enough risk indications, thus delaying the timing of treatment, which is a huge problem for patients loss.

Although some lung cancer-related tumor markers have been discovered in the prior art, the detection reagents or detection methods for these tumor markers are limited, resulting in that the sensitivity and specificity of these tumor markers cannot meet the needs. Therefore, there are still Further research is needed to screen methods that can be practically applied to lung cancer. Although non-invasive screening has unique advantages in sampling, it also has some limitations in other aspects. For example, the type of adenocarcinoma in lung cancer is difficult to cough out through sputum due to the exfoliated cells in the deep lung. In other words, those skilled in the art would think that this type of lung cancer is not suitable for non-invasive screening. On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although relevant research has been progressing for many years, there is still no noninvasive screening method for lung cancer that can be promoted to the clinic.

The purpose of the present disclosure is to provide lung tumor markers.

Another object of the present disclosure is to provide a lung tumor marker that can be detected non-invasively.

Another object of the present disclosure is to provide a lung tumor marker that can reduce the missed detection rate

Another object of the present disclosure is to provide a use of HOXA7 and HOXA9 genes or their nucleic acid fragments in the preparation of tumor diagnostic reagents.

Another object of the present disclosure is to provide a tumor marker with high sensitivity and specificity against adenocarcinoma in a non-invasive manner.

Another objective of the present disclosure is to provide a reagent/kit and method for detecting HOXA7 and HOXA9 gene methylation.

The purpose of the present disclosure is also to provide a lung tumor detection reagent/kit with strong specificity and high sensitivity.

The purpose of the present disclosure is also to provide a lung tumor detection reagent/kit with a wide range of applications for lung cancer.

The present disclosure provides the following solutions:

In one aspect, the present disclosure provides HOXA7 gene or its nucleic acid fragment, and the use of HOXA9 gene or its nucleic acid fragment in the preparation of tumor diagnostic reagents.

After in-depth research, the inventors revealed for the first time a method for simultaneously detecting the methylation of HOXA7 gene and HOXA9 gene or their nucleic acid fragments to improve the detection rate of lung cancer. In particular, it was revealed for the first time that the combined methylation detection of HOXA7 gene and HOXA9 gene can achieve a non-invasive method that greatly improves the detection rate. Especially for small cell carcinoma, the missed detection rate is 0, which is an effect that has never been matched by any technology so far.

The methylation genes are human HOXA7 gene and human HOXA9 gene. The inventor not only verified that the detection of HOXA7 and HOXA9 gene methylation in tissue samples has high specificity and sensitivity for the detection of lung cancer, but also verified that it has the same high specificity in sputum samples and lavage fluid samples. Sex and sensitivity.

There are many known lung cancer markers, such as CHRDL1, JAK1, p‑EphB1, FABP1, p‑LCK, SOST, p‑ZAP70, BARD1, UHRF1, MiRNA‑4731‑3p, miRNA‑6729‑5p, AKAP4, ABCB1 AKT1, ALK, APC, ATIC, etc. The joint detection effect between the markers is unpredictable. Because most tumor markers are only relevant for tumor diagnosis, but not specific, the combined detection of several tumor markers is of greater significance for tumor diagnosis. At present, the clinical detection of tumors basically uses multi-marker combined detection for auxiliary diagnosis. For example, liver cancer uses AFP, CEA, free-b-hCG, CA199, CA242 combined detection; colorectal cancer uses CEA, CA242, CA199, etc. combined detection.

Both HOXA7 and HOXA9 genes are members of the HOX (homebox homebox) gene family. They belong to the HOXA cluster gene on chromosome 7p15-p14. Like other HOX genes, they both contain a 180bp DNA fragment and are transcribed from 60 amine groups. A homology domain composed of acids. HOXA7 plays a regulatory role in the proliferation and differentiation of normal hematopoietic cells. At present, there are more studies that the abnormal expression of HOXA7 plays an important role in the occurrence and development of leukemia. There are also some reports that HOXA7 gene methylation is related to lung cancer. HOXA9 is a coding sequence-specific transcriptional regulator. It plays an important role in the spatiotemporal development of embryos, cell differentiation, proliferation and migration, malignant evolution of tumors and inducing apoptosis. At present, there are more studies that the abnormal expression of HOXA9 plays an important role in the occurrence and development of leukemia. There are also some reports that HOXA9 gene is related to cancers such as lung cancer and human glioma.

At present, there is no report on the combination of HOXA7 and HOXA9 genes as a tumor marker for lung cancer. This disclosure is the first to detect lung cancer based on HOXA7 and HOXA9 genes, or their nucleic acid fragments. When the two are tested jointly, the detection rate of lung cancer is greatly improved.

On the other hand, the present disclosure provides the use of detection reagents for HOXA7 and HOXA9 gene methylation in the preparation of lung cancer diagnostic reagents.

As a preferred embodiment, the methylation detection reagent contains and uses a non-invasive sample as the detection object, for example, sputum, lung lavage fluid, tears, or feces.

As a preferred embodiment, the detection of methylation provided in the present disclosure is a diagnostic reagent for small cell carcinoma or adenocarcinoma; in particular, a diagnostic reagent for small cell carcinoma.

Further, the HOXA7 gene and HOXA9 gene methylation detection reagent detects the sequence of the HOXA7 and HOXA9 gene modified by the transforming reagent. Among them, the conversion reagent refers to a reagent that deaminates cytosine in DNA into uracil, while making 5-MeC basically unaffected. Exemplary conversion reagents include hydrazine salt, bisulfite (such as sodium bisulfite, etc.), bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) Etc.), or one or more of the compounds that can produce hydrazine salt, bisulfite, and bisulfite under appropriate reaction conditions. As an exemplary embodiment, the HOXA7 and HOXA9 gene methylation detection reagents detect the sequence modified by bisulfite.

Methylation occurs when a methyl group is added to cytosine. After treatment with bisulfite, bisulfite, or hydrazine salt, cytosine will become uracil, because uracil and thymus during PCR amplification Pyrimidine is similar and will be recognized as thymine, which is reflected in the PCR amplified sequence, that is, cytosine that has not been methylated becomes thymine (C becomes T), and methylated cytosine (C) does not change . The technology for detecting methylated genes by PCR is usually methylation-specific PCR (Methylmion Specific PCR, MSP). Primers are designed for the treated methylated fragments (that is, the unchanged C in the fragment), and PCR amplification is performed if Amplification means methylation, and no amplification means no methylation.

As an alternative embodiment, the detection region of H by the detection reagents for HOXA7 and HOXA9 gene methylation includes a CG-rich region or a non-CG-rich region or CTCF (CTCF-binding sites) region of the gene. As a preferred embodiment, the detection area of the reagent includes a CG-enriched area or CTCF (CTCF-binding sites) area of a gene.

Alternatively, the detection region targeted by the detection reagents for HOXA7 and HOXA9 gene methylation includes a gene body or its promoter region.

As a preferred embodiment of the present disclosure, the detection region of the methylated detection reagent for HOXA7 includes the sequence shown in SEQ ID NO: 25 or SEQ ID NO: 27; the detection region of the reagent for HOXA9 includes SEQ ID NO: 29, SEQ ID NO: 31 or SEQ ID NO: 33. As a more preferred embodiment, the detection region of the reagent for HOXA7 includes the sequence shown in SEQ ID NO: 27, and the detection region of the reagent for HOXA9 includes the sequence shown in SEQ ID NO: 29.

The methylation detection reagent of the present disclosure also contains a primer pair for detecting HOXA7 gene and HOXA9 gene. As an alternative embodiment, the primer pair for detecting HOXA7 gene is selected from SEQ ID NO: 1-2, SEQ ID NO: 37-38, SEQ ID NO: 40-41, SEQ ID NO: 43-44, or SEQ ID NO: 46-47, SEQ ID NO: 49-50, SEQ ID NO: 52-53, SEQ ID NO: 55-56, SEQ ID NO: 58-59 or SEQ ID NO: 61-62 ; The primer pair for detecting HOXA9 gene is selected from SEQ ID NO: 4-5, SEQ ID NO: 64-65, SEQ ID NO: 67-68, SEQ ID NO: 70-71, SEQ ID NO: 73-74, SEQ ID NO: 76-77, SEQ ID NO: 79-80, SEQ ID NO: 82-83, SEQ ID NO: 85-86, SEQ ID NO: 88-89 or SEQ ID NO: 91-92 Correct.

As a preferred embodiment, the primer pair for detecting the HOXA7 gene is selected from the primer pair shown in SEQ ID NO: 1-2; the primer pair for detecting the HOXA9 gene is selected from the primer pair shown in SEQ ID NO: 4-5.

The methylation detection reagent of the present disclosure also contains probes for detecting HOXA7 gene and HOXA9 gene. As an alternative embodiment, the probe for detecting the HOXA7 gene is selected from SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 51 , SEQ ID NO: 54, SEQ ID NO: 57, SEQ ID NO: 60 or SEQ ID NO: 63; the probe for detecting the HOXA9 gene is selected from SEQ ID NO: 6, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 84, SEQ ID NO: 87, SEQ ID NO: 90 or SEQ ID NO : The sequence shown in 93. As a preferred embodiment, the probe for detecting the HOXA7 gene is selected from the sequence shown in SEQ ID NO: 3; the probe for detecting the HOXA9 gene is selected from the sequence shown in SEQ ID NO: 6. As a preferred mode of the present disclosure, for the convenience of clinical use, the fluorescent group labeled by the detection probe can be VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; the quenching group can be TAMRA , BHQ, MGB, Dabcyl, etc., to apply to the current multi-channel PCR detection system commonly used in clinical testing, to achieve multi-color fluorescence detection in a reaction tube.

As a preferred embodiment, the methylation detection reagent of the present disclosure contains the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2, the primer pair shown in SEQ ID NO: 4 and SEQ ID NO: 5, and The probe shown in SEQ ID NO: 3 and SEQ ID NO: 6.

As an optional embodiment, the methylation detection of the present disclosure also contains detection reagents for reference genes.

Preferably, the reference gene includes β-actin or COL2A1. In addition to these two reference genes, other reference genes for methylation detection in the prior art can also be used. Further, the detection reagent for the reference gene includes primers and probes for the reference gene. As a preferred embodiment, the detection reagent for the reference gene β-actin includes the primer pair shown in SEQ ID NO: 19, SEQ ID NO: 20, and the probe of SEQ ID NO: 21. The detection reagent for the reference gene COL2A1 contains the primer pair shown in SEQ ID NO: 94 (TTTTGGATTTAAGGGGAAGATAAA), SEQ ID NO: 95 (TTTTTCCTTCTCTACATCTTTCTACC), and the probe shown in SEQ ID NO: 96 (AAGGGAAATTGAGAAATGAGAGAAGGGA).

As an optional embodiment, the methylation detection reagent of the present disclosure further includes bisulfite, bisulfite, or hydrazine salt, which is used to modify methylated cytosine into thymine. Of course, it may not be included in the reagents of the present disclosure, and it may be purchased separately when used.

As an optional embodiment, the methylation detection reagent of the present disclosure further includes one or more of DNA polymerase, dNTPs, Mg²⁺ ion, and buffer; preferably, it contains DNA polymerase, dNTPs, Mg²⁺ ion And buffer for the amplification reaction of HOXA7 and HOXA9 genes.

In a preferred embodiment, the detection sample of the methylation detection reagent includes sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, prostate fluid, tears or feces, etc. Wait. As a preferred embodiment, the test sample contains sputum, lung tissue or lung lavage fluid. As a more preferred embodiment, the test sample contains sputum or lung lavage fluid.

On the other hand, the present disclosure also provides a method for detecting DNA methylation of HOXA7 gene and HOXA9 gene, including the following steps: (1) Treat the test sample with bisulfite or bisulfite or hydrazine salt to obtain a modified test sample; (2) Use the above-mentioned methylation detection or kit to detect the HOXA7 gene and HOXA9 gene methylation of the modified detection sample in step (1).

As an optional method, methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific PCR (qMSP) is used for detection. Other DNA methylation detection methods reported in the prior art can also be applied in this disclosure. The prior art methylation detection method can be introduced into the present disclosure through patent USSN62/175,916.

On the other hand, the present disclosure also provides a lung cancer diagnosis system, which includes: DNA methylation detection components of HOXA7 gene and HOXA9 gene; and Result judgment component.

In some embodiments, the DNA methylation detection components of the HOXA7 gene and the HOXA9 gene comprise the aforementioned methylation detection reagent.

In some embodiments, the methylation detection component includes one or more of a fluorescent quantitative PCR machine, a PCR machine, and a sequencer.

In some embodiments, the result judgment component is used to detect the DNA methylation level of the HOXA7 gene and the HOXA9 gene according to the detection component, and output the diagnosis result such as the risk of lung cancer and/or the type of lung cancer.

In some embodiments, the disease risk is obtained by comparing the methylation level of the test sample and the normal sample by the result judgment component, and is based on the deviation of the methylation level of the test sample and the normal sample.

In some embodiments, the result judgment component includes a data processing machine.

In some embodiments, the data processing machine includes any equipment or instrument or device that can perform data processing that can be used by those skilled in the art.

In some embodiments, the data processing machine includes one or more of a computer and a computer. The computer is loaded with any software or program that can be used by those skilled in the art that can perform data processing or statistical analysis. In some embodiments, the computer includes a computer loaded with one or more software of SPSS, SAS, and Excel.

In some embodiments, the result judgment component further includes a result outputter. The output device includes any equipment or instrument or device that can display the data processing result as readable content. In some embodiments, the result output device includes one or more of a screen and a paper report.

Another aspect of the present disclosure provides a method for diagnosing lung cancer, which includes the following steps: (1) Detect the methylation level of HOXA7 gene and HOXA9 gene in the sample to be tested from the subject; (2) Compare the levels of HOXA7 and HOXA9 genes between the samples to be tested and normal samples (3) Diagnose lung cancer based on the deviation of the methylation level between the test sample and the normal sample.

In some embodiments, when the methylation level of the HOXA7 gene of the sputum sample to be tested is greater than 0.77% or the methylation level of the HOXA9 gene is greater than 2.3%, it is determined that the sample to be tested is a lung cancer sample. When the methylation level of HOXA7 gene in the liquid sample is less than or equal to 0.77% and the methylation level of HOXA9 gene is less than or equal to 2.3%, the sample to be tested is determined to be a non-lung cancer sample.

In some embodiments, when the HOXA7 gene methylation level of the lavage fluid sample to be tested is greater than 0.7% or the HOXA9 gene methylation level is greater than 0.5%, it is determined that the tested sample is a lung cancer sample. If the HOXA7 gene methylation level of the lavage sample to be tested is less than or equal to 0.7% and the HOXA9 gene methylation level is less than or equal to 0.5%, the test sample is determined to be a non-lung cancer sample.

The diagnostic method of the present disclosure can be used before and after treatment of lung cancer or in combination with treatment of lung cancer, after treatment, such as evaluating the success of treatment or monitoring the remission, recurrence and/or progress (including metastasis) of lung cancer after treatment.

Another aspect of the present disclosure provides a method for the treatment of lung cancer, which comprises administering surgery, chemotherapy, radiotherapy, radiotherapy and chemotherapy, immunotherapy, oncolytic virus therapy, or other treatments to patients diagnosed with lung cancer by the above-mentioned diagnostic method Any other types of lung cancer treatment methods used and combinations of these treatment methods.

In the present disclosure, the lung cancer is selected from small cell lung cancer (SCL) or non-small cell lung cancer (NSCL); further, the non-small cell lung cancer is selected from squamous cell Carcinoma, adenocarcinoma or large cell carcinoma. As a preferred embodiment, the lung cancer is selected from small cell lung cancer or adenocarcinoma.

Although, in the prior art, the methylation of HOXA7 and HOXA9 genes has been reported to have methylation in lung cancer. However, there are countless reports on tumor markers of lung cancer. Among the numerous reported methylation genes that may be associated with lung cancer, this disclosure combines HOXA7 and HOXA9 genes as a tumor marker of lung cancer for the first time. Improved the detection rate of lung cancer.

For sputum samples, the individual detection of HOXA7 and HOXA9 genes has a specificity of 95% for all lung cancers. The sensitivity of individual detection of HOXA7 and HOXA9 genes for lung cancer is 88.6% and 74.3%, respectively. Through the combined detection of HOXA7 and HOXA9, the sensitivity for all lung cancers is increased to 97.1%. Such a high sensitivity is very rare in existing lung cancer markers. In clinical practice, as an early screening tool, high sensitivity is very critical. At present, the technology in early lung cancer screening, especially in the field of non-invasive screening, is seriously lacking. The main reason is the lack of detection methods with high sensitivity. The reported sensitivity is generally around 45%-75%.

In addition, the combined detection of HOXA7 gene and HOXA9 gene is aimed at different types of lung cancer, including squamous cell carcinoma, large cell carcinoma, and adenocarcinoma in small cell lung cancer and non-small cell lung cancer. It has high specificity and sensitivity, and its application range is wide. It can basically be used as a tumor marker for all lung cancers. The existing lung cancer markers for clinical use are generally only applicable to the detection of one type of lung cancer. For example, NSE is used for the diagnosis of small cell lung cancer and monitoring treatment response, while CYFRA21-1 is the first choice for non-small cell lung cancer.

In small cell carcinoma, whether it is in the detection of sputum or lavage fluid samples, the non-invasive screening method using the combined detection of HOXA7 and HOXA9 genes has achieved 100% sensitivity. Such a zero missed detection rate is a huge breakthrough in this field.

In lung adenocarcinoma, the combined detection of HOXA7 gene and HOXA9 gene has a particularly improved sensitivity than other tumor markers, reaching 100% sensitivity. Currently, the missed detection rate of lung adenocarcinoma is relatively high. On the one hand, because lung adenocarcinoma is more likely to occur in women and non-smokers, the incidence rate is lower than that of squamous cell carcinoma and undifferentiated cancer, and the age of onset is relatively young, and women are relatively more common; on the other hand, most adenocarcinomas originate from smaller Bronchus is a peripheral type of lung cancer. The exfoliated cells in the deep lung are more difficult to expectorate through sputum. On the other hand, lung adenocarcinoma generally has no obvious clinical symptoms in the early stage. Therefore, the detection of lung adenocarcinoma is more difficult and valuable.

The inventor found through experiments that in the sputum, the combined detection of HOXA7 and HOXA9 genes has a sensitivity of 100% for the detection of adenocarcinoma, which is the only extremely high sensitivity level in the field of adenocarcinoma detection (for comparison, SHOX2 The sensitivity of genes to adenocarcinoma is 33.3%). Existing tumor markers have high sensitivity to adenocarcinoma in tissues, but when sputum is used as a test sample, the sensitivity is greatly reduced, and the role of tumor markers is lost. For example, the SHOX2 gene has a sensitivity of 79.0% for adenocarcinoma in tissue samples, which is the most sensitive gene for adenocarcinoma among the tumor markers studied in this disclosure. However, in sputum samples, the sensitivity of SHOX2 gene for adenocarcinoma has dropped significantly to 33.3 %.

In lung lavage fluid, the sensitivity of the combined detection of HOXA7 and HOXA9 genes for adenocarcinoma is also as high as 81.8%, which is even higher than its sensitivity in tissue samples, which is very rare.

Therefore, for adenocarcinoma, the combined detection of HOXA7 and HOXA9 genes has outstanding advantages, and the preferred test samples are sputum and lung lavage fluid. Using sputum and lung lavage fluid as test samples, it has a relatively more outstanding sensitivity than other markers, especially when sputum is used as a test sample, the sensitivity for detection of squamous cell carcinoma, adenocarcinoma and small cell carcinoma is reached. 100%, which is conducive to timely detection of patient abnormalities, further combining other detection methods to confirm whether it is adenocarcinoma, and greatly reducing the ease of clinical tumor screening, without the need to use specific tumor markers for specific types of lung cancer. The acquisition of lung lavage fluid and sputum samples is non-invasive, making the combined detection of HOXA7 and HOXA9 of great application significance for the detection of adenocarcinoma and other types of lung cancer.

The beneficial effect of one of the above technical solutions is: not only can the tissue be used as a test sample, but also prominent, it also has high sensitivity in sputum and lung lavage fluid. For some types of lung cancer, sputum The sensitivity of lung fluid and lung lavage fluid is even higher than that of tissue. Therefore, sputum and lung lavage fluid can be easily used as test samples to make reliable diagnosis of lung cancer. Sputum and lung lavage fluid samples are very easy to obtain, and will not cause any pain and inconvenience to the patient. The sample size is very small, the sampling process is very convenient and does not affect the patient. At the same time, the samples are easy to mail or take to the hospital for examination.

The beneficial effect of one of the above technical solutions is that it can detect multiple types of lung cancer, and it also has higher sensitivity than other markers for difficult-to-detect adenocarcinoma.

The beneficial effect of one of the above technical solutions is that there is no need to consider the subject and age of detection, and the application range is wide.

The beneficial effect of one of the above technical solutions is: detection and diagnosis of cancer by methylation level, more and more studies have confirmed that methylation changes are an early event in the process of tumorigenesis, and it is easier to detect methylation abnormalities Early lesions are found.

The "primer" or "probe" in the present disclosure refers to an oligonucleotide that includes a region complementary to a sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (for example, a target gene). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe contains at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 of the target molecule. A region where the sequence of consecutive nucleotides is complementary. When a primer or probe contains a region "complementary to at least x consecutive nucleotides of the target molecule", the primer or probe is at least 95% of at least x consecutive or discontinuous block nucleotides of the target molecule Complementary. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

The "diagnosis" in the present disclosure, in addition to the early diagnosis of lung cancer, also includes the diagnosis of middle and late stages of lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stage, and selection of therapeutic targets.

The application of lung cancer markers HOXA7 and HOXA9 makes the early diagnosis of lung cancer possible. When it is determined that a gene methylated in a cancer cell is methylated in a clinically or morphologically normal cell, this indicates that the normal cell is developing into cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of lung cancer-specific genes HOXA7 and HOXA9 in cells that appear to be normal.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, preferably before the morphological changes of tissues or cells can be observed.

As an alternative embodiment of the disease stage, the progress of lung cancer in different stages or periods can be diagnosed by measuring the degree of methylation of HOXA7 and HOXA9 obtained from a sample. By comparing the degree of methylation of the HOXA7 gene and HOXA9 gene of nucleic acids isolated from samples of each stage of lung cancer with the HOXA7 of one or more nucleic acids isolated from samples in lung tissue without abnormal cell proliferation The degree of methylation of gene and HOXA9 gene can detect the specific stage of lung cancer in the sample.

In the present disclosure, "normal" samples refer to samples of the same type isolated from individuals who are known to be free of the cancer or tumor.

In the present disclosure, the "subject" is a mammal, such as a human.

The samples for methylation detection in the present disclosure include but are not limited to DNA, or RNA, or DNA and RNA samples containing mRNA, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

Methods for methylation detection are well-known, such as methylation-specific polymerase chain reaction, real-time fluorescence quantitative methylation-specific polymerase chain reaction, pyrosequencing, and the use of methylated DNA-specific binding proteins PCR, quantitative PCR, and DNA chip, differential methylation detection-methylation-sensitive restriction endonuclease, differential methylation detection-sulfite sequencing method, etc., in addition, other The methylation detection method can be introduced through the patent US62007687.

In the present disclosure, "methylation level" and "methylation degree" can usually be expressed as the percentage of methylated cytosine, which is the number of methylated cytosine divided by the number of methylated cytosine and the amount of unmethylated cytosine. The sum of the number of methylated cytosines; and the method of dividing the number of methylation target genes by the number of reference genes is currently commonly used to express the methylation level; and other methods of expressing the methylation level in the prior art.

The technical solutions of the present disclosure are further described below through specific examples, and the specific examples do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concept of this disclosure still fall within the protection scope of this disclosure.

Example 1: Selection of detection target genes

Methylated DNA has obvious advantages as a detection target. Compared with protein markers, DNA can be amplified and easily detected; compared with mutation markers, DNA methylation sites are located in specific parts of genes , Generally in the promoter region, making detection easier and more convenient. In order to complete the present disclosure, the inventors screened a large number of genes, selected representative HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, and GATA3 as candidate detection genes, β-actin gene as a reference gene, and studied the methylation sites of each gene Distribution conditions, the primer probes designed for detection are used for real-time fluorescent quantitative methylation-specific PCR (qMSP) detection. The primer probes for each gene detection are as follows:

HOXA7 detection primers and probes are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 Probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

HOXA9 detection primers and probes are: SEQ ID NO: 4 HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC SEQ ID NO: 5 HOXA9-R2 Primer R: AAACGCCAAACACCGTCG SEQ ID NO: 6 HOXA9-P2 Probe: FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

SHOX2's detection primers and probes are: SEQ ID NO: 7 SHOX2 primer F: TTTAAAGGGTTCGTCGTTTAAGTC SEQ ID NO: 8 SHOX2 primer R: AAACGATTACTTTCGCCCG SEQ ID NO: 9 SHOX2 Probe: FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

The detection primers and probes of PCDHGA12 are: SEQ ID NO: 10 PCDHGA12 Primer F: TTGGTTTTTACGGTTTTCGAC SEQ ID NO: 11 PCDHGA12 primer R: AAATTCTCCGAAACGCTCG SEQ ID NO: 12 PCDHGA12 Probe: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes of HOXD8 are: SEQ ID NO: 13 HOXD8 primer F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 14 HOXD8 primer R: CCTAAAACCGACGCGATCTA SEQ ID NO: 15 HOXD8 Probe: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes of GATA3 are: SEQ ID NO: 16 GATA3 primer F: TTTCGGTAGCGGGTATTGC SEQ ID NO: 17 GATA3 primer R: AAAATAACGACGAACCAACCG SEQ ID NO: 18 GATA3 Probe: FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 19 β-actin primer F: TTTTGGATTGTGAATTTGTG SEQ ID NO: 20 β-actin primer R: AAAACCTACTCCTCCCTTAAA SEQ ID NO: 21 β-actin probe: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

experiment procedure:

1. Extract DNA

Collect the specimens of confirmed lung cancer patients and non-tumor patients, including paraffin tissue specimens, sputum specimens, lavage fluid specimens, sample pretreatment and cell separation, according to HiPure FFPE DNA Kit (D3126-03) Instructions for DNA extraction.

2. DNA modification

The bisulfite modification was carried out with the instructions of the ZYMO RESEARCH biological company kit EZ DNA Methylation™ KIT (D5002).

3. Amplification and detection

Dosing system: [Table 1] Dosing system HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin Reaction component Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Upstream primer (100 µM) 0.125 0.125 0.05 0.125 0.05 0.125 0.125 Downstream primer (100 µM) 0.125 0.125 0.125 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Magnesium ion (25 mM) 5 4 5 5 5 3 5 dNTPs (10 mM) 1 1 1 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 5×buffer 5 5 5 5 5 5 5 Sterilized water 12.2 13.2 12.275 12.2 12.275 14.2 12.2 Template DNA 1 1 1 1 1 1 1 total capacity 25 25 25 25 25 25 25

Amplification system: [Table 2] PCR reaction process HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin step Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Number of cycles Predenaturation 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 63°C for 30 seconds 60°C 30 seconds 60°C 30 seconds 60°C 30 seconds 60°C 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C 30 seconds 60°C 30 seconds 55°C 60 seconds 55°C 60 seconds 55°C 60 seconds 55°C 60 seconds 54°C 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 1

4. Test results

4.1. Test results in paraffin tissue

Sample information: There are a total of 185 lung tissue samples, including 87 normal tissue samples, 98 cancer tissue samples, 15 squamous cell carcinomas, 81 adenocarcinomas, and 2 unclearly classified lung cancers, including cancer And 73 pairs of adjacent control samples.

The ROC curves of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and the combination of HOXA7 and HOXA9 in all tissue specimens are shown in Figure 1. The statistical results of each gene detected in the tissue are shown in Table 3. [Table 3] Test results in the organization Analysis group index HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 Comparison between normal group and all cancer groups Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 63.3% 78.6% 80.6% 69.4% 40.8% 67.3% Comparison of normal group and all squamous cell carcinoma group Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 60% 93.3% 93.3% 53.3% 60.0% 73.3% Comparison of normal group and all adenocarcinoma group Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 63.0% 75.3% 79.0% 71.6% 38.3% 65.4% [Continued Table 3] Test results in the organization Analysis group index HOXA7&HOXA9 HOXA7&HOXD8 HOXA9&HOXD8 Comparison between normal group and all cancer groups Specificity 89.7% 88.5% 88.5% Sensitivity 84.7% 70.4% 78.6% Comparison of normal group and all squamous cell carcinoma group Specificity 89.7% 88.5% 88.5% Sensitivity 93.3% 73.3% 93.3% Comparison of normal group and all adenocarcinoma group Specificity 89.7% 88.5% 88.5% Sensitivity 82.7% 69.1% 75.3%

From the above results, it can be seen that in the tissue samples, whether it is to compare and analyze lung cancer as a whole or according to the subtype of lung cancer, SHOX2 and HOXA9 have the best detection effect, and HOXA7, PCDHGA12 and GATA3 have the best detection effect. Secondly, the detection effect of HOXD8 was the worst, with a sensitivity of only 40.8%.

Although combined detection has been applied in existing technologies, it is not synergistic for combined detection. For example, Hubers et al. (DNA hypermethylation analysis in sputum for the diagnosis of lung cancer: training validation set approach) studied RASSF1A, 3OST2 and PHACTR3 alone The sensitivity of detecting lung cancer in sputum is 42.5%, 31.5%, and 28.8%, respectively. The combined detection sensitivity of the three can only reach 67.1%, and the specificity is reduced from 96.5% to 89.5%. The results show that the combined detection of lung cancer markers is effective. There is no synergistic enhancement. Similarly, in this disclosure, the two-by-two combinations of HOXA7, HOXA9, and HOXD8, which are all of the HOXA family, only the combination of HOXA7&HOXA9, whether in all cancers, in squamous cell carcinoma, or in lung cancer that is difficult to detect, has Higher sensitivity than other combinations, and other HOXA family combinations have no significant enhancement effect.

Based on the above results, in order to study the detection of different genes in sputum, the inventors further screened the six markers of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3 in sputum.

Example 2: Detection of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8 and GATA3, and the combination of HOXA7 and HOXA9 in sputum

Sample information: A total of 90 sputum samples were tested, including 55 normal control samples, 35 cancer control samples, and 35 cancer samples including 12 squamous cell carcinomas, 6 small cell carcinomas, 9 adenocarcinomas, and large cells There were 2 cases of cancer and 6 cases of lung cancer not clearly classified.

Experimental procedure:

a. Collect sputum specimens from patients with lung cancer and non-lung cancer patients. After dethickening with DTT, centrifuge to remove the precipitate to separate the cells, wash twice with PBS, and then use the DNA extraction kit (HiPure) from Magen. FFPE DNA Kit, D3126-03) to extract DNA.

b. Use ZYMO RESEARCH's DNA transformation kit (EZ DNA Methylation Kit, D5002) to modify the DNA with bisulfite.

c. The dosing system is as follows: [Table 4] Dosing system HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin Reaction component Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Upstream primer (100 µM) 0.125 0.125 0.05 0.125 0.05 0.125 0.125 Downstream primer (100 µM) 0.125 0.125 0.125 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 0.05 0.05 0.05 Magnesium ion (25 mM) 5 4 5 5 5 3 5 dNTPs (10 mM) 1 1 1 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 5×buffer 5 5 5 5 5 5 5 Sterilized water 12.2 13.2 12.275 12.2 12.275 14.2 12.2 Template DNA 1 1 1 1 1 1 1 total capacity 25 25 25 25 25 25 25

The amplification system is as follows: [Table 5] Amplification system PCR reaction process HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin step Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Temperature and time Number of cycles Predenaturation 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 63°C for 30 seconds 60°C 30 seconds 60°C 30 seconds 60°C 30 seconds 60°C 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C 30 seconds 60°C 30 seconds 55°C 60 seconds 55°C 60 seconds 55°C 60 seconds 55°C 60 seconds 54°C 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 1

The test results are as follows: [Table 6] Test results in sputum Analysis group index HOXA7 HOXA9 SHOX2 PCDHGA12 HOXD8 GATA3 HOXA7&HOXA9 combination Comparison between normal group and all cancer groups Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% 90.9% Sensitivity 88.6% 74.3% 51.4% 20.0% 42.9% 17.1% 97.1% Comparison of normal group and all squamous cell carcinoma group Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% 90.9% Sensitivity 100.0% 75.0% 66.7% 25.0% 66.7% 25.0% 100% Comparison of normal group and all adenocarcinoma group Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% 90.9% Sensitivity 88.9% 55.6% 11.1% 33.3% 11.1% 0.0% 100% Comparison between normal group and all small cell carcinoma groups Specificity 95.0% 95.0% 95.0% 95.0% 95.0% 95.0% 90.9% Sensitivity 83.3% 100% 83.3% 0.0% 50.0% 33.3% 100% Continued Table 6 Test results in sputum Analysis group index HOXA7&HOXA9 combination HOXA7&HOXD8 HOXA9&HOXD8 Comparison between normal group and all cancer groups Specificity 90.9% 90.9% 90.9% Sensitivity 97.1% 91.4% 80.0% Comparison of normal group and all squamous cell carcinoma group Specificity 90.9% 90.9% 90.9% Sensitivity 100% 100% 91.7% Comparison of normal group and all adenocarcinoma group Specificity 90.9% 90.9% 90.9% Sensitivity 100% 88.9% 55.6% Comparison between normal group and all small cell carcinoma groups Specificity 90.9% 90.9% 90.9% Sensitivity 100% 83.3% 100%

f. The ROC curves of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and the combination of HOXA7 and HOXA9 in all sputum samples are shown in Figure 2, and the statistical results are shown in Table 6. From the above results, it can be seen that in the sputum samples , To detect these 6 genes at the same time for comparison, whether it is to compare and analyze lung cancer as a whole or according to the subtype of lung cancer, the combined detection effect of HOXA7 and HOXA9 is better than the other 4 genes or HOXA7 and HOXA9 The effect of separate detection; at the same time, it is better than the combination of HOXA7&HOXD8 and HOXA9&HOXD8.

Especially for the detection effect of adenocarcinoma, the combination of HOXA7 and HOXA9 has a better detection rate than other genes, and the sensitivity can even reach 100%. Such a high sensitivity can basically achieve zero missed detection for early screening of adenocarcinoma. So that patients can get accurate risk tips, treat early, and reduce the mortality of adenocarcinoma. However, the sensitivity of existing tumor markers in lung cancer to adenocarcinoma is only 14.3%, while when HOXA7 or HOXA9 is detected alone, the sensitivity to adenocarcinoma is only 88.9%. When the two are combined, the sensitivity to lung cancer is only 88.9%. Up to 100%, the two are synergistic.

Comparing the test results of each gene, it is found that the two best genes, HOXA7 and HOXA9, have a significant synergistic effect on increasing the positive rate of system detection, and the specific manifestation is that it significantly increases the detection rate of adenocarcinoma. Adenocarcinoma is generally peripheral. Due to the tree-like physiological structure of the bronchi, it is more difficult for the exfoliated cells in the deep lung to be coughed up through sputum, so it is more difficult and meaningful to detect this part.

Example 3: Detection of HOXA7, HOXA9 and SHOX2 genes in sputum

A large number of documents show that SHOX2 can be used as a marker for the detection of lung cancer, and there are patents showing [CN201510203539 Methods and kits for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication], SHOX2 is used in alveolar lavage fluid, lesion tissue, Pleural fluid, sputum and other samples have a high detection rate. In order to verify the detection effect of HOXA7 and HOXA9, the inventors simultaneously detected HOXA7, HOXA9 and SHOX2_n3 genes. In this embodiment, the detection efficiency of the SHOX2 gene adopts the primer and probe sequences disclosed in patent CN201510203539, and the SHOX2 gene is expressed as SHOX2_n3 to distinguish it from the self-designed primers and probes used in Examples 1 and 2 of this disclosure. Needle detection of the SHOX2 gene.

The result of detection.

The primer probes for each gene detection are as follows:

HOXA7 detection primers and probes are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 Probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

HOXA9 detection primers and probes are: SEQ ID NO: 4 HOXA9-F2 primer F: TTAGTTTTTTCGGTAGGCGGC SEQ ID NO: 5 HOXA9-R2 Primer R: AAACGCCAAACACCGTCG SEQ ID NO: 6 HOXA9-P2 Probe: FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1

SHOX2_n3 detection primers and probes are: SEQ ID NO: 22 SHOX2_n3 Primer F: TTTGGATAGTTAGGTAATTTTCG SEQ ID NO: 23 SHOX2_n3 Primer R: CGTACACGCCTATACTCGTACG SEQ ID NO: 24 SHOX2_n3.2 Probe: FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. The dosing system is as follows: [Table 7] Dosing system HOXA7 HOXA9 SHOX2_n3 β-actin Reaction component Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Upstream primer (100 µM) 0.125 0.125 0.125 0.125 Downstream primer (100 µM) 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 Magnesium ion (25 mM) 5 4 5 5 dNTPs (10 mM) 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 5×buffer 5 5 5 5 Sterilized water 12.2 13.2 12.2 12.2 Template DNA 1 1 1 1 total capacity 25 25 25 25

b. The amplification system is as follows: [Table 8] Amplification system HOXA7 HOXA9 β-actin step Temperature and time Temperature and time Temperature and time Number of cycles Predenaturation 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 63°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C 30 seconds 60°C 30 seconds 54°C 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 1 [Table 9] SHOX2_n3 reaction program step Temperature and time Number of cycles Predenaturation 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 45 60°C 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 1

c. The test results are as follows:

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio=target gene copy number/ACTB copy number*100 to judge the methylation degree of the two sets of samples. Finally, the threshold of HOXA7 is selected as 0.77. The threshold of HOXA9 is 2.3, and the threshold of SHOX2_n3 is 1.3. As a criterion for judging the cancer group and the control group, the converted ratio can be judged as positive "+" if the ratio exceeds the set threshold, and negative "-" if the ratio is equal to or less than the set threshold. According to this standard, the test results of 90 sputum samples are as follows: [Table 10] Test results HOXA7 HOXA9 SHOX2_n3 HOXA7 HOXA9 SHOX2_n3 HOXA7& HOXA9 combination Serial number Sample type Methylation rate Methylation rate Methylation rate Detected situation Detected situation Detected situation Detected situation 1 Non-lung cancer control 0.0 0.1 0.2 − − − − 2 Non-lung cancer control 0.0 0.5 0.0 − − − − 3 Non-lung cancer control 0.0 0.5 0.0 − − − − 4 Non-lung cancer control 0.7 0.8 0.2 − − − − 5 Non-lung cancer control 0.0 0.5 0.1 − − − − 6 Non-lung cancer control 0.0 0.6 0.3 − − − − 7 Non-lung cancer control 0.6 1.6 0.2 − − − − 8 Non-lung cancer control 0.4 0.6 0.3 − − − − 9 Non-lung cancer control 0.3 0.3 0.0 − − − − 10 Non-lung cancer control 0.4 7.1 4.0 − + + + 11 Non-lung cancer control 0.6 0.9 0.4 − − − − 12 Non-lung cancer control 0.6 0.0 0.2 − − − − 13 Non-lung cancer control 0.0 0.3 0.0 − − − − 14 Non-lung cancer control 0.2 0.4 0.1 − − − − 15 Non-lung cancer control 0.0 0.0 0.0 − − − − 16 Non-lung cancer control 0.6 0.3 0.3 − − − − 17 Non-lung cancer control 0.0 0.4 0.0 − − − − 18 Non-lung cancer control 0.0 0.4 0.0 − − − − 19 Non-lung cancer control 0.0 0.0 0.0 − − − − 20 Non-lung cancer control 0.8 2.3 1.1 + − − + twenty one Non-lung cancer control 0.5 1.3 0.4 − − − − twenty two Non-lung cancer control 0.7 0.8 2.0 − − + − twenty three Non-lung cancer control 0.76 0.3 0.1 − − − − twenty four Non-lung cancer control 0.0 0.5 0.0 − − − − 25 Non-lung cancer control 0.1 1.2 0.5 − − − − 26 Non-lung cancer control 0.4 0.5 0.3 − − − − 27 Non-lung cancer control 0.2 0.2 0.0 − − − − 28 Non-lung cancer control 0.0 0.4 0.0 − − − − 29 Non-lung cancer control 0.0 0.3 0.0 − − − − 30 Non-lung cancer control 0.0 0.0 0.0 − − − − 31 Non-lung cancer control 0.0 0.0 0.4 − − − − 32 Non-lung cancer control 0.0 0.0 0.0 − − − − 33 Non-lung cancer control 0.0 0.3 0.5 − − − − 34 Non-lung cancer control 0.4 0.0 0.7 − − − − 35 Non-lung cancer control 0.7 0.2 0.3 − − − − 36 Non-lung cancer control 0.4 0.7 0.8 − − − − 37 Non-lung cancer control 0.0 0.0 0.1 − − − − 38 Non-lung cancer control 2.2 0.8 0.6 + − − + 39 Non-lung cancer control 0.3 0.2 0.3 − − − − 40 Non-lung cancer control 0.0 0.0 0.2 − − − − 41 Non-lung cancer control 0.6 3.7 1.7 − + + + 42 Non-lung cancer control 0.0 0.4 0.0 − − − − 43 Non-lung cancer control 0.0 0.6 0.6 − − − − 44 Non-lung cancer control 0.1 0.0 1.1 − − − − 45 Non-lung cancer control 0.2 0.0 0.2 − − − − 46 Non-lung cancer control 0.2 0.1 0.2 − − − − 47 Non-lung cancer control 0.0 0.0 0.2 − − − − 48 Non-lung cancer control 0.3 0.1 0.0 − − − − 49 Non-lung cancer control 0.6 0.1 0.4 − − − − 50 Non-lung cancer control 0.0 0.1 0.2 − − − − 51 Non-lung cancer control 0.2 0.0 0.4 − − − − 52 Non-lung cancer control 0.0 0.0 0.2 − − − − 53 Non-lung cancer control 0.5 0.5 0.6 − − − − 54 Non-lung cancer control 0.0 0.0 0.0 − − − − 55 Non-lung cancer control 3.1 2.3 0.7 + + − + 56 Squamous cell carcinoma 2.1 4.9 3.5 + + + + 57 Squamous cell carcinoma 14.6 46.5 22.7 + + + + 58 Squamous cell carcinoma 14.7 27.4 8.3 + + + + 59 Squamous cell carcinoma 29.2 73.8 23.6 + + + + 60 Squamous cell carcinoma 2.1 2.2 9.5 + − + + 61 Squamous cell carcinoma 3.2 4.7 1.2 + + − + 62 Squamous cell carcinoma 12.1 7.2 7.1 + + + + 63 Squamous cell carcinoma 8.3 98.0 96.8 + + + + 64 Squamous cell carcinoma 1.4 2.1 0.9 + − − + 65 Squamous cell carcinoma 25.9 22.3 23.0 + + + + 66 Squamous cell carcinoma 4.1 66.7 94.2 + + + + 67 Squamous cell carcinoma 1.3 0.9 0.0 + − − + 68 Adenocarcinoma 4.6 2.5 2.9 + + + + 69 Adenocarcinoma 0.9 1.0 0.2 + − − + 70 Adenocarcinoma 2.6 0.7 0.0 + − − + 71 Adenocarcinoma 2.5 1.7 1.6 + − + + 72 Adenocarcinoma 0.9 6.0 0.0 + + − + 73 Adenocarcinoma 0.0 2.8 0.4 − + − + 74 Adenocarcinoma 4.4 3.5 2.7 + + + + 75 Adenocarcinoma 6.0 0.8 0.1 + − − + 76 Adenocarcinoma 3.3 2.5 0.0 + + − + 77 Small cell carcinoma 10.0 29.3 17.3 + + + + 78 Small cell carcinoma 21.7 34.1 16.8 + + + + 79 Small cell carcinoma 6.5 29.9 20.4 + + + + 80 Small cell carcinoma 10.1 14.8 16.5 + + + + 81 Small cell carcinoma 37.3 21.3 40.1 + + + + 82 Small cell carcinoma 0.2 5.9 0.8 − + − + 83 Large cell carcinoma 4.4 9.9 7.7 + + + + 84 Large cell carcinoma 1.0 1.1 0.1 + − − + 85 Poorly differentiated carcinoma 0.3 0.3 0.5 − − − − 86 Poorly differentiated carcinoma 0.2 9.0 11.6 − + + + 87 Lung cancer 15.7 29.9 6.3 + + + + 88 Lung cancer 46.9 49.4 88.7 + + + + 89 Lung cancer 77.0 48.6 48.6 + + + + 90 Lung cancer 2.3 4.4 1.1 + + − +

Note: "+" means the methylated DNA test is positive, "-" means the methylated DNA test is negative; in the case of collaborative testing of specimens, if both are negative, it is judged as negative, and one yin and one yang or both are positive. Is positive.

d. Result analysis [Table 11] Statistical results Analysis group index HOXA7 HOXA9 HOXA7&HOXA9 combination SHOX2_n3 Comparison between normal group and all cancer groups Specificity 95.0% 95.0% 90.9% 95.0% Sensitivity 88.6% 74.3% 97.1% 62.9% Comparison of normal group and all squamous cell carcinoma group Specificity 95.0% 95.0% 90.9% 95.0% Sensitivity 100% 75.0% 100% 75.0% Comparison of normal group and all adenocarcinoma group Specificity 95.0% 95.0% 90.9% 95.0% Sensitivity 88.9% 55.6% 100% 33.3% Comparison between normal group and all small cell carcinoma groups Specificity 95.0% 95.0% 90.9% 95.0% Sensitivity 83.3% 100% 100% 83.3%

e. The ROC curve of the combination of HOXA7 and HOXA9 and SHOX2_n3 in all sputum samples is shown in Figure 3. The amplification curve of HOXA7, HOXA9 and SHOX2_n3 in sputum samples is shown in Figure 4, and the statistical results are shown in Table 11. It can be seen that in the sputum samples, the lung cancer as a whole is compared and analyzed, or according to the subtype of lung cancer. The detection effect of HOXA7 and HOXA9 is better than the detection effect of SHOX2 gene, through the combination of HOXA7 and HOXA9. Samples can effectively increase the positive detection rate. In all samples, the positive detection rate is 97.1%. Among them, the detection sensitivity for squamous cell carcinoma, adenocarcinoma and small cell carcinoma has reached 100%. In many types of lung cancer, such high sensitivity can be achieved, and when used in clinical detection, it undoubtedly has greater versatility. Especially for the detection effect of adenocarcinoma, the sensitivity of HOXA7 and HOXA9 combined to detect adenocarcinoma is as high as 100%, while the sensitivity of the existing primers and probes for SHOX2 detection to adenocarcinoma is only 33.3%. Adenocarcinoma is generally of the peripheral type. Due to the tree-like physiological structure of the bronchi, it is more difficult for the exfoliated cells in the deep lung to be coughed up through sputum. For the first time, this disclosure has discovered a method that can detect adenocarcinoma by using sputum as a sample and can greatly increase the sensitivity. Raising the mark to 100%, this breakthrough is of great significance to the detection of adenocarcinoma.

Example 4: Detection of HOXA7, HOXA9 and SHOX2 genes in lavage fluid

Sample information: A total of 79 samples of alveolar lavage fluid were tested, including 58 samples from the normal control group, 21 samples from the cancer group, 21 samples from the cancer group, 6 cases of squamous cell carcinoma, 4 cases of small cell carcinoma, and 11 cases of adenocarcinoma .

Experimental procedure:

a. Collect alveolar lavage fluid specimens from lung cancer patients and non-lung cancer patients, centrifuge to separate the cells, and then use Magen's DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. Use ZYMO RESEARCH's DNA transformation kit (EZ DNA Methylation Kit, D5002) to modify the DNA with bisulfite.

c. The amplification detection system is as follows: [Table 12] Amplification system HOXA7 HOXA9 SHOX2_n3 β-actin Reaction component Adding amount (µl) Adding amount (µl) Adding amount (µl) Adding amount (µl) Upstream primer (100 µM) 0.125 0.125 0.125 0.125 Downstream primer (100 µM) 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 Magnesium ion (25 mM) 5 4 5 5 dNTPs (10 mM) 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 5×buffer 5 5 5 5 Sterilized water 12.2 13.2 12.2 12.2 Template DNA 1 1 1 1 total capacity 25 25 25 25

d. The detection system is as follows: [Table 13] Reaction procedures of HOXA7 and HOXA9 HOXA7 HOXA9 β-actin step Temperature and time Temperature and time Temperature and time Number of cycles Predenaturation 95°C 5 minutes 95°C 5 minutes 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 63°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C 30 seconds 60°C 30 seconds 54°C 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 40°C 30 seconds 40°C 30 seconds 1 [Table 14] SHOX2_n3 reaction program step Temperature and time Number of cycles Predenaturation 95°C 5 minutes 1 Amplification 1 95°C for 20 seconds 45 60°C 30 seconds 72°C for 30 seconds cool down 40°C 30 seconds 1

e. The test results are as follows:

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio=target gene copy number/ACTB copy number*100 to judge the methylation degree of the two sets of samples, and finally select the threshold of HOXA7 to be 0.7. The threshold of HOXA9 is 0.5, and the threshold of SHOX2_n3 is 0.6. It is used as a criterion for judging the cancer group and the control group. The converted ratio can be judged as positive "+" if the ratio exceeds the set threshold, and negative "-" if the ratio is equal to or less than the set threshold. According to this standard, the test results of 79 lavage fluid samples are as follows: [Table 15] Test results HOXA7 HOXA9 SHOX2_n3 HOXA7 HOXA9 HOXA7& HOXA9 combination SHOX2_n3 Serial number Organization Type Methylation rate Methylation rate Methylation rate Detected situation Detected situation Detected situation Detected situation 1 Non-lung cancer control 0.3 0.2 0.3 − − − − 2 Non-lung cancer control 0.6 0.1 0.7 − − − + 3 Non-lung cancer control 0.3 0.2 0.1 − − − − 4 Non-lung cancer control 0.3 0.5 0.6 − − − − 5 Non-lung cancer control 0.0 0.1 0.2 − − − − 6 Non-lung cancer control 0.3 0.2 0.1 − − − − 7 Non-lung cancer control 0.0 0.0 0.0 − − − − 8 Non-lung cancer control 0.2 0.1 0.0 − − − − 9 Non-lung cancer control 0.0 0.0 0.0 − − − − 10 Non-lung cancer control 0.0 0.0 0.0 − − − − 11 Non-lung cancer control 0.0 0.0 0.1 − − − − 12 Non-lung cancer control 0.3 0.0 0.1 − − − − 13 Non-lung cancer control 0.3 0.0 0.1 − − − − 14 Non-lung cancer control 0.0 0.3 0.1 − − − − 15 Non-lung cancer control 0.70 0.3 0.5 + − + − 16 Non-lung cancer control 0.2 0.1 0.1 − − − − 17 Non-lung cancer control 0.1 0.0 0.0 − − − − 18 Non-lung cancer control 0.2 0.4 0.2 − − − − 19 Non-lung cancer control 0.2 0.1 0.2 − − − − 20 Non-lung cancer control 0.0 0.0 0.3 − − − − twenty one Non-lung cancer control 0.0 0.0 0.0 − − − − twenty two Non-lung cancer control 0.0 0.0 0.2 − − − − twenty three Non-lung cancer control 0.0 0.0 0.1 − − − − twenty four Non-lung cancer control 0.3 0.0 0.1 − − − − 25 Non-lung cancer control 0.0 0.0 0.0 − − − − 26 Non-lung cancer control 0.6 0.1 0.2 − − − − 27 Non-lung cancer control 0.0 0.1 0.1 − − − − 28 Non-lung cancer control 0.3 0.1 0.3 − − − − 29 Non-lung cancer control 0.3 0.1 0.1 − − − − 30 Non-lung cancer control 0.67 0.5 0.5 + − + − 31 Non-lung cancer control 0.0 0.0 0.2 − − − − 32 Non-lung cancer control 0.0 0.0 0.4 − − − − 33 Non-lung cancer control 0.1 0.1 0.1 − − − − 34 Non-lung cancer control 0.3 0.5 0.5 − − − − 35 Non-lung cancer control 0.2 0.1 0.2 − − − − 36 Non-lung cancer control 0.4 0.8 0.8 − + + + 37 Non-lung cancer control 0.0 0.1 0.4 − − − − 38 Non-lung cancer control 0.2 0.1 0.1 − − − − 39 Non-lung cancer control 0.3 0.2 0.2 − − − − 40 Non-lung cancer control 0.5 0.3 0.3 − − − − 41 Non-lung cancer control 0.3 0.4 0.3 − − − − 42 Non-lung cancer control 0.2 0.1 0.1 − − − − 43 Non-lung cancer control 0.3 0.8 0.6 − + + + 44 Non-lung cancer control 0.3 0.0 0.1 − − − − 45 Non-lung cancer control 0.7 0.2 0.2 − − − − 46 Non-lung cancer control 0.2 0.0 0.1 − − − − 47 Non-lung cancer control 0.2 0.1 0.1 − − − − 48 Non-lung cancer control 0.2 0.3 0.2 − − − − 49 Non-lung cancer control 0.2 0.1 0.4 − − − − 50 Non-lung cancer control 0.0 0.0 0.0 − − − − 51 Non-lung cancer control 0.2 0.2 0.0 − − − − 52 Non-lung cancer control 0.4 0.5 0.5 − − − − 53 Non-lung cancer control 0.0 0.0 0.0 − − − − 54 Non-lung cancer control 0.4 1.1 0.1 − + + − 55 Non-lung cancer control 0.2 0.4 0.0 − − − − 56 Non-lung cancer control 0.0 0.0 0.0 − − − − 57 Non-lung cancer control 2.6 0.2 0.0 + − + − 58 Non-lung cancer control 0.0 0.0 0.0 − − − − 59 Squamous cell carcinoma 0.2 0.5 0.3 − − − − 60 Squamous cell carcinoma 42.2 76.9 321.9 + + + + 61 Squamous cell carcinoma 21.9 60.9 56.7 + + + + 62 Squamous cell carcinoma 11.3 0.3 0.0 + − + − 63 Squamous cell carcinoma 14.5 17.7 7.6 + + + + 64 Squamous cell carcinoma 1.6 1.5 0.6 + + + + 65 Adenocarcinoma 0.7 0.5 0.6 + − + − 66 Adenocarcinoma 1.2 0.3 0.0 + − + − 67 Adenocarcinoma 0.8 0.3 0.4 + − + − 68 Adenocarcinoma 34.8 3.7 33.5 + + + + 69 Adenocarcinoma 2.8 2.9 2.3 + + + + 70 Adenocarcinoma 0.3 0.1 0.0 − − − − 71 Adenocarcinoma 0.3 0.3 0.3 − − − − 72 Adenocarcinoma 1.9 0.0 1.4 + + + + 73 Adenocarcinoma 0.0 20.8 8.6 − + + + 74 Adenocarcinoma 4.2 5.3 0.3 + + + − 75 Adenocarcinoma 0.9 0.9 0.2 + + + − 76 Small cell carcinoma 0.6 0.8 0.3 − + + − 77 Small cell carcinoma 24.2 26.4 97.7 + + + + 78 Small cell carcinoma 0.8 1.8 7.6 + + + + 79 Small cell carcinoma 1.7 0.6 2.4 + + + +

Note: "+" means the methylated DNA test is positive, "-" means the methylated DNA test is negative; in the case of collaborative testing of specimens, if both are negative, it is judged as negative, and one yin and one yang or both are positive. Is positive. [Table 16] Statistical results Analysis group index HOXA7 HOXA9 HOXA7&HOXA9 combination SHOX2_n3 Comparison between normal group and all cancer groups Specificity 95.0% 95.0% 89.7% 95.0% Sensitivity 76.2% 61.9% 85.7% 52.4% Comparison of normal group and all squamous cell carcinoma group Specificity 95.0% 95.0% 89.7% 95.0% Sensitivity 83.3% 66.7% 83.3% 66.7% Comparison of normal group and all adenocarcinoma group Specificity 95.0% 95.0% 89.7% 95.0% Sensitivity 72.7% 45.5% 81.8% 36.4% Comparison between normal group and all small cell carcinoma groups Specificity 95.0% 95.0% 89.7% 95.0% Sensitivity 75.0% 100% 100% 75.0%

f. The ROC curve of the combination of HOXA7 and HOXA9 and SHOX2_n3 in all lavage fluid samples is shown in Figure 5. The amplification curves of HOXA7, HOXA9 and SHOX2_n3 in lavage samples are shown in Figure 6, and the statistical results are shown in Table 16. The results show that in the lavage fluid samples, whether the lung cancer as a whole is compared or analyzed according to the subtypes of lung cancer, the detection effect of HOXA7 and HOXA9 is better than the detection effect of SHOX2 gene, through HOXA7 Combining testing samples with HOXA9 can effectively increase the positive detection rate. In all samples, the positive detection rate is 85.7%. Especially for the detection effect of adenocarcinoma, the sensitivity of HOXA7 and HOXA9 in detecting adenocarcinoma is as high as 81.8%, which is much higher than that of SHOX2, 36.4%, and is also higher than the sensitivity of HOXA7 and HOXA9 genes in tissues to adenocarcinoma. Very rare and rare. Adenocarcinoma is generally peripheral. Due to the tree-like physiological structure of the bronchi, it is more difficult for the exfoliated cells in the deep lung to be coughed up through sputum, so it is more difficult and meaningful to detect this part.

In addition, in the lavage fluid, the sensitivity to small cell carcinoma is 100%, and whether it is HOXA7, HOXA9, or SHOX2, the sensitivity to small cell carcinoma is only 75%. Such a zero missed detection rate is of great significance for early screening of small cell carcinoma.

Combining the above four embodiments can fully illustrate that the combination of HOXA7 and HOXA9 has a better detection effect in the detection and diagnosis of lung cancer, especially the application of sputum, alveolar lavage fluid and other biological samples. Can be more easily applied to large-scale population screening. Has more superior socioeconomic value.

Example 5: Primer design and optimization of HOXA7 and HOXA9

1. The influence of the detection area on the detection effect

Various research data indicate that the methylation status and distribution of the same gene are not uniform. Therefore, for the same gene, methylation primers and probe detection systems designed in different regions are used to diagnose the same sample and the same tumor. The detection efficiency is not the same, and sometimes the selected area is not suitable, resulting in no diagnostic effect on the tumor. After repeated research and comparison by the inventor, some of the regional sequences of HOXA7 and HOXA9 are as follows: [Table 17] HOXA7 sequence to be detected Sequence name sequence SEQ ID NO: 25 HOXA7 region 1 reference sequence SEQ ID NO: 26 The sequence of the HOXA7 region 1 sequence converted after treatment with bisulfite SEQ ID NO: 27 HOXA7 region 2 reference sequence CGTCCGGCTACGGCCTGGGCGCCGACGCCTACGGCAACCTGCCCTGCGCCTCCTACGACCAAAACATCCCCGGGCTCTGCAGTGACCTCGCCAAAGGCGCCTGCGACAAGACGGACGAGGGCGCGCTGCATGGCGCGGCTGAGGCCAATTTCCGCATCTACCCCTGGATGCGGTCTTCAGGTAGGCGCAGTCGCTAGGCGGGCCAGGCTGGCGGAGCGGGACCGGGAGCGGGGAGCGCAGCGCTGGGGAGCGCGGAGCGCGGGGCGCGGGGCCGGAAGAGCGGAGCCAGGCTGTTGCGAGCCGGTAGCCCCGTGACTCCCGGCGCA SEQ ID NO: 28 HOXA7 region 2 reference sequence converted sequence after bisulfite treatment CGTTCGGTTACGGTTTGGGCGTCGACGTTTACGGTAATTTGTTTTGCGTTTTTTACGATTAAAATATTTTCGGGTTTTGTAGTGATTTCGTTAAAGGCGTTTGCGATAAGACGGACGAGGGCGCGTTGTATGGCGCGGTTGAGGTTAATTTTCGTATTTATTTTTGGATGCGGTTTTTAGGTAGGCGTAGTCGTTAGGCGGGTTAGGTTGGCGGAGCGGGATCGGGAGCGGGGAGCGTAGCGTTGGGGAGCGCGGAGCGCGGGGCGCGGGGTCGGAAGAGCGGAGTTAGGTTGTTGCGAGTCGGTAGTTTCGTGATTTTCGGCGTA [Continued Table 17] HOXA9 sequence to be tested Sequence name sequence SEQ ID NO: 29 HOXA9 region 1 reference sequence AATTTCCGTGGGTCGGGCCGGGCGGGCCAGGCGCTGGGCACGGTGATGGCCACCACTGGGGCCCTGGGCAACTACTACGTGGACTCGTTCCTGCTGGGCGCCGACGCCGCGGATGAGCTGAGCGTTGGCCGCTATGCGCCGGGGACCCTGGGCCAGCCTCCCCGGCAGGCGGCGACGCTGGCCGAGCACCCCGACTTCAGCCCGTGCAGCTTCCAGTCCAAGGCGACGGTGTTTGGCGCCTCGTGGAACCCAGTGCACGCGGCGGGCGCCAACGCTGTACCCGCTGCGGTGTACCACCACCATCACCACCACCCCTACGTGCACCCCCAGGCGCCCGTGGCGGCG SEQ ID NO: 30 The sequence of the HOXA9 region 1 sequence converted after treatment with bisulfite AATTTTCGTGGGTCGGGTCGGGCGGGTTAGGCGTTGGGTACGGTGATGGTTATTATTGGGGTTTTGGGTAATTATTACGTGGATTCGTTTTTGTTGGGCGTCGACGTCGCGGATGAGTTGAGCGTTGGTCGTTATGCGTCGGGGATTTTGGGTTAGTTTTTTCGGTAGGCGGCGACGTTGGTCGAGTATTTCGATTTTAGTTCGTGTAGTTTTTAGTTTAAGGCGACGGTGTTTGGCGTTTCGTGGAATTTAGTGTACGCGGCGGGCGTTAACGTTGTATTCGTTGCGGTGTATTATTATTATTATTATTATTTTTACGTGTATTTTTAGGCGTTCGTGGCGGCG SEQ ID NO: 31 HOXA9 region 2 reference sequence SEQ ID NO: 32 HOXA9 region 2 reference sequence converted sequence after bisulfite treatment SEQ ID NO: 33 HOXA9 region 3 reference sequence SEQ ID NO: 34 HOXA9 region 3 reference sequence converted sequence after bisulfite treatment SEQ ID NO: 35 β-actin region reference sequence SEQ ID NO: 36 The sequence converted after the β-actin sequence is treated with bisulfite

We designed different methylation primers and probes according to region 1, region 2 of HOXA7 sequence, and region 1, region 2 and region 3 of HOXA9 sequence. The information of each primer probe is shown in Table 19.

For the HOXA7 sequence, group 8, group 9, group 10 are based on the methylation primers and probes designed according to region 1; group 1, group 2, group 3, group 4, group 5, group 6, and group 7 are based on region 2 Designed methylation primers and probes.

For HOXA9 sequence, group 1, group 2, group 3, group 4, and group 5 are methylation primers and probes designed according to region 1; group 6, group 7, and group 8 are methylation primers designed according to region 2. And probes; Group 9, Group 10, Group 11 are methylated primers and probes designed according to region 3.

The following primer probe combinations were tested in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, 4 squamous cell carcinomas and 21 adenocarcinomas among the 25 cancer samples. The test results are shown in Table 18. [Table 18] Test results of HOXA7 primers in tissues Area Group Primer probe combination Specificity Sensitivity Area 2 Group 1 H7-F2, H7-R2, H7-P2 100% 80% Area 2 Group 2 H7-F3, H7-R3, H7-P3 100% 76% Area 2 Group 3 H7-F4, H7-R4, H7-P4 100% 56% Area 2 Group 4 H7-F5, H7-R5, H7-P5 100% 72% Area 2 Group 5 H7-F6, H7-R6, H7-P6 100% 80% Area 2 Group 6 H7-F7, H7-R7, H7-P7 100% 72% Area 2 Group 7 H7-F8, H7-R8, H7-P8 100% 56% Area 1 Group 8 H7-F9, H7-R9, H7-P9 100% 48% Area 1 Group 9 H7-F10, H7-R10, H7-P10 100% 16% Area 1 Group 10 H7-F11, H7-R11, H7-P11 100% twenty four% [Continued Table 18] Test results of HOXA9 primers in tissues Area Group Primer probe combination Specificity Sensitivity Area 1 Group 1 H9-F2, H9-R2, H9-P2 100% 76% Area 1 Group 2 H9-F3, H9-R3, H9-P3 100% 76% Area 1 Group 3 H9-F4, H9-R4, H9-P4 100% 40% Area 1 Group 4 H9-F5, H9-R5, H9-P5 100% 60% Area 1 Group 5 H9-F6, H9-R6, H9-P6 100% 68% Area 2 Group 6 H9-F7, H9-R7, H9-P7 100% 32% Area 2 Group 7 H9-F8, H9-R8, H9-P8 100% 20% Area 2 Group 8 H9-F9, H9-R9, H9-P9 100% 12% Area 3 Group 9 H9-F10, H9-R10, H9-P10 100% 16% Area 3 Group 10 H9-F11, H9-R11, H9-P11 100% twenty four% Area 3 Group 11 H9-F12, H9-R12, H9-P12 100% twenty four%

The results show that for HOXA7, no matter how the primers and probes are designed for region 1, the detection sensitivity of region 1 can only reach 48%, and regardless of the primers and probes designed in the present disclosure, the detection sensitivity of region 2 is the lowest. Can reach 56%, up to 80%. Therefore, the detection rate of HOXA7 in area 2 is significantly higher than that in area 1 (see Table 18).

Regarding HOXA9, regardless of how the primers and probes are designed for regions 2 and 3, the detection sensitivity for these two regions can only reach 32%, and regardless of the primers and probes designed in this disclosure, the detection sensitivity of region 1 is the lowest It can also reach 40%, up to 76%. Therefore, the detection rate of HOXA7 area 1 is significantly higher than that of areas 2 and 3 (see Table 18).

2. The influence of primers and probes on detection results

In addition to the detection area that will affect the detection effect, primers and probes also have a great impact on the detection effect of tumor markers. During the research process, the inventor designed multiple pairs of primers and their corresponding probes to find the best possible detection Sensitive and specific probes and primers, so that the detection reagents of the present disclosure can be practically applied to clinical detection. Some primers and probes are shown in Table 19 below, and the test results are shown in Table 20. All primers and probes are synthesized by Invitech (Shanghai) Trading Co., Ltd. [Table 19] HOXA7 primers and probes name Serial number sequence effect H7-F2 SEQ ID NO: 1 TAAAGGCGTTTGCGATAAGAC HOXA7 gene upstream primer H7-R2 SEQ ID NO: 2 TAACCCGCCTAACGACTACG Downstream primer of HOXA7 gene H7-P2 SEQ ID NO: 3 FAM-AGGGCGCGTTGTATGGCGC-BQ1 HOXA7 gene detection probe H7-F3 SEQ ID NO: 37 GCGTTTGCGATAAGACGGAC HOXA7 gene upstream primer H7-R3 SEQ ID NO: 38 CCAACCTAACCCGCCTAACG Downstream primer of HOXA7 gene H7-P3 SEQ ID NO: 39 FAM-CGTTGTATGGCGCGGTTGAGG-BQ1 HOXA7 gene detection probe H7-F4 SEQ ID NO: 40 CGTTCGGTTACGGTTTGGGC HOXA7 gene upstream primer H7-R4 SEQ ID NO: 41 GCCCTCGTCCGTCTTATCGC Downstream primer of HOXA7 gene H7-P4 SEQ ID NO: 42 FAM-TCGACGTTTACGGTAATTTGTTTTGCG-BQ1 HOXA7 gene detection probe H7-F5 SEQ ID NO: 43 ATTTCGTTAAAGGCGTTTGC HOXA7 gene upstream primer H7-R5 SEQ ID NO: 44 TCCGCCAACCTAACCCG Downstream primer of HOXA7 gene H7-P5 SEQ ID NO: 45 FAM-CGGACGAGGGCGCGTTGTAT-BQ1 HOXA7 gene detection probe H7-F6 SEQ ID NO: 46 CGTTAAAGGCGTTTGCGATAAGAC HOXA7 gene upstream primer H7-R6 SEQ ID NO: 47 TACGCTCCCCGCTCCCGAT Downstream primer of HOXA7 gene H7-P6 SEQ ID NO: 48 FAM-GACGGACGAGGGCGCGTTGTATG-BQ1 HOXA7 gene detection probe H7-F7 SEQ ID NO: 49 CAACGCTACGCTCCCCGCT Downstream primer of HOXA7 gene H7-R7 SEQ ID NO: 50 GCGATAAGACGGACGAGGGC HOXA7 gene upstream primer H7-P7 SEQ ID NO: 51 FAM-CCGATCCCGCTCCGCCAACC-BQ1 HOXA7 gene detection probe H7-F8 SEQ ID NO: 52 CGTTAGGCGGGTTAGGTTGGC HOXA7 gene upstream primer H7-R8 SEQ ID NO: 53 GCCGAAAATCACGAAACTACCG Downstream primer of HOXA7 gene H7-P8 SEQ ID NO: 54 FAM-AGCGGGATCGGGAGCGGG-BQ1 HOXA7 gene detection probe H7-F9 SEQ ID NO: 55 TCGGGTCGTTTGGCGTTC HOXA7 gene upstream primer H7-R9 SEQ ID NO: 56 AACCTAACGCGTCCCGCG Downstream primer of HOXA7 gene H7-P9 SEQ ID NO: 57 FAM-TTGGTCGTTAGTTGGGCGTTTTCGC-BQ1 HOXA7 gene detection probe H7-F10 SEQ ID NO: 58 GGCGTTCGTAGATTTTAGTGC HOXA7 gene upstream primer H7-R10 SEQ ID NO: 59 CAAATAATCTCGCTCCGCA Downstream primer of HOXA7 gene H7-P10 SEQ ID NO: 60 FAM-GGTCGTTAGTTGGGCGTTTTCG-BQ1 HOXA7 gene detection probe H7-F11 SEQ ID NO: 61 GCGTTAGGTTCGTCGGGC HOXA7 gene upstream primer H7-R11 SEQ ID NO: 62 AAACTCGCCGCAACACGTAA Downstream primer of HOXA7 gene H7-P11 SEQ ID NO: 63 FAM-CGGATTTTTTGGTCGTATATTTGAGT-BQ1 HOXA7 gene detection probe [Continued Table 19] HOXA9 primers and probes name Serial number sequence effect H9-F2 SEQ ID NO: 1 TTAGTTTTTTCGGTAGGCGGC HOXA9 gene upstream primer H9-R2 SEQ ID NO: 2 AAACGCCAAACACCGTCG Downstream primer of HOXA9 gene H9-P2 SEQ ID NO: 3 FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1 HOXA9 gene detection probe H9-F3 SEQ ID NO: 64 AATTTT CG TGGGT CG GGT C HOXA9 gene upstream primer H9-R3 SEQ ID NO: 65 CCAAACACCGTCGCCTTAA Downstream primer of HOXA9 gene H9-P3 SEQ ID NO: 66 FAM-ACGTGGATTCGTTTTTGTTGGGC-BQ1 HOXA9 gene detection probe H9-F4 SEQ ID NO: 67 CGTCGCGGATGAGTTGAGC HOXA9 gene upstream primer H9-R4 SEQ ID NO: 68 CACGAACGCCTAAAAATACACG Downstream primer of HOXA9 gene H9-P4 SEQ ID NO: 69 FAM-TGGTCGTTATGCGTCGGGGATT-BQ1 HOXA9 gene detection probe H9-F5 SEQ ID NO: 70 AGCGTTGGTCGTTATGCGTC HOXA9 gene upstream primer H9-R5 SEQ ID NO: 71 CCAAACACCGTCGCCTTAAAC Downstream primer of HOXA9 gene H9-P5 SEQ ID NO: 72 FAM-GACGTTGGTCGAGTATTTCGATTTTAG-BQ1 HOXA9 gene detection probe H9-F6 SEQ ID NO: 73 CGACGTTGGTCGAGTATTTC HOXA9 gene upstream primer H9-R6 SEQ ID NO: 74 GCCACGAACGCCTAAAAAT Downstream primer of HOXA9 gene H9-P6 SEQ ID NO: 75 FAM-TTAGTTTAAGGCGACGGTGTTTGG-BQ1 HOXA9 gene detection probe H9-F7 SEQ ID NO: 76 CGTTTTGGTGGCGGTTGGTC HOXA9 gene upstream primer H9-R7 SEQ ID NO: 77 AATAATCCCTACGATCCCCGA Downstream primer of HOXA9 gene H9-P7 SEQ ID NO: 78 FAM-GGGCGTTTTTCGTTTTAGGCGG-BQ1 HOXA9 gene detection probe H9-F8 SEQ ID NO: 79 TCGTTTGGGACGGATTTTGC HOXA9 gene upstream primer H9-R8 SEQ ID NO: 80 ACAAATTCGTTTACCTCGCCG Downstream primer of HOXA9 gene H9-P8 SEQ ID NO: 81 FAM-ATTCGTTTTTTTCGGGGATCGTAGG-BQ1 HOXA9 gene detection probe H9-F9 SEQ ID NO: 82 AATAG CG TG CG GAGTGATTTA C HOXA9 gene upstream primer H9-R9 SEQ ID NO: 83 CGACCCGACCCACGAAAAT Downstream primer of HOXA9 gene H9-P9 SEQ ID NO: 84 FAM-CGTTATTGTTTTGTTGGACGGGTACG-BQ1 HOXA9 gene detection probe H9-F10 SEQ ID NO: 85 TTTAGGCGTTCGTGGCGGC HOXA9 gene upstream primer H9-R10 SEQ ID NO: 86 CCCTTCTAACCGACAACGATTC Downstream primer of HOXA9 gene H9-P10 SEQ ID NO: 87 FAM-CGGACGGTAGGTATATGCGTTTTTGG-BQ1 HOXA9 gene detection probe H9-F11 SEQ ID NO: 88 AATTCGTCGTCGTTTTTACGTC HOXA9 gene upstream primer H9-R11 SEQ ID NO: 89 TCCCGTAACCCTACGAACCG Downstream primer of HOXA9 gene H9-P11 SEQ ID NO: 90 FAM-TCGGATTTGTTGGTTCGTTAGGTTTTTTTC-BQ1 HOXA9 gene detection probe H9-F12 SEQ ID NO: 91 TTAGATTGTTCGTGAGCGGC HOXA9 gene upstream primer H9-R12 SEQ ID NO: 92 TTATAACCCGAATCGCCCG Downstream primer of HOXA9 gene H9-P12 SEQ ID NO: 93 FAM-TTGGGACGTTGGGGGAGACGGT-BQ1 HOXA9 gene detection probe [Table 20] Test results of HOXA7 in tissues Group Primer probe combination Specificity Sensitivity Group 1 H7-F2, H7-R2, H7-P2 100% 80% Group 2 H7-F3, H7-R3, H7-P3 100% 76% Group 3 H7-F4, H7-R4, H7-P4 100% 56% Group 4 H7-F5, H7-R5, H7-P5 100% 72% Group 5 H7-F6, H7-R6, H7-P6 100% 80% Group 6 H7-F7, H7-R7, H7-P7 100% 72% Group 7 H7-F8, H7-R8, H7-P8 100% 56% Group 8 H7-F9, H7-R9, H7-P9 100% 48% Group 9 H7-F10, H7-R10, H7-P10 100% 16% Group 10 H7-F11, H7-R11, H7-P11 100% twenty four% [Continued Table 20] Test results of HOXA9 in tissues Group Primer probe combination Specificity Sensitivity Group 1 H9-F2, H9-R2, H9-P2 100% 76% Group 2 H9-F3, H9-R3, H9-P3 100% 76% Group 3 H9-F4, H9-R4, H9-P4 100% 40% Group 4 H9-F5, H9-R5, H9-P5 100% 60% Group 5 H9-F6, H9-R6, H9-P6 100% 68% Group 6 H9-F7, H9-R7, H9-P7 100% 32% Group 7 H9-F8, H9-R8, H9-P8 100% 20% Group 8 H9-F9, H9-R9, H9-P9 100% 12% Group 9 H9-F10, H9-R10, H9-P10 100% 16% Group 10 H9-F11, H9-R11, H9-P11 100% twenty four% Group 11 H9-F12, H9-R12, H9-P12 100% twenty four%

In this disclosure, the primers and probes in Table 19 are used to verify the tissue samples. The above 10 sets of primer probe combinations were tested in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, and 25 cancer samples, including 4 squamous cell carcinomas and 21 adenocarcinomas. The test results are shown in Table 20 above.

The results showed that HOXA7 group 1, group 2, group 4, group 5, and group 6 all had a good detection rate. HOXA9 group 1, group 2, group 4, group 5 all have a good detection rate.

In order to further verify its detection rate in sputum, we selected 22 sputum samples and used the primers and probes in Table 19 for verification, including 7 normal controls, 15 lung cancer controls, and 15 lung cancers. There were 7 cases of squamous cell carcinoma, 7 cases of adenocarcinoma and 1 case of large cell carcinoma. The test results are shown in Table 21 below. [Table 21] Test results of HOXA7 in sputum Group Primer probe combination Specificity Sensitivity Group 1 H7-F2, H7-R2, H7-P2 100% 73.3% Group 2 H7-F3, H7-R3, H7-P3 100% 53.3% Group 4 H7-F5, H7-R5, H7-P5 100% 60.0% Group 5 H7-F6, H7-R6, H7-P6 100% 53.3% Group 6 H7-F7, H7-R7, H7-P7 100% 46.7% [Continued Table 21] Test results of HOXA9 in sputum Group Primer probe combination Specificity Sensitivity Group 1 H9-F2, H9-R2, H9-P2 100% 66.7% Group 2 H9-F3, H9-R3, H9-P3 100% 44.6% Group 4 H9-F5, H9-R5, H9-P5 100% 33.3% Group 5 H9-F6, H9-R6, H9-P6 100% 40.0%

The test results of 22 sputum samples showed that the detection rate of HOXA7 group 1: H7-F2, H7-R2, H7-P2 was the highest, reaching 73.3%. Although the sensitivity of group 1 and group 5 can reach 80% in tissue samples, the sensitivity of group 5 has dropped to 53.3% for sputum testing samples.

HOXA9 group 1: H9-F2, H9-R2, H9-P2 had the highest detection rate, reaching 66.7%. Although the sensitivity of group 1 and group 2 can reach 76% in tissue samples, the sensitivity of group 2 has dropped to 44.6% for sputum testing samples.

The final preferred primers are shown in Table 22 below. [Table 22] Optimized primers and probes name Serial number sequence effect H7-F2 SEQ ID NO: 1 TAAAGGCGTTTGCGATAAGAC HOXA7 gene upstream primer H7-R2 SEQ ID NO: 2 TAACCCGCCTAACGACTACG Downstream primer of HOXA7 gene H7-P2 SEQ ID NO: 3 FAM-AGGGCGCGTTGTATGGCGC-BQ1 HOXA7 gene detection probe H9-F2 SEQ ID NO: 4 TTAGTTTTTTCGGTAGGCGGC HOXA9 gene upstream primer H9-R2 SEQ ID NO: 5 AAACGCCAAACACCGTCG Downstream primer of HOXA9 gene H9-P2 SEQ ID NO: 6 FAM-ACGTTGGTCGAGTATTTCGATTTTAGTTC-BQ1 HOXA9 gene detection probe A3-TqMF SEQ ID NO: 19 TTTTGGATTGTGAATTTGTG β-actin gene upstream primer A3-TqMR SEQ ID NO: 20 AAAACCTACTCCTCCCTTAAA Downstream primer of β-actin gene A3-TqP SEQ ID NO: 21 FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 β-actin gene detection probe

no.

[Figure 1] ROC curves detected by HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and the combination of HOXA7 and HOXA9 in all tissue samples; [Figure 2] ROC curves of HOXA7, HOXA9, SHOX2, PCDHGA12, HOXD8, GATA3, and the combination of HOXA7 and HOXA9 detected in all sputum specimens; [Figure 3] The ROC curves of HOXA7, HOXA9, SHOX2_n3, and HOXA7 and HOXA9 in all sputum specimens; [Figure 4] Amplification curves of HOXA7, HOXA9 and SHOX2_n3 in sputum samples (A is the amplification image of HOXA7, B is the amplification image of HOXA9, and C is the amplification image of SHOX2_n3); [Figure 5] ROC curves of HOXA7, HOXA9, SHOX2_n3, and the combination of HOXA7 and HOXA9 in all lavage fluid samples; [Figure 6] Amplification curves of HOXA7, HOXA9 and SHOX2_n3 in lavage samples (A is the amplification image of HOXA7, B is the amplification image of HOXA9, and C is the amplification image of SHOX2_n3).

Claims (13)

Use of HOXA7 gene or its nucleic acid fragment, and HOXA9 gene or its nucleic acid fragment in preparing lung cancer diagnostic reagents or kits. Use of detection reagents for HOXA7 gene and HOXA9 gene methylation in preparing lung cancer diagnostic reagents. The use according to claim 2, wherein the HOXA7 and HOXA9 gene methylation detection reagent detects the sequence of the HOXA7 gene and the HOXA9 gene modified by a transformation reagent; Preferably, the conversion reagent is selected from one or more of hydrazine salt, bisulfite and bisulfite; Preferably, the conversion reagent is selected from bisulfite. The use according to claim 2, wherein the detection region of the methylation detection reagent comprises the gene body or promoter region of HOXA7 gene and HOXA9 gene; Preferably, the detection region of the reagent for HOXA7 comprises the sequence shown in SEQ ID NO: 25 or SEQ ID NO: 27; the detection region of the reagent for HOXA9 comprises SEQ ID NO: 29, SEQ ID NO: 31 or SEQ ID NO : The sequence shown in 33; More preferably, the detection region of the reagent for HOXA7 contains the sequence shown in SEQ ID NO: 27, and the detection region of the reagent for HOXA9 contains the sequence shown in SEQ ID NO: 29. The use according to claim 2, wherein the methylation detection reagent comprises a primer pair for detecting HOXA7 gene and HOXA9 gene; Preferably, the primer pair for detecting HOXA7 gene comprises SEQ ID NO: 1-2, SEQ ID NO: 37-38, SEQ ID NO: 40-41, SEQ ID NO: 43-44, or SEQ ID NO: 46-47 , SEQ ID NO: 49-50, SEQ ID NO: 52-53, SEQ ID NO: 55-56, SEQ ID NO: 58-59 or SEQ ID NO: 61-62; More preferably, the primer pair for detecting HOXA7 gene comprises the primer pair shown in SEQ ID NO: 1-2; Preferably, the primer pair for detecting HOXA9 gene comprises SEQ ID NO: 4-5, SEQ ID NO: 64-65, SEQ ID NO: 67-68, SEQ ID NO: 70-71, SEQ ID NO: 73-74, SEQ ID NO: 76-77, SEQ ID NO: 79-80, SEQ ID NO: 82-83, SEQ ID NO: 85-86, SEQ ID NO: 88-89 or SEQ ID NO: 91-92 Primer pair More preferably, the primer pair for detecting HOXA9 gene comprises the primer pair shown in SEQ ID NO: 4-5. The use according to claim 2, wherein the methylation detection reagent comprises a probe for detecting HOXA7 gene and HOXA9 gene; Preferably, the probe for detecting the HOXA7 gene comprises SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 51, SEQ ID NO: 54. The sequence shown in SEQ ID NO: 57, SEQ ID NO: 60 or SEQ ID NO: 63; More preferably, the probe for detecting HOXA7 gene comprises the sequence shown in SEQ ID NO: 3; Preferably, the probe for detecting the HOXA9 gene comprises SEQ ID NO: 6, SEQ ID NO: 66, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 84, SEQ ID NO: 87, SEQ ID NO: 90 or SEQ ID NO: 93; More preferably, the probe for detecting the HOXA9 gene comprises the sequence shown in SEQ ID NO: 6. The use according to claim 2, wherein the methylation detection reagent further comprises a reference gene detection reagent; Preferably, the reference gene contains β-actin or COL2A1; Preferably, the reference gene detection reagent contains a primer and a probe containing the reference gene; More preferably, the detection reagent for the reference gene β-actin includes the primer pair shown in SEQ ID NO: 19 and SEQ ID NO: 20, and the probe shown in SEQ ID NO: 21; Preferably, the detection reagent for the reference gene COL2A1 includes the primer pair shown in SEQ ID NO: 94 and SEQ ID NO: 95, and the probe shown in SEQ ID NO: 96. The use according to claim 2, wherein the methylation detection reagent further comprises bisulfite, bisulfite or hydrazine salt. The use according to claim 2, wherein the methylation detection reagent further comprises one or more of DNA polymerase, dNTPs, Mg²⁺ ion and buffer; Preferably, it contains DNA polymerase, dNTPs, Mg²⁺ ion and buffer. The use according to claim 2, wherein a test sample of the methylation detection reagent includes sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, saliva, and prostate fluid , Tears or feces; Preferably, the test sample contains sputum, lung tissue or lung lavage fluid; More preferably, the test sample contains sputum. A method for detecting DNA methylation of HOXA7 gene and HOXA9 gene, including the following steps: (1) Treat the test sample with bisulfite or bisulfite or hydrazine salt to obtain a modified test sample; (2) Use any of the methylation detection reagents described in claim 2-10 to detect the methylation status of HOXA7 gene and HOXA9 gene on the modified test sample in step (1); Preferably, in step (2), methylation-specific polymerase chain reaction or real-time fluorescence quantitative methylation-specific polymerase chain reaction is used for detection. A lung cancer diagnosis system, including: i. A DNA methylation detection component of HOXA7 gene and HOXA9 gene, and, ii. A result judgment component; Preferably, the DNA methylation detection component of the HOXA7 gene and the HOXA9 gene comprises a methylation detection reagent according to any one of Claims 2-10; Preferably, the methylation detection component includes one or more of a fluorescent quantitative PCR machine, a PCR machine, and a sequencer; Preferably, the result judgment component includes a data processing machine; Preferably, the result judgment component is used to output a diagnosis result according to the DNA methylation levels of the HOXA7 gene and the HOXA9 gene detected by the detection component; More preferably, the diagnosis result is obtained by comparing the methylation level of the test sample and the normal sample by the result judgment component, and is based on the deviation of the methylation level of the test sample and the normal sample. A method for diagnosing lung cancer includes the following steps: a) Detect the methylation level of HOXA7 gene and HOXA9 gene in the sample to be tested from the subject; b) Compare the HOXA7 gene and HOXA9 gene levels of the sample to be tested and the normal sample c) Diagnose lung cancer based on the deviation of the methylation level of the sample to be tested and the normal sample; Preferably, the sample to be tested contains sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, saliva, prostate fluid, tears or feces; Preferably, the sample to be tested contains sputum, lung tissue or lung lavage fluid; More preferably, the sample to be tested contains sputum or lung lavage fluid.

Images