TWI774992B - Application of HOXA7 methylation detection reagent in preparation of lung cancer diagnostic reagent - Google Patents

Abstract

The present disclosure relates to the use of a detection reagent taking the methylation of HOXA7 as a detection object in the preparation of a diagnostic reagent for lung cancer. In the present disclosure, HOXA7 is used as a marker for detecting lung cancer, and its sensitivity in sputum is as high as 88.6%, specificity is as high as 95%, and the sensitivity in lavage fluid is as high as 76.2%, specificity is as high as 95%, and the detection sensitivity is high. Compared with the existing lung cancer markers, especially for adenocarcinoma, the sensitivity has been greatly improved, and it has great application value for the detection of lung adenocarcinoma.

Description

Application of HOXA7 methylation detection reagent in preparation of lung cancer diagnostic reagent

The present disclosure belongs to the field of gene diagnosis, and more particularly, the present disclosure relates to the use of a human HOXA7 gene methylation detection reagent in the preparation of a lung cancer detection reagent, and a method for human HOXA7 gene methylation detection.

Lung cancer is a malignant tumor of the lung originating from the bronchial mucosa, glands or alveolar epithelium. According to the pathological type, it can be divided into: 1. Small cell lung cancer (SCLC): a special pathological type of lung cancer with obvious tendency of distant metastasis and poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy. 2. Non-small cell lung cancer (NSCLC): other pathological types of lung cancer other than small cell lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are some differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1. Central lung cancer: lung cancer that grows at or above the bronchial opening of the lung segment. 2. Peripheral lung cancer: Lung cancer that grows beyond the bronchial opening in the segment of the lung.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can fully achieve early detection and early diagnosis:

1. Blood biochemical examination: There is currently no specific blood biochemical examination for primary lung cancer. Lung cancer patients with elevated blood alkaline phosphatase or serum calcium should consider the possibility of bone metastasis, and elevated blood alkaline phosphatase, aspartate transaminase, lactate dehydrogenase or bilirubin should consider the possibility of liver metastasis.

2. Tumor marker examination: (1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but they are mainly seen in patients with advanced lung cancer. At present, the detection of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. (2) NSE: It is the first choice marker for small cell lung cancer. It is used for the diagnosis of small cell lung cancer and monitoring the treatment response. The reference value is different depending on the detection method and the reagent used. (3) CYFRA21-1: It is the first choice marker for non-small cell lung cancer, and its sensitivity for the diagnosis of lung squamous cell carcinoma can reach 60%. The reference value is different depending on the detection method and reagent used.

3. Imaging examination: (1) Chest X-ray examination: should include frontal and lateral chest X-rays. In primary hospitals, frontal and lateral chest radiographs are still the most basic and preferred imaging diagnostic method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT scan is performed. (2) CT examination: chest CT is the most common and important examination method for lung cancer, and is used for the diagnosis, differential diagnosis, staging and follow-up after treatment of lung cancer. Hospitals where conditions permit should include the adrenal glands when performing chest CT scans in lung cancer patients. Contrast-enhanced scans should be used whenever possible, especially in patients with central pulmonary disease. CT is the basic examination method for showing brain metastases. Patients with clinical symptoms or advanced stage should undergo brain CT scan, and use enhanced scan as much as possible. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Conditional hospitals can use it for the diagnosis of pulmonary lesions that are difficult to characterize, as well as for patients whose clinical diagnosis of lung cancer needs to be confirmed by cytology and histology, but other methods are difficult to obtain. case. (3) Ultrasound examination: It is mainly used to find out whether the vital organs of the abdomen and the abdominal cavity and retroperitoneal lymph nodes have metastasized, and it is also used for the examination of cervical lymph nodes. For intrapulmonary lesions or chest wall lesions adjacent to the chest wall, cystic and solid lesions can be identified and ultrasound-guided needle biopsy can be performed; ultrasound is also commonly used for pleural effusion extraction and localization. (4) Bone scan: It has a high sensitivity in detecting bone metastases from lung cancer, but has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

4. Other examinations: (1) Sputum cytology examination: At present, a simple and convenient non-invasive method for the diagnosis of lung cancer, continuous smear examination can increase the positive rate by about 60%, and is a routine diagnosis method for suspected lung cancer cases. (2) Fiberoptic bronchoscopy: one of the most important means in the diagnosis of lung cancer, plays an important role in the qualitative localization diagnosis of lung cancer and the selection of surgical plans. It is a necessary routine inspection item for patients who are going to undergo surgical treatment. While transbronchial needle biopsy (TBNA) is beneficial for pre-treatment staging, it is technically difficult and risky, and those who need it should be transferred to a higher-level hospital for further examination. (3) Others: such as percutaneous lung biopsy, thoracoscopy biopsy, mediastinoscopy biopsy, pleural effusion cytology, etc., if there are indications, they can be used according to the existing conditions to assist the diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools to detect early-stage lung cancer and reduce mortality. 20% of lung cancer mortality. It has been proved in clinical practice that the success or failure of any lung cancer screening program depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized as one of the methods for identifying high-risk groups of lung cancer. Risk models further improve outcomes for patients with lung cancer by assisting clinicians in improving interventions or treatments. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still an intractable problem. In order to maximize the benefit-harm ratio of lung cancer screening, the key question is how to define the high-risk population; the second is how to screen this population, including the definition of high-risk factors, the overall risk Quantitative summarization of and selection of screening benefit cut-offs.

The existing lung cancer detection technologies mainly have low sensitivity, high false positives, and invasiveness, and the current conventional detection technologies are difficult to detect early lung cancer.

Non-invasive detection of lung cancer, such as sputum detection, is even more difficult. Although researchers have also studied tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is low compared to the detection and evaluation of tumor markers in blood samples from other tumor patients. This is mainly due to the following reasons: ① The composition of sputum is relatively complex, and the composition and viscosity of sputum vary greatly among different groups of people under different diseases or environments; ② There are many tracheal epithelial cells and bacteria in sputum, and oral cavity For the components of non-lung cancer cells such as mucosal cells, the general sample processing method cannot effectively enrich the DNA of sufficient lung cancer origin; ③ There are many smoking patients who do not show sputum. A J Hubers et al in "Molecular sputum analysis for the diagnosis of lung cancer" studied the past 10 literatures and showed that the median methylation degree of markers in lung cancer tissue was 48%, while the median methylation degree of sputum was 48%. The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that in sputum. Meanwhile, Rosalia Cirincione (Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, and 51.7%, respectively. %, and only 44.4%, 5%, and 5% in sputum.

At present, the missed detection rate of lung cancer is relatively high. In particular, for the type of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate in the smaller bronchi, which are peripheral lung cancers, and exfoliated cells deep in the lung are more difficult to expectorate through sputum. Therefore, the current sputum detection methods for adenocarcinoma are almost zero.

Reducing the missed detection rate is especially important in early cancer screening. If an early tumor screening product cannot screen out all or most of the patients, those missed will not be able to get enough risk indications, thus delaying the timing of treatment, which is a huge problem for patients. loss.

Although some lung cancer-related tumor markers have been found in the prior art, the sensitivity and specificity of these tumor markers cannot meet the requirements due to the limitation of detection reagents or detection methods for these tumor markers. Further research is needed on screening methods that can be practically applied to lung cancer. Although non-invasive screening has unique advantages in sampling, it also has other limitations. For example, adenocarcinoma in lung cancer, because the exfoliated cells in the deep part of the lung are difficult to expectorate through sputum, usually In other words, those skilled in the art would consider this type of lung cancer inappropriate for non-invasive screening. On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although relevant research has progressed for many years, there is still no non-invasive screening method for lung cancer that can be promoted to the clinic.

The purpose of the present disclosure is to provide the use of a methylation detection reagent for lung cancer tumor markers in the preparation of a lung cancer diagnostic reagent.

Another object of the present disclosure is to provide the use of a methylation detection reagent whose sensitivity in sputum and lavage fluid is no less than that of lung cancer tumor markers in tissue in the preparation of a lung cancer diagnostic reagent.

Another object of the present disclosure is to provide the use of a detection reagent for methylation of tumor markers with high sensitivity and specificity for adenocarcinoma in sputum and lavage fluid in the preparation of a diagnostic reagent for lung cancer.

Another object of the present disclosure is to provide a method for detecting HOXA7 gene methylation.

The above-mentioned purpose of the present disclosure is achieved by the following technical means:

After in-depth research, the inventor revealed a method for detecting the methylation of a gene to improve the detection rate of lung cancer, and the gene is the human HOXA7 gene. The inventors not only verified that the detection of HOXA7 methylation has high specificity and sensitivity in the detection of lung cancer in tissue samples, but also verified that it has the same high specificity and sensitivity in sputum samples and lavage samples. sex.

A first aspect of the present disclosure provides the use of a HOXA7 gene methylation detection reagent in the preparation of a lung cancer diagnostic reagent.

The HOXA7 gene is a member of the HOX (homebox) gene family and belongs to the HOXA cluster gene on chromosome 7p15-p14. Like other HOX genes, it contains a 180bp DNA fragment, which is composed of 60 amino acids. homology domain. HOXA7 plays a regulatory role in the proliferation and differentiation of normal hematopoietic cells. At present, many studies show that the abnormal expression of HOXA7 plays an important role in the occurrence and development of leukemia. Some reports also show that the methylation of HOXA7 gene is related to lung cancer.

Wherein, the HOXA7 gene methylation detection reagent detects the sequence of the HOXA7 gene modified by the conversion reagent. Among them, the conversion reagent refers to a reagent that deaminates cytosine in DNA to uracil while leaving 5-MeC substantially unaffected. Exemplary conversion reagents include hydrazine salts, bisulfites (eg, sodium bisulfite, etc.), bisulfites (eg, sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) etc.), or one or more of the compounds that can produce hydrazine salts, bisulfites and bisulfites under appropriate reaction conditions. As an exemplary embodiment, the HOXA7 gene methylation detection reagent detects the bisulfite-modified sequence.

Methylation occurs when an additional methyl group is added to cytosine. After treatment with bisulfite or bisulfite or hydrazine salt, cytosine will become uracil, because uracil and thymus during PCR amplification Pyrimidine is similar to thymine and will be recognized as thymine. It is reflected in the PCR amplification sequence that the unmethylated cytosine becomes thymine (C becomes T), and the methylated cytosine (C) does not change. . The technology of PCR detection of methylated genes is usually methylation specific PCR (Methylmion Specific PCR, MSP). The presence of amplification means that methylation has occurred, and the absence of amplification means that there is no methylation.

As an optional embodiment, the detection region of the HOX7 gene targeted by the HOXA7 gene methylation detection reagent comprises a CG-enriched region or a non-CG-enriched region or a CTCF (CTCF-binding sites) region of the HOXA7 gene. As a preferred embodiment, the detection region of the reagent comprises the CG-enriched region or CTCF (CTCF-binding sites) region of the HOXA7 gene.

Alternatively, the detection region of the HOXA7 gene targeted by the HOXA7 gene methylation detection reagent comprises the gene body of the HOXA7 gene or its promoter region.

In some embodiments, the detection region targeted by the HOXA7 gene methylation detection reagent comprises the sequence shown in SEQ ID NO: 22 (region 1) or SEQ ID NO: 24 (region 2).

The inventors have found through experiments that the selection of the HOXA7 gene detection region will have an impact on the detection efficiency of tumors. According to the primers designed according to the CG-enriched region of the HOXA7 gene, the primers designed in different regions have obvious differences in the detection results. The tumor detection rate was 50% to 60% higher than in poor areas. The inventors have found through experimental comparison that the detection results of specific CG-enriched regions or CTCF (CTCF-binding sites) regions are significantly better than other regions.

The HOXA7 gene methylation detection reagent of the present disclosure includes amplification primers. As an optional embodiment, the primers comprise SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: : 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46 , SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, at least any one of SEQ ID NO: 53. As a preferred embodiment, the primers comprise a pair of primers shown in SEQ ID NO: 1 and SEQ ID NO: 2.

The HOXA7 gene methylation detection reagent of the present disclosure also includes a probe. As an optional embodiment, the probe comprises SEQ ID NO: 3, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID Any one of NO: 45, SEQ ID NO: 48, SEQ ID NO: 51, and SEQ ID NO: 54. As a preferred embodiment, the probe is selected from SEQ ID NO: 3. As a preferred mode of the present disclosure, for the convenience of clinical use, the labels of the detection probes include radioisotopes, fluorescent groups, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes.

In some embodiments, the label of the probe is a fluorescent group, and these fluorescent groups include but are not limited to VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; quenching groups include but are not limited to Not limited to TAMRA, BHQ, MGB, Dabcyl, etc., it is suitable for multi-channel PCR detection systems commonly used in clinical detection, and realizes multi-color fluorescence detection in one reaction tube.

As a preferred embodiment, the HOXA7 gene methylation detection reagent of the present disclosure comprises the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 and the probe shown in SEQ ID NO: 3.

As an optional embodiment, the HOXA7 gene methylation detection reagent of the present disclosure further comprises bisulfite, bisulfite or hydrazine salt for modifying methylated cytosine into thymine. Of course, it may not be included in the reagent of the present disclosure, and can be purchased independently when used.

As an optional embodiment, the HOXA7 gene methylation detection reagent of the present disclosure further comprises one or more of DNA polymerase, dNTPs, Mg²⁺ ions, and buffer; preferably, DNA polymerase, dNTPs, Mg² ⁺Ions and buffers for amplification reactions of the HOXA7 gene.

As an optional embodiment, the HOXA7 gene methylation detection reagent of the present disclosure also includes a reference gene detection reagent. Preferably, the reference gene comprises β-actin or COL2A1, in addition to these two reference genes, other reference genes for methylation detection in the prior art can also be used. Further, the detection reagent for the reference gene includes primers and probes for the reference gene. As a preferred embodiment, the detection reagent for the reference gene β-actin comprises the primer pair shown in SEQ ID NO: 16 and SEQ ID NO: 17, and the probe of SEQ ID NO: 18. The detection reagent for the reference gene COL2A1 comprises a primer pair shown in SEQ ID NO: 55 (TTTTGGATTTAAGGGGAAGATAAA), SEQ ID NO: 56 (TTTTTCCTTCTCT ACATCTTTCTACCT), and a probe shown in SEQ ID NO: 57 (AAGGGAAATTGAGAAATGAGAGAGAAGGGA) .

Another aspect of the present disclosure provides a method for detecting DNA methylation of the HOXA7 gene, comprising the following steps: (1) Treat the test sample with bisulfite or bisulfite or hydrazine salt to obtain a modified test sample; (2) Use the above-mentioned HOXA7 gene methylation detection reagent to detect the HOXA7 gene methylation status of the modified detection sample in step (1).

Alternatively, methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific PCR (qMSP) was used for detection. Other DNA methylation detection methods reported in the prior art can also be applied in the present disclosure. A prior art methylation detection method can be incorporated into the present disclosure through patent USSN 62/175,916.

Another aspect of the present disclosure also provides a system for diagnosing lung cancer, the system comprising: DNA methylation detection components of the HOXA7 gene, and, The result judges the component.

In some embodiments, the DNA methylation detection component of the HOXA7 gene comprises the above-mentioned HOXA7 gene methylation detection reagent.

In some embodiments, the methylation detection component comprises one or more of a fluorescence quantitative PCR instrument, a PCR instrument, and a sequencer.

In some embodiments, the result judgment component is used to output a diagnosis result such as the risk of lung cancer and/or the type of lung cancer according to the DNA methylation level of the HOXA7 gene detected by the detection component.

In some embodiments, the disease risk is obtained by comparing the methylation levels of the test sample and the normal sample through the result judgment component, based on the deviation of the methylation levels of the test sample and the normal sample.

In some embodiments, the result determination means comprises a data processing machine.

In some embodiments, the data processing machine includes any equipment or apparatus or apparatus that can perform data processing available to those skilled in the art.

In some embodiments, the data processing machine comprises one or more of a computer, a computer. The computer is loaded with any software or program capable of data processing or statistical analysis that can be used by those skilled in the art. In some embodiments, the computer comprises a computer with one or more of SPSS, SAS, Excel attached.

In some embodiments, the result judgment component further includes a result outputter. The exporter includes any device or apparatus or device that can display the results of data processing as readable content. In some embodiments, the results exporter comprises one or more of a screen, a paper report.

Another aspect of the present disclosure provides a method for diagnosing lung cancer, the method comprising the steps of: Detect the methylation level of HOXA7 gene in the sample to be tested from the subject; Compare the methylation level of HOXA7 gene in the sample to be tested and the normal sample; Lung cancer is diagnosed based on the deviation of the methylation level of the test sample and the normal sample.

In some embodiments, when the methylation level of the sputum sample to be tested is greater than 0.77%, it is determined that the sample to be tested is a lung cancer sample, and when the methylation level is less than or equal to 0.77%, it is determined that the sample to be tested is a non-lung cancer sample .

In some embodiments, when the methylation level of the lavage fluid sample to be tested is greater than 0.7%, the sample to be tested is determined to be a lung cancer sample, and when the methylation level of the sample to be tested is less than or equal to 0.7%, the sample to be tested is determined to be non-specific Lung cancer samples.

The diagnostic methods of the present disclosure can be used before or in combination with lung cancer treatment, such as to assess the success of treatment or to monitor post-treatment remission, recurrence and/or progression (including metastasis) of lung cancer.

Another aspect of the present disclosure provides a method for treating lung cancer, the method comprising administering surgery, chemotherapy, radiotherapy, chemoradiotherapy, immunotherapy, oncolytic virus therapy, or other fields in the art to a patient diagnosed with lung cancer by the above-mentioned diagnostic method Any other types of lung cancer treatments used and combinations of these treatments.

In some embodiments, the detection sample of the HOXA7 gene methylation detection reagent comprises sputum, pulmonary lavage fluid, lung tissue, pleural effusion, blood, serum, plasma, urine, prostatic fluid, tears or feces and many more. As a preferred embodiment, the detection sample of the HOXA7 gene methylation detection reagent comprises sputum, tissue or lung lavage fluid. As a more preferred embodiment, the detection sample of the HOXA7 gene methylation detection reagent comprises sputum or lung lavage fluid.

The present disclosure finds that the methylation level of HOXA7 gene in tissues is highly correlated with the incidence of lung cancer. Among the 185 tissues, the specificity of HOXA7 gene normal group compared with all lung cancer groups was as high as 95%, while the sensitivity was 63.3%. Although the sensitivity was lower than that of another tumor marker SHOX2 gene in the experiment of the present disclosure, the surprising finding was that , the methylation level of HOXA7 gene detected in sputum and pulmonary lavage fluid also maintained a very high correlation with the incidence of lung cancer. In sputum, the sensitivity was 88.6%, and the specificity was 95%; In pulmonary lavage fluid, the sensitivity is 76.2% and the specificity is 95%. In sputum and pulmonary lavage fluid, the sensitivity is even higher than that in tissue, which is very rare among molecular markers, and even is unique.

Among the various molecular markers studied, the detection sensitivity or specificity of sputum samples decreased significantly compared to tissue samples. For example, SHOX2, PCDHGA12, HOXD8, and GATA3 have been reported to be related to lung cancer genes. Among them, SHOX2 has a sensitivity of 80.6% in tissue detection, which is higher than that of HOXA7 gene, while it is less sensitive in sputum. to 62.9%, which was significantly lower than 88.6% of HOXA7 gene (Note: comparison between normal group and all cancer groups). In pulmonary lavage fluid, the sensitivity of SHOX2 gene decreased to 52.4%, which seriously affected the diagnosis of lung cancer, while the sensitivity of HOXA7 was 76.2%, which was higher than that in tissue.

The study found that a variety of lung cancer markers only showed good detection sensitivity and specificity in tissues; while in sputum and lung lavage samples, no matter how designed and optimized the detection area, detection primers, probes, etc. Sexuality is still greatly reduced, seriously affecting the diagnosis of lung cancer.

The sensitivity of HOXA7 gene in sputum and pulmonary lavage samples increased rather than decreased, and maintained a specificity of up to 95%, which makes this gene extremely useful as a gene in sputum and pulmonary lavage samples. Reliable lung cancer marker.

In some embodiments, the lung cancer is selected from small cell lung cancer (SCLC) and non-small cell lung cancer (non-small cell lung cancer, NSCLC); further, the non-small cell lung cancer is selected from squamous cell carcinoma Squamous cell carcinoma, adenocarcinoma, or large cell carcinoma. As a preferred embodiment, the lung cancer is selected from adenocarcinoma.

Experiments have confirmed that HOXA7 gene has high specificity and high sensitivity in many different types of lung cancer, even in lung adenocarcinoma, it also has higher sensitivity than other tumor markers. Currently, lung adenocarcinoma has a high rate of missed detection. On the one hand, because lung adenocarcinoma is more likely to occur in women and non-smokers, the incidence rate is lower than that of squamous cell carcinoma and anaplastic carcinoma, the age of onset is younger, and women are relatively more common; on the other hand, most adenocarcinomas originate from younger Bronchus is a peripheral lung cancer, and the exfoliated cells in the deep part of the lung are more difficult to cough up through sputum; on the other hand, lung adenocarcinoma generally has no obvious clinical symptoms in the early stage. Therefore, the detection of lung adenocarcinoma is more difficult and valuable.

Experiments found that in sputum, the detection sensitivity of HOXA7 for adenocarcinoma reached 88.9%, which is a breakthrough improvement compared to SHOX2 (33.3% sensitivity for adenocarcinoma). Compared with SHOX2 (adenocarcinoma sensitivity of 36.4%), the detection sensitivity has reached 72.7%, and it is not obvious that it is higher than the sensitivity in tissue. Therefore, for adenocarcinoma, the preferred detection sample is sputum. Even if the pulmonary lavage fluid is used as the detection sample, it has a relatively more prominent sensitivity than other markers, which is conducive to timely detection of patient abnormalities, and further combined with Other tests are used to diagnose adenocarcinoma. Therefore, HOXA7 has great application significance for the detection of adenocarcinoma.

The beneficial effects of one of the above technical solutions are: not only can the tissue be used as a detection sample, but also prominently, it has higher sensitivity in sputum and lung lavage fluid, and can be easily used in sputum and lung lavage fluid. The lavage fluid is used as a test sample for reliable diagnosis of lung cancer. Sputum samples are very easy to obtain without causing any pain and inconvenience to the patient. The sample volume used is very small, the sampling process is very convenient and has no impact on the patient. At the same time, the samples are easy to be mailed or taken to the hospital for examination.

The beneficial effect of one of the above technical solutions is that various types of lung cancer can be detected, and it also has higher sensitivity than other markers for difficult-to-detect adenocarcinoma.

The beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent does not need to consider the subject and age of the detection, and has a wide range of applications.

One of the above technical solutions has the beneficial effects of: detecting and diagnosing cancer through methylation levels, more and more studies have confirmed that methylation changes are early events in the process of tumorigenesis, and it is easier to detect methylation abnormalities. Early detection of lesions.

A "primer" or "probe" in the present disclosure refers to an oligonucleotide comprising a region complementary to a sequence of at least 6 contiguous nucleotides of a target nucleic acid molecule (eg, a target gene). In some embodiments, at least a portion of the primer or probe sequence is not complementary to the amplified sequence. In some embodiments, the primer or probe comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 associations with the target molecule. A region of sequence complementarity of consecutive or discontinuous block nucleotides. When a primer or probe comprises a region "complementary to at least x contiguous nucleotides of the target molecule", the primer or probe is at least 95% complementary to at least x contiguous nucleotides of the target molecule. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 87%, at least 88% 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99% or 100% complementary.

The application of lung cancer marker HOXA7 makes the early diagnosis of lung cancer possible. When a gene that is methylated in cancer cells is determined to be methylated in a clinically or morphologically normal-looking cell, this indicates that the normal-looking cell is progressing toward cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of the lung cancer-specific gene HOXA7 in normal-appearing cells.

Among them, early diagnosis refers to the possibility of finding cancer before metastasis, preferably before morphological changes in tissue or cells can be observed.

"Diagnosis" in the present disclosure, in addition to the early diagnosis of lung cancer, also includes the diagnosis of intermediate and advanced lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stage and selection of therapeutic targets.

As an alternative to the stage of the disorder, the progression of lung cancer at different stages or periods can be diagnosed by measuring the degree of methylation of HOXA7 obtained from a sample. By comparing the degree of HOXA7 gene methylation of nucleic acids isolated from samples of each stage of lung cancer with the HOXA7 gene methylation of one or more nucleic acids isolated from samples of lung tissue without cell proliferative abnormalities The degree of chemotherapy can detect the specific stage of lung cancer in the sample.

In the present disclosure, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of the cancer or tumor.

In the present disclosure, the "subject" is a mammal, such as a human.

Samples for methylation detection of the present disclosure include, but are not limited to, DNA, or RNA, or mRNA-containing DNA and RNA samples, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

Methods for methylation detection are well known, such as methylation-specific polymerase chain reaction, real-time fluorescence quantitative methylation-specific polymerase chain reaction, pyrosequencing, the use of methylated DNA-specific binding proteins PCR, quantitative PCR, and DNA chips, differential methylation detection-methylation-sensitive restriction enzymes, differential methylation detection-sulfite sequencing, etc., in addition, other The methylation detection method can be introduced by patent US62007687.

In the present disclosure, "methylation level" is the same as "methylation degree", which can usually be expressed as the percentage of methylated cytosines, which is the number of methylated cytosines divided by the number of methylated cytosines and the number of unmethylated cytosines. The sum of the number of methylated cytosines; and the method of dividing the number of methylation target genes by the number of reference genes is generally used to express the methylation level; and other methods of expressing the methylation level in the prior art.

The technical solutions of the present disclosure are further described below through specific embodiments, which do not represent limitations on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concepts of the present disclosure still fall within the protection scope of the present disclosure.

Example 1: Selection of detection target genes

Methylated DNA has obvious advantages as a detection target. Compared with protein markers, DNA can be amplified and easily detected. Compared with mutant markers, the methylated parts of DNA are located in specific genes. The site, generally in the promoter region, makes detection easier and more convenient. In order to complete the present disclosure, the inventors screened hundreds of genes, and selected better HOXA7, SHOX2, PCDHGA12, HOXD8, GATA3 as candidate detection genes, and β-actin gene as a reference gene to study the methylation of each gene. Site distribution, primer probes designed for detection were respectively used for real-time fluorescent quantitative methylation-specific PCR (qMSP) detection. The primer probes for each gene detection are as follows:

The detection primers and probes for HOXA7 are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 Primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

The detection primers and probes for SHOX2 are: SEQ ID NO: 4 SHOX2 Primer F: TTTAAAGGGTTCGTCGTTTAAGTC SEQ ID NO: 5 SHOX2 Primer R: AAACGATTACTTTCGCCCG SEQ ID NO: 6 SHOX2 probe: FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

The detection primers and probes for PCDHGA12 are: SEQ ID NO: 7 PCDHGA12 Primer F: TGGTTTTTACGGTTTTCGAC SEQ ID NO: 8 PCDHGA12 Primer R: AAATTCTCCGAAACGCTCG SEQ ID NO: 9 PCDHGA12 probe: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes for HOXD8 are: SEQ ID NO: 10 HOXD8 Primer F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 11 HOXD8 Primer R: CCTAAAACCGACGCGATCTA SEQ ID NO: 12 HOXD8 probe: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes for GATA3 are: SEQ ID NO: 13 GATA3 Primer F: TTTCGGTAGCGGGTATTGC SEQ ID NO: 14 GATA3 Primer R: AAAATAACGACGAACCAACCG SEQ ID NO: 15 GATA3 probe: FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 16 β-actin Primer F: TTTTGGATTGTGAATTTGTG SEQ ID NO: 17 β-actin Primer R: AAAACCTACTCCTCCCTTAAA SEQ ID NO: 18 β-actin probe: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

experiment procedure:

1. DNA extraction

Specimens from patients diagnosed with lung cancer and those from non-lung cancer patients were collected, including paraffin tissue specimens, sputum specimens, and lavage fluid specimens, respectively. After the sample was pretreated and the cells were separated, DNA extraction was performed according to the instructions of the HiPure FFPE DNA Kit (D3126-03) of the US Biotechnology Company.

2. DNA modification

Bisulfite modification was performed as described in the ZYMO RESEARCH Bio Kit EZ DNA Methylation™ KIT (D5002).

3. Amplification and detection [Table 1] Liquid dispensing system HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin reactive components Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Upstream Primer (100 µM) 0.125 0.05 0.125 0.05 0.125 0.125 Downstream Primer (100 µM) 0.125 0.125 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 0.05 0.05 Magnesium (25 mM) 5 5 5 5 3 5 dNTPs (10 mM) 1 1 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 0.5 0.5 5x buffer 5 5 5 5 5 5 Sterilized water 12.2 12.275 12.2 12.275 14.2 12.2 template DNA 1 1 1 1 1 1 total capacity 25 25 25 25 25 25

Amplification system: [Table 2] PCR reaction process HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin step temperature and time temperature and time temperature and time temperature and time temperature and time temperature and time Number of cycles predenaturation 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C for 30 seconds 55°C for 60 seconds 55°C for 60 seconds 55°C for 60 seconds 55°C for 60 seconds 54°C for 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 1

4. Test results

4.1. Detection results in paraffin tissue

Sample information: A total of 185 lung tissue samples, including 87 normal tissue samples, 98 cancer tissue samples, 15 squamous cell carcinomas, 81 adenocarcinomas, and 2 unclassified lung cancers among the 98 cancer group samples. and 73 pairs of paracancerous control samples.

The ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in all tissue samples are shown in Figure 1. The statistical results of the detection of each gene in the tissue are shown in Table 3. [Table 3] Detection results in tissues Analysis group index HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 Comparison of normal group and all cancer groups specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 63.3% 80.6% 69.4% 40.8% 67.3% Comparison of normal group and all squamous cell carcinoma groups specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 60% 93.3% 53.3% 60.0% 73.3% Comparison of normal group and all adenocarcinoma group specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 63.0% 79.0% 71.6% 38.3% 65.4%

It can be seen from the above results that, in the tissue samples, whether the lung cancer as a whole is compared or analyzed according to the subtype of lung cancer, SHOX2 has the best detection effect, followed by HOXA7, PCDHGA12 and GATA3. , HOXD8 has the worst detection effect, with a sensitivity of only 40.8%.

According to the above results, in order to study the detection of different genes in sputum, the inventors further screened the 5 markers HOXA7, SHOX2, PCDHGA12, HOXD8 and GATA3 in sputum, because sputum is used as a non-invasive detection sample , more important.

Example 2: Detection of HOXA7, SHOX2, PCDHGA12, HOXD8 and GATA3 genes in sputum

Sample information: A total of 90 sputum samples were tested, including 55 normal control samples, 35 cancer control samples, 12 squamous cell carcinomas, 6 small cell carcinomas, 9 adenocarcinomas, and 35 cancer samples. There were 2 cases of cell carcinoma and 6 cases of unclassified lung cancer.

Experimental procedure:

a. Collect sputum samples from patients diagnosed with lung cancer and patients with non-lung cancer. After thickening with DTT, centrifuge to separate cells, wash twice with PBS, and then use Magen DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. Bisulfite modification of DNA was performed using the DNA transformation kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH.

c. The liquid distribution system is as follows: [Table 4] Liquid distribution system HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin reactive components Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Addition amount (µl) Upstream Primer (100 µM) 0.125 0.05 0.125 0.05 0.125 0.125 Downstream Primer (100 µM) 0.125 0.125 0.125 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 0.05 0.05 0.05 Magnesium (25 mM) 5 5 5 5 3 5 dNTPs (10 mM) 1 1 1 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 0.5 0.5 0.5 5x buffer 5 5 5 5 5 5 Sterilized water 12.2 12.275 12.2 12.275 14.2 12.2 template DNA 1 1 1 1 1 1 total capacity 25 25 25 25 25 25

d. The amplification system is as follows: [Table 5] Amplification system PCR reaction process HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 β-actin step temperature and time temperature and time temperature and time temperature and time temperature and time temperature and time Number of cycles predenaturation 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 60°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 95°C for 20 seconds 45 60°C for 30 seconds 55°C for 60 seconds 55°C for 60 seconds 55°C for 60 seconds 55°C for 60 seconds 54°C for 60 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 40°C for 30 seconds 1

e. The test results are as follows: [Table 6] Test results in sputum Analysis group index HOXA7 SHOX2 PCDHGA12 HOXD8 GATA3 Comparison of normal group and all cancer groups specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 88.6% 51.4% 20.0% 42.9% 17.1% Comparison of normal group and all squamous cell carcinoma groups specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 100.0% 66.7% 25.0% 66.7% 25.0% Comparison of normal group and all adenocarcinoma group specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 88.9% 11.1% 33.3% 11.1% 0.0% Comparison between normal group and all small cell carcinoma groups specificity 95.0% 95.0% 95.0% 95.0% 95.0% Sensitivity 83.3% 83.3% 0.0% 50.0% 33.3%

f. The ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in sputum samples are shown in Figure 2, and the statistical results are shown in Table 6. It can be seen from the above results that in the sputum samples, these 5 genes were detected at the same time. In comparison, whether the lung cancer as a whole is compared or analyzed according to the subtype of lung cancer, the detection effect of HOXA7 is better than that of the other four genes. Especially in the detection of adenocarcinoma, the detection rate of HOXA7 is 88.9%, which is much higher than other genes. Adenocarcinoma is generally peripheral type. Due to the dendritic physiological structure of the bronchus, the exfoliated cells in the deep lung are more difficult to cough through sputum. However, most tumor markers will be ineffective or have reduced efficacy when sputum is used as the detection specimen. For example, in the present disclosure, SHOX2, which has the highest sensitivity to adenocarcinoma in tissue, has a significantly higher sensitivity in sputum. is reduced to 11.1%, so the detection of this part is more difficult and meaningful.

Example 3: Detection of HOXA7 and SHOX2 genes in sputum

A large number of literatures show that SHOX2 can be used as a marker for detecting lung cancer, and there are patents showing that [CN201510203539-method and kit for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication], SHOX2 in bronchoalveolar lavage fluid, lesion tissue , pleural effusion, sputum and other samples have a high detection rate. In order to verify the detection effect of HOXA7, the present disclosure simultaneously detects the detection efficiency of HOXA7 and SHOX2 gene. In this embodiment, the detection efficiency of SHOX2 gene adopts the primer and probe sequences disclosed in the patent CN201510203539, and the SHOX2 gene is used for the detection efficiency of SHOX2 gene. It is expressed as SHOX2_n3 to distinguish it from the SHOX2 gene detected by self-designed primers and probes in Examples 1 and 2 of the present disclosure.

The primer probes for each gene detection are as follows:

The detection primers and probes for HOXA7 are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 Primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

The detection primers and probes for SHOX2_n3 are: SEQ ID NO: 19 SHOX2_n3 Primer F: TTTGGATAGTTAGGTAATTTTCG SEQ ID NO: 20 SHOX2_n3 Primer R: CGTACACGCCTATACTCGTACG SEQ ID NO: 21 SHOX2_n3.2 probe: FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. The dosing system is as follows: [Table 7] Dosing system HOXA7 SHOX2_n3 β-actin reactive components Addition amount (µl) Addition amount (µl) Addition amount (µl) Upstream Primer (100 µM) 0.125 0.125 0.125 Downstream Primer (100 µM) 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 Magnesium (25 mM) 5 5 5 dNTPs (10 mM) 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 5x buffer 5 5 5 Sterilized water 12.2 12.2 12.2 template DNA 1 1 1 total capacity 25 25 25

b. The amplification system is as follows: [Table 8] Reaction procedure of HOXA9 and β-actin HOXA7 β-actin step temperature and time temperature and time Number of cycles predenaturation 95°C for 5 minutes 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 45 60°C for 30 seconds 54°C for 60 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 40°C for 30 seconds 1 [Table 9] SHOX2_n3 reaction program step temperature and time Number of cycles predenaturation 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 45 60°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 1

c. The test results are as follows:

The standard curve was used to calculate the methylated copy number of each gene in the sample, and the ratio = target gene copy number/ACTB copy number * 100 was used to judge the methylation degree of the two groups of samples. Finally, the threshold of HOXA7 was 0.77. The threshold value of SHOX2_n3 is 1.3, which is used as the criterion for judging the cancer group and the control group. If the converted ratio exceeds the set threshold, it can be judged as positive "+", and if it is equal to or less than the set threshold, it can be judged as negative "-". According to this standard, the test results of 90 sputum samples are as follows: [Table 10] Test results HOXA7 SHOX2_n3 HOXA7 SHOX2_n3 serial number sample type methylation rate methylation rate detection detection 1 Non-lung cancer control 0.0 0.2 − − 2 Non-lung cancer control 0.0 0.0 − − 3 Non-lung cancer control 0.0 0.0 − − 4 Non-lung cancer control 0.7 0.2 − − 5 Non-lung cancer control 0.0 0.1 − − 6 Non-lung cancer control 0.0 0.3 − − 7 Non-lung cancer control 0.6 0.2 − − 8 Non-lung cancer control 0.4 0.3 − − 9 Non-lung cancer control 0.3 0.0 − − 10 Non-lung cancer control 0.4 4.0 − + 11 Non-lung cancer control 0.6 0.4 − − 12 Non-lung cancer control 0.6 0.2 − − 13 Non-lung cancer control 0.0 0.0 − − 14 Non-lung cancer control 0.2 0.1 − − 15 Non-lung cancer control 0.0 0.0 − − 16 Non-lung cancer control 0.6 0.3 − − 17 Non-lung cancer control 0.0 0.0 − − 18 Non-lung cancer control 0.0 0.0 − − 19 Non-lung cancer control 0.0 0.0 − − 20 Non-lung cancer control 0.8 1.1 + − twenty one Non-lung cancer control 0.5 0.4 − − twenty two Non-lung cancer control 0.7 2.0 − + twenty three Non-lung cancer control 0.76 0.1 − − twenty four Non-lung cancer control 0.0 0.0 − − 25 Non-lung cancer control 0.1 0.5 − − 26 Non-lung cancer control 0.4 0.3 − − 27 Non-lung cancer control 0.2 0.0 − − 28 Non-lung cancer control 0.0 0.0 − − 29 Non-lung cancer control 0.0 0.0 − − 30 Non-lung cancer control 0.0 0.0 − − 31 Non-lung cancer control 0.0 0.4 − − 32 Non-lung cancer control 0.0 0.0 − − 33 Non-lung cancer control 0.0 0.5 − − 34 Non-lung cancer control 0.4 0.7 − − 35 Non-lung cancer control 0.7 0.3 − − 36 Non-lung cancer control 0.4 0.8 − − 37 Non-lung cancer control 0.0 0.1 − − 38 Non-lung cancer control 2.2 0.6 + − 39 Non-lung cancer control 0.3 0.3 − − 40 Non-lung cancer control 0.0 0.2 − − 41 Non-lung cancer control 0.6 1.7 − + 42 Non-lung cancer control 0.0 0.0 − − 43 Non-lung cancer control 0.0 0.6 − − 44 Non-lung cancer control 0.1 1.1 − − 45 Non-lung cancer control 0.2 0.2 − − 46 Non-lung cancer control 0.2 0.2 − − 47 Non-lung cancer control 0.0 0.2 − − 48 Non-lung cancer control 0.3 0.0 − − 49 Non-lung cancer control 0.6 0.4 − − 50 Non-lung cancer control 0.0 0.2 − − 51 Non-lung cancer control 0.2 0.4 − − 52 Non-lung cancer control 0.0 0.2 − − 53 Non-lung cancer control 0.5 0.6 − − 54 Non-lung cancer control 0.0 0.0 − − 55 Non-lung cancer control 3.1 0.7 + − 56 squamous cell carcinoma 2.1 3.5 + + 57 squamous cell carcinoma 14.6 22.7 + + 58 squamous cell carcinoma 14.7 8.3 + + 59 squamous cell carcinoma 29.2 23.6 + + 60 squamous cell carcinoma 2.1 9.5 + + 61 squamous cell carcinoma 3.2 1.2 + − 62 squamous cell carcinoma 12.1 7.1 + + 63 squamous cell carcinoma 8.3 96.8 + + 64 squamous cell carcinoma 1.4 0.9 + − 65 squamous cell carcinoma 25.9 23.0 + + 66 squamous cell carcinoma 4.1 94.2 + + 67 squamous cell carcinoma 1.3 0.0 + − 68 adenocarcinoma 4.6 2.9 + + 69 adenocarcinoma 0.9 0.2 + − 70 adenocarcinoma 2.6 0.0 + − 71 adenocarcinoma 2.5 1.6 + + 72 adenocarcinoma 0.9 0.0 + − 73 adenocarcinoma 0.0 0.4 − − 74 adenocarcinoma 4.4 2.7 + + 75 adenocarcinoma 6.0 0.1 + − 76 adenocarcinoma 3.3 0.0 + − 77 small cell carcinoma 10.0 17.3 + + 78 small cell carcinoma 21.7 16.8 + + 79 small cell carcinoma 6.5 20.4 + + 80 small cell carcinoma 10.1 16.5 + + 81 small cell carcinoma 37.3 40.1 + + 82 small cell carcinoma 0.2 0.8 − − 83 large cell carcinoma 4.4 7.7 + + 84 large cell carcinoma 1.0 0.1 + − 85 poorly differentiated carcinoma 0.3 0.5 − − 86 poorly differentiated carcinoma 0.2 11.6 − + 87 lung cancer 15.7 6.3 + + 88 lung cancer 46.9 88.7 + + 89 lung cancer 77.0 48.6 + + 90 lung cancer 2.3 1.1 + −

d. Analysis of results [Table 11] Statistical results Analysis group index HOXA7 SHOX2_n3 Comparison of normal group and all cancer groups specificity 95.0% 95.0% Sensitivity 88.6% 62.9% Comparison of normal group and all squamous cell carcinoma groups specificity 95.0% 95.0% Sensitivity 100% 75.0% Comparison of normal group and all adenocarcinoma group specificity 95.0% 95.0% Sensitivity 88.9% 33.3% Comparison between normal group and all small cell carcinoma groups specificity 95.0% 95.0% Sensitivity 83.3% 83.3%

e. The ROC curves of HOXA7 and SHOX2_n3 detected in sputum samples are shown in Figure 3, the amplification curves are shown in Figure 4, and the statistical results are shown in Table 11. It can be seen from the above results that the comparison and analysis of lung cancer as a whole is still based on lung cancer. The detection effect of HOXA7 gene is better than that of SHOX2 gene. It is not obvious that the detection sensitivity of HOXA7 in sputum is higher than that in tissue. Especially for adenocarcinoma detection, the detection rate of HOXA7 was 88.9%, which was much higher than 33.3% of SHOX2 gene. Adenocarcinomas are generally peripheral, and due to the dendritic physiology of the bronchi, exfoliated cells deep in the lung are more difficult to expectorate through sputum. The present disclosure finds a marker that can use sputum as a sample to detect adenocarcinoma, and can greatly increase the sensitivity to 88.9%. This breakthrough is of great significance to the detection of adenocarcinoma.

Example 4: Detection of HOXA7 and SHOX2 genes in lavage fluid

Sample information: A total of 79 samples of bronchoalveolar lavage fluid were tested, including 58 samples from the normal control group, 21 samples from the cancer group, 6 samples from the 21 samples from the cancer group, 6 samples from squamous cell carcinoma, 4 samples from small cell carcinoma, and 11 samples from adenocarcinoma. .

Experimental procedure:

a. Collect bronchoalveolar lavage fluid samples from patients diagnosed with lung cancer and patients with non-lung cancer, centrifuge to separate cells, and then use the DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) of Megbio to extract DNA.

b. Bisulfite modification of DNA was performed using the DNA transformation kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH.

c. The amplification detection system is as follows: [Table 12] Amplification system HOXA7 SHOX2_n3 β-actin reactive components Addition amount (µl) Addition amount (µl) Addition amount (µl) Upstream Primer (100 µM) 0.125 0.125 0.125 Downstream Primer (100 µM) 0.125 0.125 0.125 Probe (100 µM) 0.05 0.05 0.05 Magnesium (25 mM) 5 5 5 dNTPs (10 mM) 1 1 1 Taq polymerase (5 unit/µl) 0.5 0.5 0.5 5x buffer 5 5 5 Sterilized water 12.2 12.2 12.2 template DNA 1 1 1 total capacity 25 25 25

The detection system is as follows: [Table 13] Reaction procedure of HOXA7 and β-actin HOXA7 β-actin step temperature and time temperature and time Number of cycles predenaturation 95°C for 5 minutes 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 95°C for 20 seconds 10 63°C for 30 seconds 62°C for 30 seconds 70°C for 30 seconds 70°C for 30 seconds Amplification 2 95°C for 20 seconds 95°C for 20 seconds 45 60°C for 30 seconds 54°C for 60 seconds 72°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 40°C for 30 seconds 1 [Table 14] SHOX2_n3 reaction program step temperature and time Number of cycles predenaturation 95°C for 5 minutes 1 Amplification 1 95°C for 20 seconds 45 60°C for 30 seconds 72°C for 30 seconds cool down 40°C for 30 seconds 1

The test results are as follows:

The standard curve was used to calculate the methylation copy number of each gene in the sample, and the ratio = target gene copy number/ACTB copy number * 100 was used to judge the methylation degree of the two groups of samples. Finally, the threshold of HOXA7 was selected as 0.7. The threshold value of SHOX2_n3 is 0.6. As the standard for judging the cancer group and the control group, if the converted ratio exceeds the set threshold, it can be judged as positive “+”, and if it is equal to or less than the set threshold, it can be judged as negative “−”. According to this standard, the test results of 79 lavage fluid samples are as follows: [Table 15] Test results HOXA7 SHOX2_n3 HOXA7 SHOX2_n3 serial number Organization type methylation rate methylation rate detection detection 1 Non-lung cancer control 0.3 0.3 − − 2 Non-lung cancer control 0.6 0.7 − + 3 Non-lung cancer control 0.3 0.1 − − 4 Non-lung cancer control 0.3 0.6 − − 5 Non-lung cancer control 0.0 0.2 − − 6 Non-lung cancer control 0.3 0.1 − − 7 Non-lung cancer control 0.0 0.0 − − 8 Non-lung cancer control 0.2 0.0 − − 9 Non-lung cancer control 0.0 0.0 − − 10 Non-lung cancer control 0.0 0.0 − − 11 Non-lung cancer control 0.0 0.1 − − 12 Non-lung cancer control 0.3 0.1 − − 13 Non-lung cancer control 0.3 0.1 − − 14 Non-lung cancer control 0.0 0.1 − − 15 Non-lung cancer control 0.70 0.5 + − 16 Non-lung cancer control 0.2 0.1 − − 17 Non-lung cancer control 0.1 0.0 − − 18 Non-lung cancer control 0.2 0.2 − − 19 Non-lung cancer control 0.2 0.2 − − 20 Non-lung cancer control 0.0 0.3 − − twenty one Non-lung cancer control 0.0 0.0 − − twenty two Non-lung cancer control 0.0 0.2 − − twenty three Non-lung cancer control 0.0 0.1 − − twenty four Non-lung cancer control 0.3 0.1 − − 25 Non-lung cancer control 0.0 0.0 − − 26 Non-lung cancer control 0.6 0.2 − − 27 Non-lung cancer control 0.0 0.1 − − 28 Non-lung cancer control 0.3 0.3 − − 29 Non-lung cancer control 0.3 0.1 − − 30 Non-lung cancer control 0.67 0.5 + − 31 Non-lung cancer control 0.0 0.2 − − 32 Non-lung cancer control 0.0 0.4 − − 33 Non-lung cancer control 0.1 0.1 − − 34 Non-lung cancer control 0.3 0.5 − − 35 Non-lung cancer control 0.2 0.2 − − 36 Non-lung cancer control 0.4 0.8 − + 37 Non-lung cancer control 0.0 0.4 − − 38 Non-lung cancer control 0.2 0.1 − − 39 Non-lung cancer control 0.3 0.2 − − 40 Non-lung cancer control 0.5 0.3 − − 41 Non-lung cancer control 0.3 0.3 − − 42 Non-lung cancer control 0.2 0.1 − − 43 Non-lung cancer control 0.3 0.6 − + 44 Non-lung cancer control 0.3 0.1 − − 45 Non-lung cancer control 0.7 0.2 − − 46 Non-lung cancer control 0.2 0.1 − − 47 Non-lung cancer control 0.2 0.1 − − 48 Non-lung cancer control 0.2 0.2 − − 49 Non-lung cancer control 0.2 0.4 − − 50 Non-lung cancer control 0.0 0.0 − − 51 Non-lung cancer control 0.2 0.0 − − 52 Non-lung cancer control 0.4 0.5 − − 53 Non-lung cancer control 0.0 0.0 − − 54 Non-lung cancer control 0.4 0.1 − − 55 Non-lung cancer control 0.2 0.0 − − 56 Non-lung cancer control 0.0 0.0 − − 57 Non-lung cancer control 2.6 0.0 + − 58 Non-lung cancer control 0.0 0.0 − − 59 squamous cell carcinoma 0.2 0.3 − − 60 squamous cell carcinoma 42.2 321.9 + + 61 squamous cell carcinoma 21.9 56.7 + + 62 squamous cell carcinoma 11.3 0.0 + − 63 squamous cell carcinoma 14.5 7.6 + + 64 squamous cell carcinoma 1.6 0.6 + + 65 adenocarcinoma 0.7 0.6 + − 66 adenocarcinoma 1.2 0.0 + − 67 adenocarcinoma 0.8 0.4 + − 68 adenocarcinoma 34.8 33.5 + + 69 adenocarcinoma 2.8 2.3 + + 70 adenocarcinoma 0.3 0.0 − − 71 adenocarcinoma 0.3 0.3 − − 72 adenocarcinoma 1.9 1.4 + + 73 adenocarcinoma 0.0 8.6 − + 74 adenocarcinoma 4.2 0.3 + − 75 adenocarcinoma 0.9 0.2 + − 76 small cell carcinoma 0.6 0.3 − − 77 small cell carcinoma 24.2 97.7 + + 78 small cell carcinoma 0.8 7.6 + + 79 small cell carcinoma 1.7 2.4 + + [Table 16] Analysis results Analysis group index HOXA7 SHOX2_n3 Comparison of normal group and all cancer groups specificity 95.0% 95.0% Sensitivity 76.2% 52.4% Comparison of normal group and all squamous cell carcinoma groups specificity 95.0% 95.0% Sensitivity 83.3% 66.7% Comparison of normal group and all adenocarcinoma group specificity 95.0% 95.0% Sensitivity 72.7% 36.4% Comparison of normal group and all small cell carcinoma groups specificity 95.0% 95.0% Sensitivity 75.0% 75.0%

The ROC curves of HOXA7 and SHOX2_n3 detected in all lavage fluid samples are shown in Figure 5, the amplification curves are shown in Figure 6, and the statistical results are shown in Table 16. It can be seen from the above results that the simultaneous detection of HOXA7 and SHOX2, and the comparative analysis of lung cancer as a whole, the detection rate of HOXA7 is 76.2%, which is much higher than the 52.4% of SHOX2, and also higher than the sensitivity of HOXA7 in tissues . According to the subtype of lung cancer, the detection result of HOXA7 in squamous cell carcinoma group was 16.6% higher than that of SHOX2. Especially for the detection of adenocarcinoma, its sensitivity is as high as 72.7%, much higher than 36.4% of SHOX2, and still higher than the sensitivity of HOXA7 in tissues, which is very rare in the field of adenocarcinoma detection. Dou Y et al. (Plasma small ncRNA pair panels as novel biomarkers for early-stage lung adenocarcinoma screening) reported that in plasma samples, the diagnostic sensitivity of adenocarcinoma was 70.4% and the specificity was 72.7%, although the sensitivity of this disclosure was not significantly higher than , but the present disclosure can maintain a sensitivity of up to 95% for the detection of adenocarcinoma with higher accuracy. Because adenocarcinomas are generally peripheral, due to the dendritic structure of the bronchi, the bronchoalveolar lavage fluid is not easily accessible to the alveoli or cancer tissue in the deep lung. The present disclosure finds a marker that can use sputum as a sample to detect adenocarcinoma, and can greatly increase the sensitivity to 72.7% while maintaining high specificity. This breakthrough is of great significance to the detection of adenocarcinoma.

Combining the above four embodiments, it can be fully demonstrated that HOXA7 has a better detection effect in the detection and diagnosis of lung cancer, especially in the application of biological samples such as sputum and bronchoalveolar lavage fluid. It can be more easily applied to large-scale population screening and has superior socioeconomic value.

Example 5: Influence of HOXA7 detection region, primer and probe on detection effect

1. The influence of the detection area on the detection effect

Various research data show that the methylation status and distribution of the same gene are not uniform. Therefore, for the same gene, methylation primers and probe detection systems designed in different regions are selected to diagnose the same sample and the same tumor. The detection performance is not the same, and sometimes the selected area is not suitable, resulting in no diagnostic effect on the tumor at all. After repeated research and comparison of multiple detection areas, some exemplary detection areas are shown in Table 17 below. [Table 17] Sequence to be detected sequence name sequence SEQ ID NO: 22 HOXA7 Region 1 Reference Sequence SEQ ID NO: 23 HOXA7 region 1 sequence converted after bisulfite treatment SEQ ID NO: 24 HOXA7 Region 2 Reference Sequence CGTCCGGCTACGGCCTGGGCGCCGACGCCTACGGCAACCTGCCCTGCGCCTCCTACGACCAAAACATCCCCGGGCTCTGCAGTGACCTCGCCAAAGGCGCCTGCGACAAGACGGACGAGGGCGCGCTGCATGGCGCGGCTGAGGCCAATTTCCGCATCTACCCCTGGATGCGGTCTTCAGGTAGGCGCAGTCGCTAGGCGGGCCAGGCTGGCGGAGCGGGACCGGGAGCGGGGAGCGCAGCGCTGGGGAGCGCGGAGCGCGGGGCGCGGGGCCGGAAGAGCGGAGCCAGGCTGTTGCGAGCCGGTAGCCCCGTGACTCCCGGCGCA SEQ ID NO: 25 HOXA7 region 2 reference sequence converted after bisulfite treatment CGTTCGGTTACGGTTTGGGCGTCGACGTTTACGGTAATTTGTTTTGCGTTTTTTACGATTAAAATATTTTCGGGTTTTGTAGTGATTTCGTTAAAGGCGTTTGCGATAAGACGGACGAGGGCGCGTTGTATGGCGCGGTTGAGGTTAATTTTCGTATTTATTTTTGGATGCGGTTTTTAGGTAGGCGTAGTCGTTAGGCGGGTTAGGTTGGCGGAGCGGGATCGGGAGCGGGGAGCGTAGCGTTGGGGAGCGCGGAGCGCGGGGCGCGGGGTCGGAAGAGCGGAGTTAGGTTGTTGCGAGTCGGTAGTTTCGTGATTTTCGGCGTA SEQ ID NO: 26 β-actin region reference sequence SEQ ID NO: 27 β-actin sequence converted after bisulfite treatment

We design different methylation primers and probes according to sequence SEQ ID NO: 22 region 1 and sequence SEQ ID NO: 24 region 2, each primer probe information is shown in Table 18, wherein group 8, group 9, group 10 are based on Methylated primers and probes designed in region 1; group 1, group 2, group 3, group 4, group 5, group 6, group 7 are methylated primers and probes designed according to region 2 (primers and probes) The sequence is shown in Table 19).

The above 10 primer-probe combinations were detected in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, 4 squamous cell carcinomas and 21 adenocarcinoma samples in the 25 cancer samples. The test results are shown in Table 18 below. [Table 18] Detection results in tissues In the area group primer probe combination specificity Sensitivity Zone 2 Group 1 H7-F2, H7-R2, H7-P2 100% 80% Zone 2 group 2 H7-F3, H7-R3, H7-P3 100% 76% Zone 2 group 3 H7-F4, H7-R4, H7-P4 100% 56% Zone 2 Group 4 H7-F5, H7-R5, H7-P5 100% 72% Zone 2 Group 5 H7-F6,H7-R6,H7-P6 100% 80% Zone 2 Group 6 H7-F7, H7-R7, H7-P7 100% 72% Zone 2 Group 7 H7-F8,H7-R8,H7-P8 100% 56% Area 1 Group 8 H7-F9, H7-R9, H7-P9 100% 48% Area 1 Group 9 H7-F10,H7-R10,H7-P10 100% 16% Area 1 group 10 H7-F11,H7-R11,H7-P11 100% twenty four%

The results show that no matter how primers and probes are designed in region 1, the highest detection sensitivity for region 1 can only reach 48%, and no matter what kind of primers and probes are designed in the present disclosure, the detection sensitivity of region 2 can also reach the lowest 56%. %, up to 80%. Therefore, the detection rate of Region 2 was significantly higher than that of Region 1 (see Table 18).

2. Influence of primers and probes on the detection effect

In addition to the detection area affecting the detection effect, primers and probes also have a great impact on the detection effect of tumor markers. Sensitivity and specificity of probes and primers, so that the detection reagent of the present disclosure can be practically applied to clinical detection. Some primers and probes are shown in Table 19 below, and the detection results are shown in Table 20. All primers and probes were synthesized by Yingweijieji (Shanghai) Trading Co., Ltd. [Table 19] Primers and probes name serial number sequence effect H7-F2 SEQ ID NO: 1 TAAAGGCGTTTGCGATAAGAC Primer upstream of HOXA7 gene H7-R2 SEQ ID NO: 2 TAACCCGCCTAACGACTACG Primer downstream of HOXA7 gene H7-P2 SEQ ID NO: 3 FAM-AGGGCGCGTTGTATGGCGC-BQ1 HOXA7 gene detection probe H7-F3 SEQ ID NO: 28 GCGTTTGCGATAAGACGGAC Primer upstream of HOXA7 gene H7-R3 SEQ ID NO: 29 CCAACCTAACCCGCCTAACG Primer downstream of HOXA7 gene H7-P3 SEQ ID NO: 30 FAM-CGTTGTATGGCGCGGTTGAGG-BQ1 HOXA7 gene detection probe H7-F4 SEQ ID NO: 31 CGTTCGGTTACGGTTTGGGC Primer upstream of HOXA7 gene H7-R4 SEQ ID NO: 32 GCCCTCGTCCGTCTTATCGC Primer downstream of HOXA7 gene H7-P4 SEQ ID NO: 33 FAM-TCGACGTTTACGGTAATTTGTTTTGCG-BQ1 HOXA7 gene detection probe H7-F5 SEQ ID NO: 34 ATTTCGTTAAAGGCGTTTGC Primer upstream of HOXA7 gene H7-R5 SEQ ID NO: 35 TCCGCCAACCTAACCCG Primer downstream of HOXA7 gene H7-P5 SEQ ID NO: 36 FAM-CGGACGAGGGCGCGTTGTAT-BQ1 HOXA7 gene detection probe H7-F6 SEQ ID NO: 37 CGTTAAAGGCGTTTGCGATAAGAC Primer upstream of HOXA7 gene H7-R6 SEQ ID NO: 38 TACGCTCCCCGCTCCCGAT Primer downstream of HOXA7 gene H7-P6 SEQ ID NO: 39 FAM-GACGGACGAGGGCGCGTTGTATG-BQ1 HOXA7 gene detection probe H7-F7 SEQ ID NO: 40 CAACGCTACGCTCCCCGCT Primer downstream of HOXA7 gene H7-R7 SEQ ID NO: 41 GCGATAAGACGGACGAGGGC Primer upstream of HOXA7 gene H7-P7 SEQ ID NO: 42 FAM-CCGATCCCGCTCCGCCAACC-BQ1 HOXA7 gene detection probe H7-F8 SEQ ID NO: 43 CGTTAGGCGGGTTAGGTTGGC Primer upstream of HOXA7 gene H7-R8 SEQ ID NO: 44 GCCGAAAATCACGAAACTACCG Primer downstream of HOXA7 gene H7-P8 SEQ ID NO: 45 FAM-AGCGGGATCGGGAGCGGG-BQ1 HOXA7 gene detection probe H7-F9 SEQ ID NO: 46 TCGGGTCGTTTGGCGTTC Primer upstream of HOXA7 gene H7-R9 SEQ ID NO: 47 AACCTAACGCGTCCCGCG Primer downstream of HOXA7 gene H7-P9 SEQ ID NO: 48 FAM-TTGGTCGTTAGTTGGGCGTTTTCGC-BQ1 HOXA7 gene detection probe H7-F10 SEQ ID NO: 49 GGCGTTCGTAGATTTTAGTGC Primer upstream of HOXA7 gene H7-R10 SEQ ID NO: 50 CAAATAATCTCGCTCCGCA Primer downstream of HOXA7 gene H7-P10 SEQ ID NO: 51 FAM-GGTCGTTAGTTGGGCGTTTTCG-BQ1 HOXA7 gene detection probe H7-F11 SEQ ID NO: 52 GCGTTAGGTTCGTCGGGC Primer upstream of HOXA7 gene H7-R11 SEQ ID NO: 53 AAACTCGCCGCAACACGTAA Primer downstream of HOXA7 gene H7-P11 SEQ ID NO: 54 FAM-CGGATTTTTTGGTCGTATATTTGAGT-BQ1 HOXA7 gene detection probe A3-TqMF SEQ ID NO: 16 TTTTGGATTGTGAATTTGTG β-actin gene upstream primer A3-TqMR SEQ ID NO: 17 AAAACCTACTCCTCCCTTAAA β-actin gene downstream primer A3-TqP SEQ ID NO: 18 FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 β-actin gene detection probe [Table 20] Detection results in tissues group primer probe combination specificity Sensitivity Group 1 H7-F2, H7-R2, H7-P2 100% 80% group 2 H7-F3, H7-R3, H7-P3 100% 76% group 3 H7-F4, H7-R4, H7-P4 100% 56% Group 4 H7-F5, H7-R5, H7-P5 100% 72% Group 5 H7-F6, H7-R6, H7-P6 100% 80% Group 6 H7-F7, H7-R7, H7-P7 100% 72% Group 7 H7-F8, H7-R8, H7-P8 100% 56% Group 8 H7-F9, H7-R9, H7-P9 100% 48% Group 9 H7-F10, H7-R10, H7-P10 100% 16% group 10 H7-F11, H7-R11, H7-P11 100% twenty four%

In this disclosure, the primers and probes in Table 19 were used for validation of tissue samples. The above 10 primer-probe combinations were detected in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, 4 squamous cell carcinomas and 21 adenocarcinoma samples in the 25 cancer samples. The test results are shown in Table 20 above. The results show that group 1, group 2, group 4, group 5, and group 6 all have good detection rates.

In order to further verify its detection rate in sputum, we selected 22 sputum samples and used the primers and probes in Table 19 for verification, including 7 normal controls, 15 lung cancer controls, and 15 lung cancer patients. There were 7 cases of squamous cell carcinoma, 7 cases of adenocarcinoma, and 1 case of large cell carcinoma. The test results are shown in Table 21. [Table 21] Detection results in sputum group primer probe combination specificity Sensitivity Group 1 H7-F2, H7-R2, H7-P2 100% 73.3% group 2 H7-F3, H7-R3, H7-P3 100% 53.3% Group 4 H7-F5, H7-R5, H7-P5 100% 60.0% Group 5 H7-F6, H7-R6, H7-P6 100% 53.3% Group 6 H7-F7, H7-R7, H7-P7 100% 46.7%

The detection results of 22 sputum samples showed that group 1: H7-F2, H7-R2, H7-P2 had the highest detection rate, reaching 73.3%.

Although the sensitivity of group 1 and group 5 can reach 80% in tissue samples, the sensitivity of group 5 has dropped significantly to 53.3% for sputum samples. Detection reagents with high sensitivity are particularly difficult.

Finally, according to the detection results of each set of primer probes, the most preferred primer probe sequences are shown in Table 22 below. [Table 22] Optimized primers name serial number sequence effect H7-F2 SEQ ID NO: 1 TAAAGGCGTTTGCGATAAGAC Primer upstream of HOXA7 gene H7-R2 SEQ ID NO: 2 TAACCCGCCTAACGACTACG Primer downstream of HOXA7 gene H7-P2 SEQ ID NO: 3 FAM-AGGGCGCGTTGTATGGCGC-BQ1 HOXA7 gene detection probe

none.

[Figure 1] ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in tissue samples; [Fig. 2] ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in sputum samples; [Fig. 3] ROC curves of HOXA7 and SHOX2_n3 detected in sputum samples; [Figure 4] Amplification curves of HOXA7 and SHOX2_n3 in sputum samples (A is the amplification map of HOXA7, B is the amplification map of SHOX2_n3; [Fig. 5] The ROC curves of HOXA7 and SHOX2_n3 in all lavage fluid samples; [Fig. 6] Amplification curves of HOXA7 and SHOX2_n3 in lavage fluid samples (A is the amplification map of HOXA7, B is the amplification map of SHOX2_n3).

<110> Mainland business Guangzhou Kang Liming Biotechnology Co., Ltd.

<120> Use of HOXA7 methylation detection reagent in preparation of lung cancer diagnostic reagent

<150> 201811152034.7

<151> 2018-09-29

<160> 57

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> HOXA7-F2 primer F

<400> 1

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> HOXA7-R2 primer R

<400> 2

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> HOXA7-P2 probe

<400> 3

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2 primer F

<400> 4

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2 primer R

<400> 5

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2 probe

<400> 6

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> PCDHGA12 primer F

<400> 7

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> PCDHGA12 primer R

<400> 8

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> PCDHGA12 probe

<400> 9

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> HOXD8 primer F

<400> 10

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> HOXD8 primer R

<400> 11

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> HOXD8 probe

<400> 12

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> GATA3 primer F

<400> 13

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> GATA3 primer R

<400> 14

<210> 15

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> GATA3 probe

<400> 15

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> β -actin primer F

<400> 16

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> β -actin primer R

<400> 17

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> β -actin probe

<400> 18

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2_n3 primer F

<400> 19

<210> 20

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2_n3 primer R

<400> 20

<210> 21

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> SHOX2_n3.2 probe

<400> 21

<210> 22

<211> 880

<212> DNA

<213> Homo sapiens

<220>

<223> HOXA7 Region 1 Reference Sequence

<400> 22

<210> 23

<211> 880

<212> DNA

<213> Artificial sequence

<220>

<223> HOXA7 region 1 sequence converted after bisulfite treatment

<400> 23

<210> 24

<211> 326

<212> DNA

<213> Homo sapiens

<220>

<223> HOXA7 Region 2 Reference Sequence

<400> 24

<210> 25

<211> 326

<212> DNA

<213> Artificial sequence

<220>

<223> HOXA7 region 2 reference sequence converted after bisulfite treatment

<400> 25

<210> 26

<211> 972

<212> DNA

<213> Homo sapiens

<220>

<223> β -actin region reference sequence

<400> 26

<210> 27

<211> 972

<212> DNA

<213> Artificial sequence

<220>

<223> β -actin sequence converted after bisulfite treatment

<400> 27

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F3

<400> 28

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R3

<400> 29

<210> 30

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P3

<400> 30

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F4

<400> 31

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R4

<400> 32

<210> 33

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P4

<400> 33

<210> 34

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F5

<400> 34

<210> 35

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R5

<400> 35

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P5

<400> 36

<210> 37

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F6

<400> 37

<210> 38

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R6

<400> 38

<210> 39

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P6

<400> 39

<210> 40

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F7

<400> 40

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R7

<400> 41

<210> 42

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P7

<400> 42

<210> 43

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F8

<400> 43

<210> 44

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R8

<400> 44

<210> 45

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P8

<400> 45

<210> 46

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F9

<400> 46

<210> 47

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R9

<400> 47

<210> 48

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P9

<400> 48

<210> 49

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F10

<400> 49

<210> 50

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R10

<400> 50

<210> 51

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P10

<400> 51

<210> 52

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> H7-F11

<400> 52

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> H7-R11

<400> 53

<210> 54

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> H7-P11

<400> 54

<210> 55

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> COL2A1 primer F

<400> 55

<210> 56

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> COL2A1 primer R

<400> 56

<210> 57

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> COL2A1 probe P

<400> 57

Claims (19)

Use of a detection reagent for HOXA7 gene methylation in preparing a diagnostic reagent for lung cancer; the lung cancer is lung adenocarcinoma; the sample targeted by the detection reagent is sputum; the detection reagent comprises a primer pair and a probe; the primer For having the sequences shown in SEQ ID NO:1 and SEQ ID NO:2, the probe has the sequence shown in SEQ ID NO:3. The use according to claim 1, wherein the HOXA7 gene methylation detection reagent detects the sequence of the HOXA7 gene modified by a transformation reagent. The use according to claim 2, wherein the conversion reagent is one or more selected from hydrazine salts, bisulfites and bisulfites. The use according to claim 2, wherein the conversion reagent is selected from bisulfite. The use according to claim 1, wherein the detection region of the HOXA7 gene methylation detection reagent comprises the sequence shown in SEQ ID NO: 24. The use according to claim 1, wherein the HOXA7 gene methylation detection reagent further comprises bisulfite, bisulfite or hydrazine salt. The use according to claim 1, wherein the HOXA7 gene methylation detection reagent further comprises one or more of DNA polymerase, dNTPs, Mg ²⁺ ions and buffer. The use according to claim 1, wherein the HOXA7 gene methylation detection reagent comprises DNA polymerase, dNTPs, Mg ²⁺ ions and a buffer. The use according to claim 1, wherein the HOXA7 gene methylation detection reagent further comprises a reference gene detection reagent. The use according to claim 9, wherein the reference gene comprises β-actin or COL2A1. The use according to claim 9, wherein the detection reagent for the reference gene comprises primers and probes for the reference gene. The use according to claim 10, wherein the detection reagent for the reference gene β-actin comprises a primer pair shown in SEQ ID NO: 16 and SEQ ID NO: 17, and a probe shown in SEQ ID NO: 18. The use according to claim 10, wherein the detection reagent for the reference gene COL2A1 comprises a primer pair shown in SEQ ID NO: 55 and SEQ ID NO: 56, and a probe shown in SEQ ID NO: 57. A diagnostic system for lung cancer, comprising: a. a DNA methylation detection component of the HOXA7 gene; and b. a result judgment component; the lung cancer is lung adenocarcinoma; the sample targeted by the detection component is sputum; wherein the HOXA7 The DNA methylation detection component of the gene comprises the detection reagent for HOXA7 gene methylation according to any one of claims 1-13. The diagnostic system according to claim 14, wherein the methylation detection component comprises one or more of a fluorescence quantitative PCR instrument, a PCR instrument, and a sequencer. The diagnostic system of claim 14, wherein the result determining means comprises a data processing machine. The diagnostic system according to claim 14, wherein the result judgment means is configured to output a diagnosis result according to the DNA methylation level of the HOXA7 gene detected by the detection means. The diagnostic system according to claim 14, wherein the diagnostic result is obtained by comparing the methylation levels of the test sample and the normal sample by the result judgment component, based on the methylation levels of the test sample and the normal sample. A method for diagnosing lung cancer, comprising the following steps: (1) mixing a sample to be tested from a future subject with a detection reagent for HOXA7 gene methylation comprising the use described in any one of claims 1-13, obtaining a mixture, and mixing the mixture. Extraction and amplification are performed to detect the HOXA7 gene methylation level of the test sample derived from the subject; (2) the HOXA7 gene methylation level of the test sample is compared with the normal sample; and (3) based on the test sample The elevated methylation level of the normal sample is used to diagnose lung cancer; the lung cancer is lung adenocarcinoma; the sample to be tested is sputum.

Images