TWI730429B - HOXA7 methylation detection reagent - Google Patents

Abstract

The present disclosure relates to a lung cancer diagnosis reagent and kit. The reagent or kit contains a detection reagent for HOXA7 gene methylation. The detection reagent or kit of the present disclosure has a sensitivity of 88.6% and a specificity of 95% for lung cancer in sputum, and the detection sensitivity is higher than existing lung cancer markers, especially for lung adenocarcinoma. The substantial improvement has great application value for the diagnosis of lung adenocarcinoma.

Description

HOXA7 methylation detection reagent

The present disclosure belongs to the field of genetic diagnosis. More specifically, the present disclosure relates to a lung cancer diagnostic reagent based on the methylation of human HOXA7 gene or a kit containing the reagent.

Lung cancer is a malignant tumor of the lung that originates from the bronchial mucosa, glands, or alveolar epithelium. According to the pathological type, it can be divided into: 1. Small cell lung cancer (SCLC): a special pathological type of lung cancer, which has obvious tendency to metastasize to a distance and has a poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy. 2. Non-small cell lung cancer (NSCLC): In addition to small cell lung cancer, other pathological types of lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are certain differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1. Central lung cancer: Lung cancer that grows at the opening of the bronchus of the lung segment and above. 2. Peripheral lung cancer: lung cancer that grows beyond the opening of the bronchus in the lung segment.

Early diagnosis and early surgery of lung cancer is one of the most effective methods to improve the 5-year survival rate of lung cancer and reduce the mortality rate.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following types, but none of them can fully achieve early detection and early diagnosis:

1. Blood biochemical test: There is currently no specific blood biochemical test for primary lung cancer. For lung cancer patients, elevated blood alkaline phosphatase or serum calcium may consider bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, or bilirubin may consider liver metastasis.

2. Tumor marker examination: (1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but they are mainly seen in patients with advanced lung cancer. At present, the examination of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. (2) NSE: It is the first choice marker for small cell lung cancer. It is used for the diagnosis and monitoring of treatment response of small cell lung cancer. The reference value is different depending on the detection method and reagents used. 3) CYFRA21-1: It is the first choice marker for non-small cell lung cancer, with a sensitivity of up to 60% in the diagnosis of lung squamous cell carcinoma. The reference value is different depending on the detection method and reagents used.

3. Imaging examination: (1) Chest X-ray examination: It should include frontal and lateral chest radiographs. In primary hospitals, chest radiographs are still the most basic and first-choice imaging diagnosis method for lung cancer at the initial diagnosis. Once lung cancer is diagnosed or suspected, a CT scan of the chest is performed. (2) CT examination: Chest CT is the most commonly used and most important examination method for lung cancer. It is used for the diagnosis and differential diagnosis, staging and follow-up after treatment of lung cancer. Hospitals with conditions should include the adrenal glands when performing chest CT scans for lung cancer patients. Enhanced scanning should be used as much as possible, especially in patients with central lung disease. CT is the basic examination method to show brain metastases. Patients with clinical symptoms or advanced patients should undergo brain CT scans, and use enhanced scans as much as possible. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Hospitals with conditions can use it for the diagnosis of lung lesions that are difficult to characterize. The clinical diagnosis of lung cancer needs to be confirmed by cytology and histology, and other methods are difficult to obtain. Case. (3) Ultrasound examination: It is mainly used to find out whether there are metastases in important abdominal organs, abdominal cavity and retroperitoneal lymph nodes, and it is also used for neck lymph node examination. For lung lesions or chest wall lesions that are adjacent to the chest wall, the cysts and solids can be identified and ultrasound-guided needle biopsy can be performed; ultrasound is also often used for pleural fluid extraction and positioning. (4) Bone scan: It is highly sensitive to the detection of bone metastases from lung cancer, but has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

4. Other examinations: (1) Sputum cytology examination: The current simple and convenient non-invasive diagnosis method for lung cancer, continuous smear examination can increase the positive rate by about 60%, and it is a routine diagnosis method for suspected lung cancer cases. (2) Fiberoptic bronchoscopy: one of the most important methods in the diagnosis of lung cancer, which plays an important role in the qualitative diagnosis of lung cancer and the selection of surgical options. It is a necessary routine examination item for patients who are to be treated by surgery. The bronchoscopy needle biopsy (TBNA), although conducive to pre-treatment staging, but due to technical difficulties and risks, those in need should be transferred to a higher-level hospital for further examination. (3) Others: such as percutaneous lung biopsy, thoracoscopy biopsy, mediastinoscopy biopsy, pleural effusion cytology, etc., if there are indications, they can be used according to the existing conditions to assist in diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools to detect early lung cancer and reduce mortality. The Nationwide Lung Cancer Screening Study (NLST) has shown that LDCT can reduce compared to chest X-ray screening 20% of lung cancer mortality. It has been proved in clinical practice that the success or failure of any lung cancer screening project depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized worldwide as one of the methods for identifying high-risk groups of lung cancer. The risk model assists clinicians to improve interventions or treatments, thereby further improving the efficacy of lung cancer patients. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still a difficult problem to solve. In order to maximize the benefit-harm ratio of lung cancer screening, the key question is how to define the population at high risk of disease; the second is what method is used to screen the population, including the definition of high-risk factors and the overall risk Quantitative summary and selection of screening benefit cutoffs.

Existing lung cancer detection techniques mainly have low sensitivity, high false positives, and are invasive, and it is difficult to detect early lung cancer with conventional detection techniques.

However, non-invasive detection of lung cancer, such as sputum detection, is more difficult. Although some researchers have studied tumor markers in the sputum of patients with lung cancer, the success rate of sputum samples is very low compared with the detection and evaluation of tumor markers in blood samples of other tumor patients. This is because ① the composition of sputum is more complicated, and the composition and viscosity of sputum of different people in different diseases or environments are quite different; ② sputum contains more tracheal epithelial cells and bacteria, oral mucosal cells, etc. For the components of non-lung cancer cells, general sample processing methods cannot effectively enrich a sufficient number of lung cancer-derived DNA; ③There are many smokers who do not show sputum expectoration. AJ Hubers et al. in "Molecular sputum analysis for the diagnosis of lung cancer" in the past 10 literature studies showed that the median methylation degree of markers in lung cancer tissue is 48%, while the median of sputum The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that in sputum. At the same time, Rosalia Cirincione (Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, and 51.7, respectively. %, and only 44.4%, 5%, 5% in sputum.

Currently, the missed detection rate of lung cancer is relatively high. Especially, for this type of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate from smaller bronchial tubes, which are peripheral lung cancers. Exfoliated cells in the deep lungs are more difficult to expectorate through sputum. Therefore, the current sputum detection methods for adenocarcinoma are almost zero.

Although some lung cancer-related tumor markers have been discovered in the prior art, the detection reagents or detection methods for these tumor markers are limited, resulting in that the sensitivity and specificity of these tumor markers cannot meet the needs. Therefore, there are still Further research is needed for screening methods that can be practically applied to lung cancer. Although non-invasive screening has unique advantages in sampling, it also has some limitations in other aspects. For example, the type of adenocarcinoma in lung cancer is difficult to expectorate through sputum due to the exfoliated cells in the deep lung. In other words, those skilled in the art would think that this type of lung cancer is not suitable for non-invasive screening. On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements of clinical use. Although relevant research has been progressing for many years, there is still no noninvasive screening method for lung cancer that can be promoted to the clinic.

The purpose of the present disclosure is to provide a use of a nucleic acid fragment of the HOXA7 gene in the preparation of lung cancer diagnosis.

Another object of the present disclosure is to provide a primer and its use in the preparation of lung cancer diagnostic reagents or kits.

Another object of the present disclosure is to provide a probe and its use in preparing lung cancer diagnostic reagents or kits.

Another objective of the present disclosure is to provide a reagent, kit and method for diagnosing the methylation of human HOXA7 gene.

Another objective of the present disclosure is to provide a lung cancer diagnostic reagent and kit with strong specificity and high sensitivity.

A further objective of the present disclosure is to provide a lung cancer diagnostic reagent and kit with high sensitivity and specificity for lung adenocarcinoma.

Another objective of the present disclosure is to provide a lung cancer diagnostic reagent and kit with a wide range of applications for lung cancer.

Another objective of the present disclosure is to provide a non-invasive lung cancer diagnostic reagent and kit.

The above objectives of the present disclosure are achieved through the following technical means:

After in-depth research, the inventor provided a detection reagent for HOXA7 gene methylation. The inventor not only verified that the detection reagent has high specificity and sensitivity for the detection of lung cancer in tissue samples, but also verified that it has the same high specificity and sensitivity in sputum samples and lavage fluid samples.

The HOXA7 gene is a member of the HOX (homebox homebox) gene family. It belongs to the HOXA cluster gene on chromosome 7p15-p14. Like other HOX genes, they all contain a 180bp DNA fragment, which is transcribed from 60 amino acids. Homology domain. HOXA7 plays a regulatory role in the proliferation and differentiation of normal hematopoietic cells. At present, there are more studies that the abnormal expression of HOXA7 plays an important role in the occurrence and development of leukemia. There are also some reports that the methylation of HOXA7 gene is related to lung cancer.

The first aspect of the present disclosure provides a use of a nucleic acid fragment in preparing a lung cancer diagnostic reagent or kit; wherein the nucleic acid fragment is derived from the HOXA7 gene. Specifically, the nucleic acid fragment comprises the sequence shown in SEQ ID NO: 22 or SEQ ID NO: 24; as a preferred embodiment, the nucleic acid fragment comprises the sequence shown in SEQ ID NO: 24.

On the other hand, the present disclosure also provides a primer comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53 are shown in any one; as a preferred embodiment in the present disclosure The primer includes the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2.

On the other hand, the present disclosure also provides a probe comprising SEQ ID NO: 3, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID It is shown in any one of NO: 42, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 51, and SEQ ID NO: 54. As a preferred embodiment in the present disclosure, the nucleic acid probe comprises the sequence shown in SEQ ID NO: 3.

On the other hand, the present disclosure also provides the use of the aforementioned primers or nucleic acid probes in the preparation of diagnostic reagents or kits for lung cancer.

On the other hand, the present disclosure also provides a diagnostic reagent for lung cancer, which comprises a detection reagent for HOXA7 gene methylation.

Wherein, the HOXA7 gene methylation detection reagent detects the sequence of the HOXA7 gene modified by the transformation reagent. Among them, the conversion reagent refers to a reagent that deaminates cytosine in DNA into uracil, and at the same time makes 5-MeC basically unaffected. Exemplary conversion reagents include hydrazine salt, bisulfite (such as sodium bisulfite, etc.), bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) Etc.), or one or more of the compounds that can produce hydrazine salt, bisulfite, and bisulfite under appropriate reaction conditions. As an exemplary embodiment, the HOXA7 gene methylation detection reagent detects the sequence modified by bisulfite.

Methylation occurs when a methyl group is added to cytosine. After treatment with bisulfite, bisulfite, or hydrazine salt, cytosine will become uracil, because uracil and thymine will become uracil during PCR amplification. Pyrimidines are similar and will be recognized as thymine, which is reflected in the PCR amplification sequence, that is, the unmethylated cytosine becomes thymine (C becomes T), and the methylated cytosine (C) does not change. . The technology for detecting methylated genes by PCR is usually methylation-specific PCR (Methylmion Specific PCR, MSP). Primers are designed for the treated methylated fragments (that is, the unchanged C in the fragments), and PCR amplification is carried out. Amplification means methylation, and no amplification means no methylation.

As an optional embodiment, the detection area of the reagent is a CG-enriched area or a non-CG-enriched area or CTCF (CTCF-binding sites) area of the HOXA7 gene. As a preferred embodiment, the detection region of the reagent is a CG-enriched region or CTCF (CTCF-binding sites) region of the HOXA7 gene.

Or the detection region targeted by the reagent is the gene body of the HOXA7 gene or its promoter region.

As a preferred embodiment in the present disclosure, the detection area of the reagent comprises the sequence shown in SEQ ID NO: 22 (Region 1) or SEQ ID NO: 24 (Region 2). As a more preferred embodiment, the detection area of the reagent comprises the sequence shown in SEQ ID NO:24.

The inventor found through experiments that the selection of the detection area of the HOXA7 gene will have an impact on the detection efficiency of the tumor. The primers designed according to the hypermethylated area of the HOXA7 gene, and the primers designed in different regions have obvious differences in the detection results. The detection rate is 50%~60% higher than the poor area. The inventors found through experiments that the detection results of GC-enriched regions or CTCF (CTCF-binding sites) regions are significantly better than non-hypermethylated regions.

The diagnostic reagent of the present disclosure includes an amplification primer. As an optional embodiment, the primer includes SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO : 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46 , At least any one of SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, and SEQ ID NO: 53. As a preferred embodiment, the primer includes a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2.

The primers are used to amplify specific regions of the HOXA7 gene. It is well known in the art that the successful design of primers is essential for PCR. Compared with general PCR, in the detection of gene methylation, the influence of primer design is more critical. This is because the methylsulfurization reaction promotes the conversion of "C" in the DNA chain to "U", which reduces the GC content and makes PCR After the reaction, a long continuous "T" appears in the sequence, which is likely to cause DNA strand breaks, making it difficult to select a suitable Tm and stable primer; on the other hand, in order to distinguish between vulcanization treatment and non-vulcanization treatment and incomplete treatment DNA requires a sufficient number of "C" in the primers, all of which increase the difficulty of selecting stable primers. Therefore, in DNA methylation detection, the selection of the amplified fragments targeted by the primers, such as the length and position of the amplified fragments, and the selection of primers, all have an impact on the sensitivity and specificity of the detection. The inventor also found through experiments that different amplification target fragments and primers have different detection effects. Many times, it is found that certain genes or nucleic acid fragments have expression differences between tumors and non-tumors, but their distances are transformed into tumor markers, and there is still a long way to be applied in the clinic. The main reason is that the detection sensitivity and specificity of the potential tumor markers are difficult to meet the detection requirements due to the limitations of the detection reagents, or the detection methods are complicated and costly, and it is difficult to apply them in clinics on a large scale.

The diagnostic reagent of the present disclosure further includes a probe. As an optional embodiment, the probe includes SEQ ID NO: 3, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID Any one of NO: 45, SEQ ID NO: 48, SEQ ID NO: 51, SEQ ID NO: 54. As a preferred embodiment, the probe comprises SEQ ID NO: 3. As a preferred mode of the present disclosure, for the convenience of clinical use, the fluorescent group labeled by the detection probe includes VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red, etc.; the quenching group includes TAMRA, BHQ , MGB, Dabcyl, etc., to apply to the multi-channel PCR detection system commonly used in clinical testing at present, to achieve multi-color fluorescence detection in a reaction tube.

As a more preferred embodiment, the diagnostic reagent of the present disclosure includes the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2 and the probe shown in SEQ ID NO: 3.

As an optional embodiment, the reagents of the present disclosure further include bisulfite, bisulfite or hydrazine salt for modifying methylated cytosine to thymine. Of course, it may not be included in the reagent of the present disclosure, and it may be purchased separately at the time of use.

As an optional embodiment, the reagent of the present disclosure further contains one or more of DNA polymerase, dNTPs, Mg²⁺ ion, and buffer; preferably, it contains DNA polymerase, dNTPs, Mg²⁺ ion, and buffer. For the amplification reaction of HOXA7 gene.

As an optional embodiment, the reagents of the present disclosure also include reference gene detection reagents.

In some embodiments, the reference gene includes β-actin or COL2A1. In addition to these two reference genes, other reference genes for methylation detection in the prior art can also be used. Further, the detection reagent for the reference gene includes primers and probes for the reference gene. As a preferred embodiment, the detection reagent for the reference gene β-actin includes the primer pair shown in SEQ ID NO: 16, SEQ ID NO: 17, and the probe of SEQ ID NO: 18. The detection reagent for the reference gene COL2A1 includes the primer pair shown in SEQ ID NO: 55 (TTTTGGATTTAAGGGGAAGATAAA) and SEQ ID NO: 56 (TTTTTCCTTCTCTA​CATCTTTCTACCT), and the probe shown in SEQ ID NO: 57 (AAGGGAAATTGAGAAATGAGAGAA​GGGA) .

Another aspect of the present disclosure provides a kit containing the above primers, probes, and lung cancer diagnostic reagents.

As an optional embodiment, the kit of the present disclosure includes: one or more containers divided into receiving reagents, provided that they contain at least one primer or probe of the present disclosure or other detection components.

In one embodiment, the kit may also include nucleic acid extraction reagents and materials.

In one embodiment, the kit may also include reagents and materials commonly used for nucleic acid amplification, such as DNA polymerases, dNTPs, Mg²⁺ ions, buffers, and so on.

In one embodiment, the kit may further include a conversion reagent that sensitively converts unmethylated cytosine.

In one embodiment, the kit includes a first container that contains a conversion reagent that sensitively transforms unmethylated cytosine; a second container that contains primers for amplification; and a third container that contains Probe.

In one embodiment, the kit further includes instructions.

In one embodiment, the kit further includes a sampling device.

Another aspect of the present disclosure provides a method for detecting DNA methylation of HOXA7 gene, which includes the following steps: (1) Treat the test sample with bisulfite or bisulfite or hydrazine salt to obtain a modified test sample; (2) Use the above reagents or kits to detect the methylation status of HOXA7 gene on the modified test sample in step (1).

As an alternative method, methylation-specific polymerase chain reaction (MSP) or real-time fluorescent quantitative methylation-specific PCR (qMSP) is used for detection. Other DNA methylation detection methods reported in the prior art can also be applied in the present disclosure. The prior art methylation detection method can be introduced into the present disclosure through patent USSN62/175,916.

Another aspect of the present disclosure also provides a lung cancer diagnosis system, which includes: The DNA methylation detection component of the HOXA7 gene, and, Result judgment component.

In some embodiments, the DNA methylation detection component of the HOXA7 gene comprises the above-mentioned reagent or kit.

In some embodiments, the methylation detection component includes one or more of a fluorescent quantitative PCR machine, a PCR machine, and a sequencer. In some embodiments, the result judgment component is used to output a diagnosis result such as the risk of lung cancer and/or the type of lung cancer based on the DNA methylation level of the HOXA7 gene detected by the detection component.

In some embodiments, the diagnosis result is obtained by comparing the methylation level of the test sample and the normal sample by the result judgment component, and is based on the deviation of the methylation level of the test sample and the normal sample.

In some embodiments, the result judgment component includes a data processing machine.

In some embodiments, the data processing machine includes any equipment or instrument or device that can perform data processing that can be used by a person skilled in the art.

In some embodiments, the data processing machine includes one or more of a computer and a computer. The computer is loaded with any software or program that can be used by those skilled in the art that can perform data processing or statistical analysis. In some embodiments, the computer includes a computer loaded with one or more software of SPSS, SAS, and Excel.

In some embodiments, the result judgment component further includes a result outputter. The output device includes any equipment or instrument or device that can display the data processing result as readable content. In some embodiments, the result output device includes one or more of a screen and a paper report.

Another aspect of the present disclosure provides a method for diagnosing lung cancer. The method includes the following steps: Detect the methylation level of HOXA7 gene in the sample to be tested from the subject; Compare the HOXA7 gene methylation level of the sample to be tested and the normal sample; Based on the deviation of the methylation level of the test sample and the normal sample, lung cancer is diagnosed.

In some embodiments, when the methylation level of the test sputum sample is greater than 0.77%, the test sample is determined to be a lung cancer sample, and when the methylation level is less than or equal to 0.77%, the test sample is determined to be a non-lung cancer sample .

In some embodiments, when the methylation level of the lavage fluid sample to be tested is greater than 0.7%, the sample to be tested is determined to be a lung cancer sample, and when the methylation level is less than or equal to 0.7%, it is determined that the sample to be tested is non- Lung cancer sample.

The diagnostic method of the present disclosure can be used before and after treatment of lung cancer or in combination with treatment of lung cancer, after treatment, such as evaluating the success of the treatment or monitoring the remission, recurrence and/or progress (including metastasis) of lung cancer after treatment.

Another aspect of the present disclosure provides a method for the treatment of lung cancer. The method includes administering surgery, chemotherapy, radiotherapy, radiotherapy and chemotherapy, immunotherapy, oncolytic virus therapy, or other related art to a patient diagnosed with lung cancer by the above-mentioned diagnostic method. Any other types of lung cancer treatment methods used and combinations of these treatment methods. In the present disclosure, the test samples of the reagents/kits/methods include sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, prostate fluid, tears or feces, etc. As a preferred embodiment, the test sample of the diagnostic/testing reagent contains sputum, tissue or lung lavage fluid. As a more preferred embodiment, the test sample of the diagnostic/testing reagent contains sputum.

The methylation level of HOXA7 gene in tissues is highly correlated with the incidence of lung cancer. Among 185 tissues, the specificity of HOXA7 gene normal group and all lung cancer groups is as high as 95%, and the sensitivity is 63.3%. Although the sensitivity is lower than that of the other tumor marker SHOX2 gene in the experiment of this disclosure, the unexpected finding is , HOXA7 gene methylation levels detected in sputum and lung lavage fluid also maintain a very high correlation with the incidence of lung cancer. In sputum, the sensitivity is 88.6% and the specificity is 95%. In the lung lavage fluid, the sensitivity is 76.2%, the specificity is 95%, and the sensitivity is even higher than that in the tissues. This is rare or even unique in molecular markers.

Among the various molecular markers studied by the inventors, the sensitivity or specificity of sputum samples was greatly reduced compared with tissue samples. For example, SHOX2, PCDHGA12, HOXD8, and GATA3 have been reported to be related to lung cancer genes. Among them, the sensitivity of SHOX2 in tissues is 80.6%, which is higher than the sensitivity of HOXA7 gene, while the sensitivity in sputum is reduced. To 62.9%, which is significantly lower than 88.6% of HOXA7 gene (Note: comparison between normal group and all cancer groups). In lung lavage fluid, the sensitivity of SHOX2 gene dropped to 52.4%, which seriously affected the diagnosis of lung cancer, while the sensitivity of HOXA7 increased to 76.2%.

The study found that a variety of lung cancer markers only showed good detection sensitivity and specificity in tissues; and in sputum and lung lavage fluid samples, no matter how to design and optimize the detection area, detection primers, probes, etc., it is sensitive Sex is still falling sharply, seriously affecting the diagnosis of lung cancer.

The sensitivity of HOXA7 gene in sputum and lung lavage fluid samples does not decrease but rises, and maintains up to 95% specificity, which makes this gene extremely special for sputum and lung lavage fluid samples. Reliable lung cancer marker. Among them, one of the reasons is that the present disclosure has optimized the detection area, primers, probes, etc. of HOXA7.

In the present disclosure, the lung cancer is selected from small cell lung cancer (SCLC) and non-small cell lung cancer (NSLC); further, the non-small cell lung cancer is selected from squamous cell Carcinoma, adenocarcinoma or large cell carcinoma. As a preferred embodiment, the lung cancer is selected from adenocarcinoma.

Experiments have confirmed that the reagents/kits of the present disclosure have high specificity and high sensitivity in many different types of lung cancer, and even in lung adenocarcinoma, they have higher sensitivity than other tumor markers. Currently, the missed detection rate of lung adenocarcinoma is relatively high. On the one hand, because lung adenocarcinoma is more likely to occur in women and non-smokers, the incidence is lower than that of squamous cell carcinoma and undifferentiated cancer, and the age of onset is relatively young, and women are relatively more common; on the other hand, most adenocarcinomas originate from smaller ones. Bronchus is a peripheral type of lung cancer. The exfoliated cells in the deep lung are more difficult to expectorate through sputum. On the other hand, lung adenocarcinoma generally has no obvious clinical symptoms in the early stage. Therefore, the detection of lung adenocarcinoma is more difficult and valuable.

The inventor found through experiments that in sputum, the reagent/kit of the present disclosure has a sensitivity of 88.9% for the detection of adenocarcinoma, which is a breakthrough improvement compared to SHOX2 (adenocarcinoma sensitivity 33.3%). In the lotion, the sensitivity of HOXA7 for adenocarcinoma detection has reached 72.7%, which is significantly improved compared to SHOX2 (adenocarcinoma sensitivity 36.4%), and it is not obvious that the sensitivity is higher than that in tissues. Therefore, for adenocarcinoma, the preferred test sample is sputum. Even if the lung lavage fluid is used as the test sample, it has a more prominent sensitivity than other markers, which is helpful for timely detection of patient abnormalities and further integration. Other testing methods confirm whether it is adenocarcinoma. Therefore, the HOXA7 methylation detection reagent/kit of the present disclosure has great application significance for the detection of adenocarcinoma.

The beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent/kit can not only use tissue as a test sample, but also has a higher sensitivity in sputum and lung lavage fluid. Sputum and lung lavage fluid can be easily used as test samples for reliable diagnosis of lung cancer. The sputum sample is very easy to obtain, and it will not cause any pain and inconvenience to the patient. The amount of sample used is very small, the sampling process is very convenient and has no effect on the patient. At the same time, the samples are easy to mail or take to the hospital for examination.

The beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent/kit can detect multiple types of lung cancer, and it also has higher sensitivity than other markers for difficult-to-detect adenocarcinoma.

The beneficial effect of one of the above technical solutions is that the lung cancer diagnostic reagent/kit does not need to consider the subject and age of detection, and has a wide range of applications.

The beneficial effect of one of the above technical solutions is that the reagent/kit is used to detect and diagnose cancer by methylation level, and more and more studies have confirmed that methylation changes are an early event in the process of tumorigenesis. , The detection of abnormal methylation makes it easier to find early lesions.

The “primer” or “probe” in the present disclosure refers to an oligonucleotide that includes a region complementary to a sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (for example, a target gene). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe contains at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 relative to the target molecule. A continuous or discontinuous block of nucleotide sequence complementary regions. When the primer or probe includes a region complementary to at least x consecutive nucleotides of the target molecule, the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

The "diagnosis" in this disclosure, in addition to the early diagnosis of lung cancer, also includes the diagnosis of middle and late stages of lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

The application of the lung cancer marker HOXA7 makes the early diagnosis of lung cancer possible. When it is determined that a gene methylated in a cancer cell is methylated in a cell that is clinically or morphologically normal, it indicates that the normal-looking cell is developing into cancer. In this way, lung cancer can be diagnosed at an early stage by methylation of the lung cancer-specific gene HOXA7 in cells that appear to be normal.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, preferably before the morphological changes of tissues or cells can be observed.

In addition to the early diagnosis of lung cancer, the reagents/kits of the present disclosure are also promising for lung cancer screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

As an alternative embodiment of the disease stage, the progress of lung cancer in different stages or periods can be diagnosed by measuring the degree of methylation of HOXA7 obtained from a sample. By comparing the degree of HOXA7 gene methylation of nucleic acids isolated from samples of each stage of lung cancer with the HOXA7 gene methylation of one or more nucleic acids isolated from samples in lung tissue without abnormal cell proliferation The degree of chemistry can be used to detect the specific stage of lung cancer in the sample.

In the present disclosure, "normal" samples refer to samples of the same type isolated from individuals who are known to be free of the cancer or tumor.

In the present disclosure, the "subject" is a mammal, such as a human.

The samples for methylation detection in the present disclosure include but are not limited to DNA, or RNA, or DNA and RNA samples containing mRNA, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

Methods for methylation detection are well-known, such as methylation-specific polymerase chain reaction, real-time fluorescence quantitative methylation-specific polymerase chain reaction, pyrosequencing, and the use of methylated DNA-specific binding proteins PCR, quantitative PCR, and DNA chip, differential methylation detection-methylation sensitive restriction endonuclease, differential methylation detection-sulfite sequencing method, etc., in addition, other The methylation detection method can be introduced through the patent US62007687.

In the present disclosure, "methylation level" and "methylation degree" can usually be expressed as the percentage of methylated cytosine, which is the number of methylated cytosine divided by the number of methylated cytosine and the amount of unmethylated cytosine. The sum of the number of methylated cytosines; and the method of dividing the number of methylation target genes by the number of reference genes is currently commonly used to express the methylation level; and other common ways of expressing the methylation level in the prior art.

The technical solutions of the present disclosure are further described below through specific examples, and the specific examples do not represent a limitation on the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concept of the present disclosure still fall within the protection scope of the present disclosure.

Example 1 ：The choice of detecting target genes

Methylated DNA has obvious advantages as a detection target. Compared with protein markers, DNA can be amplified and easily detected; compared with mutation markers, DNA methylation sites are located in specific genes. The location, generally in the promoter region, makes the detection easier and more convenient. In order to complete the present disclosure, the inventors screened hundreds of genes, and selected good HOXA7, SHOX2, PCDHGA12, HOXD8, GATA3 as candidate detection genes, β-actin gene as a reference gene, and studied the methylation of each gene. For site distribution, the primer probes designed for detection are used for real-time fluorescent quantitative methylation-specific PCR (qMSP) detection. The primer probes for each gene detection are as follows:

The detection primers and probes of HOXA7 are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

SHOX2's detection primers and probes are: SEQ ID NO: 4 SHOX2 Primer F: TTTAAAGGGTTCGTCGTTTAAGTC SEQ ID NO: 5 SHOX2 Primer R: AAACGATTACTTTCGCCCG SEQ ID NO: 6 SHOX2 Probe: FAM-TTAGAAGGTAGGAGGCGGAAAATTAG-BQ1

The detection primers and probes of PCDHGA12 are: SEQ ID NO: 7 PCDHGA12 Primer F: TTGGTTTTTACGGTTTTCGAC SEQ ID NO: 8 PCDHGA12 Primer R: AAATTCTCCGAAACGCTCG SEQ ID NO: 9 PCDHGA12 Probe: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes of HOXD8 are: SEQ ID NO: 10 HOXD8 primer F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 11 HOXD8 primer R: CCTAAAACCGACGCGATCTA SEQ ID NO: 12 HOXD8 probe: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes of GATA3 are: SEQ ID NO: 13 GATA3 primer F: TTTCGGTAGCGGGTATTGC SEQ ID NO: 14 GATA3 primer R: AAAATAACGACGAACCAACCG SEQ ID NO: 15 GATA3 Probe: FAM-CGCGTTTATGTAGGAGTGGTTGAGGTTC-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 16 β-actin primer F: TTTTGGATTGTGAATTTGTG SEQ ID NO: 17 β-actin primer R: AAAACCTACTCCTCCCTTAAA SEQ ID NO: 18 β-actin probe: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

experiment procedure:

1 ,extract DNA

Collect specimens of confirmed lung cancer patients and non-lung cancer patients, including paraffin tissue specimens, sputum specimens, and lavage fluid specimens. After the sample is pretreated and separated from the cells, DNA extraction is performed according to the HiPure FFPE DNA Kit (D3126-03) instruction of Meji Biotech.

2 , DNA Retouch

Follow the instructions of ZYMO RESEARCH Biotech Kit EZ DNA Methylation™ KIT (D5002) for bisulfite modification.

3. Amplification and detection [Table 1] Liquid preparation system

Amplification system: [Table 2] PCR reaction process

4 ,Test results

4.1. Test results in paraffin tissue

Sample information: A total of 185 lung tissue samples, including 87 normal tissue samples, 98 cancer tissue samples, and 98 cancer samples included 15 squamous cell carcinomas, 81 adenocarcinomas, and 2 unspecified lung cancers, including cancer And 73 pairs of adjacent control samples.

Figure 1 shows the ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 in all tissue samples. The statistical results of the detection of each gene in the tissue are shown in Table 3. [Table 3] Test results in the organization

From the above results, it can be seen that in the tissue samples, whether it is to compare and analyze lung cancer as a whole or compare and analyze according to the subtype of lung cancer, SHOX2 has the best detection effect, and HOXA7, PCDHGA12 and GATA3 have the second best detection effect. , HOXD8 has the worst detection effect, only reaching 40.8%.

Based on the above results, in order to study the detection of different genes in sputum, the inventors further screened the five markers of HOXA7, SHOX2, PCDHGA12, HOXD8 and GATA3 in sputum, because sputum is used as a non-invasive test sample , Is more important.

Example 2 : HOXA7 , SHOX2 , PCDHGA12 , HOXD8 with GATA3 Detection of genes in sputum

Sample information: A total of 90 sputum samples were tested, including 55 normal control samples, 35 cancer control samples, and 35 cancer samples including 12 cases of squamous cell carcinoma, 6 cases of small cell carcinoma, and 9 cases of adenocarcinoma. There were 2 cases of cell carcinoma and 6 cases of lung cancer without clear classification.

Experimental procedure:

a. Collect sputum specimens from lung cancer patients and non-lung cancer patients. After dethickening with DTT, centrifuge to remove the precipitate to separate the cells, wash twice with PBS, and then use Magen's DNA extraction kit (HiPure). FFPE DNA Kit, D3126-03) to extract DNA.

b. Use ZYMO RESEARCH's DNA transformation kit (EZ DNA Methylation Kit, D5002) to modify the DNA with bisulfite.

c. The dosing system is as follows: [Table 4] Dosing system

d. The amplification system is as follows: [Table 5] Amplification system

e. The test results are as follows: [Table 6] Test results in sputum

f. The ROC curve of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 in sputum samples is shown in Figure 2, and the statistical results are shown in Table 6. From the above results, it can be seen that in the sputum samples, these 5 genes are detected at the same time. For comparison, whether it is to compare and analyze lung cancer as a whole, or compare and analyze lung cancer subtypes, the detection effect of HOXA7 is better than that of the other 4 genes. Especially for the detection effect of adenocarcinoma, the detection rate of HOXA7 is 88.9%, while the detection rate of other genes is only 33.3%, and the detection rate of HOXA7 is much higher than that of other genes. Adenocarcinoma is generally peripheral. Due to the tree-like physiological structure of the bronchi, it is more difficult for the exfoliated cells in the deep lung to be coughed up through sputum, so the detection of this part is more difficult and meaningful.

Example 3 : HOXA7 as well as SHOX2 Detection of genes in sputum

A large number of documents show that SHOX2 can be used as a marker for detecting lung cancer, and there are patents showing [CN201510203539-Methods and kits for diagnosing methylation of human SHOX2 gene and human RASSF1A gene-application publication], SHOX2 is used in alveolar lavage fluid, lesion tissue , Pleural fluid, sputum and other samples have a higher detection rate. In order to verify the detection effect of HOXA7, the inventors simultaneously detected the detection efficiency of HOXA7 and SHOX2 genes. In this example, the detection efficiency of SHOX2 gene adopts the primer and probe sequences disclosed in patent CN201510203539, and expresses SHOX2 gene It is SHOX2_n3, to distinguish it from the SHOX2 gene detected by self-designed primers and probes in Examples 1 and 2 of the present disclosure.

The primer probes for each gene detection are as follows:

The detection primers and probes of HOXA7 are: SEQ ID NO: 1 HOXA7-F2 Primer F: TAAAGGCGTTTGCGATAAGAC SEQ ID NO: 2 HOXA7-R2 primer R: TAACCCGCCTAACGACTACG SEQ ID NO: 3 HOXA7-P2 Probe: FAM-AGGGCGCGTTGTATGGCGC-BQ1

The detection primers and probes of SHOX2_n3 are: SEQ ID NO: 19 SHOX2_n3 Primer F: TTTGGATAGTTAGGTAATTTTCG SEQ ID NO: 20 SHOX2_n3 Primer R: CGTACACGCCTATACTCGTACG SEQ ID NO: 21 SHOX2_n3.2 Probe: FAM-CCCCGATCGAACAAACGAAAC-BQ1

a. The dosing system is as follows: [Table 7] Dosing system

[表9] SHOX2_n3反應程序

b. The amplification system is as follows: [Table 8] Amplification system

[Table 9] SHOX2_n3 reaction program

c. The test results are as follows:

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio=target gene copy number/ACTB copy number*100 to judge the methylation degree of the two sets of samples. Finally, the threshold of HOXA7 is selected as 0.77. The threshold of SHOX2_n3 is 1.3, which is used as a criterion for judging the cancer group and the control group. The converted ratio can be judged as positive "+" if the ratio exceeds the set threshold, and it can be judged as negative "-" if the ratio is equal to or less than the set threshold. According to this standard, the test results of 90 sputum samples are as follows: [Table 10] Test results

d. Result analysis [Table 11] Statistical results

e. The ROC curve of HOXA7 and SHOX2_n3 detected in sputum samples is shown in Figure 3, the amplification curve is shown in Figure 4, and the statistical results are shown in Table 11. From the above results, it can be seen that the comparison and analysis of lung cancer as a whole is still based on lung cancer. For comparison and analysis of the subtypes of HOXA7, the detection effect of HOXA7 is better than that of SHOX2 gene. It is not obvious that the detection sensitivity of HOXA7 in sputum is higher than that in tissues. Especially for the detection effect of adenocarcinoma, the detection rate of HOXA7 is 88.9%, which is much higher than that of SHOX2 gene 33.3%. Adenocarcinoma is generally peripheral. Due to the tree-like physiological structure of the bronchi, the exfoliated cells in the deep lung are more difficult to expectorate through sputum. However, this disclosure has discovered for the first time a marker that can detect adenocarcinoma using sputum as a sample and can greatly increase the sensitivity to 88.9%. This breakthrough is of great significance to the detection of adenocarcinoma.

Example 4 : HOXA7 versus SHOX2 Detection of genes in lavage fluid

Sample information: A total of 79 samples of alveolar lavage fluid were tested, including 58 samples from the normal control group, 21 samples from the cancer group, 21 samples from the cancer group, 6 cases of squamous cell carcinoma, 4 cases of small cell carcinoma, and 11 cases of adenocarcinoma .

Experimental procedure:

a. Collect alveolar lavage fluid specimens from lung cancer patients and non-lung cancer patients, centrifuge to separate the cells, and then use Magen's DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. Use ZYMO RESEARCH's DNA transformation kit (EZ DNA Methylation Kit, D5002) to modify the DNA with bisulfite.

c. The amplification detection system is as follows: [Table 12] Amplification system

[表14] SHOX2_n3反應程序

d. The testing system is as follows: [Table 13] Testing system

[Table 14] SHOX2_n3 reaction program

e. The test results are as follows:

[表16] 分析結果

Use the standard curve to calculate the methylation copy number of each gene in the specimen, and use the ratio=target gene copy number/ACTB copy number*100 to judge the methylation degree of the two sets of samples. Finally, the threshold of HOXA7 is selected as 0.7. The threshold of SHOX2_n3 is 0.6, which is used as a criterion for judging the cancer group and the control group. The converted ratio can be judged as positive "+" if the ratio exceeds the set threshold, and it can be judged as negative "-" if the ratio is equal to or less than the set threshold. According to this standard, the test results of 79 lavage fluid samples are as follows: Table 15 Test results

[Table 16] Analysis results

f. The ROC curve of HOXA7 and SHOX2_n3 detected in all lavage fluid samples is shown in Figure 5, the amplification curve is shown in Figure 6, and the statistical results are shown in Table 16. It can be seen from the above results that both HOXA7 and SHOX2 are detected at the same time, and lung cancer as a whole is compared and analyzed. The detection rate of HOXA7 is 76.2%, which is much higher than that of SHOX2, 52.4%, and also higher than the sensitivity of HOXA7 in tissues. . According to the comparison and analysis of the subtypes of lung cancer, the test result of HOXA7 in the squamous cell carcinoma group was 16.6% higher than that of SHOX2. Especially for the detection effect of adenocarcinoma, its sensitivity reaches 72.7%, which is much higher than 36.4% of SHOX2, and is still higher than the sensitivity of HOXA7 in tissues, which is very rare in the field of adenocarcinoma detection. Dou Y et al. (Plasma small ncRNA pair panels as novel biomarkers for early-stage lung adenocarcinomascreening) reported that with plasma as the test sample, the sensitivity of the diagnosis of adenocarcinoma was 70.4% and the specificity was 72.7%, although the sensitivity of this disclosure is not significantly higher than However, the detection of adenocarcinoma in the present disclosure can maintain a sensitivity of up to 95%, and has a higher accuracy rate. Because adenocarcinoma is generally peripheral, due to the tree-like physiological structure of the bronchi, the alveolar lavage fluid is not easy to contact the deep lung alveoli or cancer tissue. This disclosure has discovered for the first time a marker that can detect adenocarcinoma using sputum as a sample and can greatly increase the sensitivity to 72.7%. This breakthrough is of great significance to the detection of adenocarcinoma.

Combining the above four examples, it can fully illustrate that HOXA7 has a better detection effect in the detection and diagnosis of lung cancer, especially the application of sputum, alveolar lavage fluid and other biological samples. It can be more easily applied to large-scale population screening and has more superior socio-economic value.

Example 5 : HOXA7 The influence of the detection area, primer and probe on the detection effect

1. The influence of the detection area on the detection effect

Various research data indicate that the methylation status and distribution of the same gene are not uniform. Therefore, for the same gene, methylation primers and probe detection systems designed in different regions are used to diagnose the same sample and the same tumor. The detection efficiency is not the same, and sometimes the selected area is not suitable, resulting in no diagnostic effect on the tumor. The inventors have repeatedly studied and compared multiple detection areas, and some exemplary detection areas are shown in Table 17 below. [Table 17] Sequence to be detected

We designed different methylation primers and probes according to the sequence SEQ ID NO: 22 (region 1) and the sequence SEQ ID NO: 24 (region 2). The information of each primer probe is shown in Table 18. Group 10 is the methylation primers and probes designed based on region 1; Group 1, Group 2, Group 3, Group 4, Group 5, Group 6, and Group 7 are methylation primers and probes designed based on Region 2 ( The sequences of primers and probes are shown in Table 19).

The above 10 sets of primer probe combinations were tested in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, and 25 cancer samples, including 4 squamous cell carcinomas and 21 adenocarcinomas. The test results are shown in Table 18. [Table 18] Test results in the organization

The results show that no matter how the primers and probes are designed in area 1, the detection sensitivity for area 1 can only reach 48%, and regardless of the primers and probes designed in the present disclosure, the detection sensitivity of area 2 can reach 56%. %, up to 80%. Therefore, the detection rate of area 2 is significantly higher than that of area 1 (see Table 18).

2. The influence of primers and probes on detection results

[表20] 在組織中的檢測結果

In addition to the detection area that will affect the detection effect, primers and probes also have a great impact on the detection effect of tumor markers. During the research process, the inventor designed multiple pairs of primers and their corresponding probes to find the best possible detection. Sensitive and specific probes and primers, so that the detection reagents of the present disclosure can be practically applied to clinical detection. Some of the primers and probes are shown in Table 19 below, and the test results are shown in Table 20. All primers and probes are synthesized by Invitech (Shanghai) Trading Co., Ltd. [Table 19] Primer and probe

[Table 20] Test results in the organization

In this disclosure, the primers and probes in Table 19 are used to verify the tissue samples. The above 10 sets of primer probe combinations were tested in 36 lung tissue samples, including 11 normal tissue samples, 25 cancer tissue samples, and 25 cancer samples, including 4 cases of squamous cell carcinoma and 21 cases of adenocarcinoma. The test results are shown in Table 20 above, and the results show that Group 1, Group 2, Group 4, Group 5, and Group 6 have good detection rates.

In order to further verify its detection rate in sputum, we selected 22 sputum samples and used the primers and probes in Table 19 for verification, including 7 normal controls, 15 lung cancer controls, and 15 lung cancers. There were 7 cases of squamous cell carcinoma, 7 cases of adenocarcinoma and 1 case of large cell carcinoma. The test results are shown in Table 21 below. [Table 21] Test results in sputum

The test results of 22 sputum samples showed that group 1: H7-F2, H7-R2, H7-P2 had the highest detection rate, reaching 73.3%.

Although the sensitivity of group 1 and group 5 can reach 80% in tissue samples, the sensitivity of group 5 for sputum testing samples has dropped significantly to 53.3%. This also confirms that for sputum samples, the design Detection reagents with high sensitivity are particularly difficult.

Finally, according to the detection results of each set of primer probes, the most preferred primer probe sequences are shown in Table 22 below. [Table 22] Optimized primer

no.

[Figure 1] ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in tissue samples; [Figure 2] ROC curves of HOXA7, SHOX2, PCDHGA12, HOXD8, and GATA3 detected in sputum samples; [Figure 3] ROC curve of HOXA7 and SHOX2_n3 detected in sputum samples; [Figure 4] Amplification curves of HOXA7 and SHOX2_n3 in sputum samples (A is the amplification image of HOXA7, and B is the amplification image of SHOX2_n3; [Figure 5] ROC curves detected by HOXA7 and SHOX2_n3 in all lavage fluid samples; [Figure 6] Amplification curves of HOXA7 and SHOX2_n3 in lavage fluid samples (A is the amplification image of HOXA7, and B is the amplification image of SHOX2_n3).

Claims (26)

A use of a nucleic acid fragment in preparing a lung cancer diagnostic reagent or kit, wherein the nucleic acid fragment is selected from the sequence shown in SEQ ID NO:24. A primer selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO : 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44. According to the primer described in claim 2, the primer is selected from the primer pair shown in SEQ ID NO:1 and SEQ ID NO:2. A nucleic acid probe selected from any of SEQ ID NO: 3, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, and SEQ ID NO: 45 A sequence shown. According to the nucleic acid probe according to claim 4, the nucleic acid probe is selected from the sequence shown in SEQ ID NO:3. The use of the primer or nucleic acid probe according to any one of Claims 2-5 in the preparation of a diagnostic reagent or kit for lung cancer. A diagnostic reagent for lung cancer, comprising a detection reagent for HOXA7 gene methylation, and the detection region of the reagent is selected from the sequence shown in SEQ ID NO: 24. According to the reagent according to claim 7, the test sample of the reagent includes sputum, lung lavage fluid, lung tissue, pleural fluid, blood, serum, plasma, urine, saliva, prostate fluid, tears or feces. According to the reagent according to claim 7, the test sample of the reagent contains sputum, lung tissue or lung lavage fluid. According to the reagent according to claim 7, the test sample of the reagent contains sputum. The reagent according to claim 7, wherein the HOXA7 gene methylation detection reagent detects the sequence of the HOXA7 gene modified by a conversion reagent. According to the reagent according to claim 11, the conversion reagent contains one or more of hydrazine salt, bisulfite and bisulfite. According to the reagent according to claim 11, the conversion reagent contains bisulfite. The reagent according to claim 7, further comprising an amplification primer; the amplification primer is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 31. SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, At least any one of SEQ ID NO:44. The reagent according to claim 7, further comprising an amplification primer; the amplification primer is selected from the primer pair shown in SEQ ID NO:1 and SEQ ID NO:2. The reagent according to claim 7, further comprising a probe; The probe is selected from any one of SEQ ID NO: 3, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 45 Show. The reagent according to claim 7, further comprising a probe; the probe is selected from the sequence shown in SEQ ID NO:3. The reagent according to claim 7, further comprising bisulfite, bisulfite or hydrazine salt. The reagent according to claim 7, further comprising ^{one or more of DNA polymerase, dNTPs, Mg 2+} ions and buffer. The reagent according to claim 7, further comprising DNA polymerase, dNTPs, Mg ²⁺ ions and buffer. The reagent according to claim 7, further comprising a detection reagent for a reference gene. According to the reagent according to claim 21, the reference gene comprises β-actin or COL2A1. According to the reagent according to claim 21, the detection reagent for the reference gene includes a primer and a probe for the reference gene. According to the reagent according to claim 23, the detection reagent for the reference gene β-actin comprises the primer pair shown in SEQ ID NO: 16 and SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18. According to the reagent according to claim 23, the detection reagent for the reference gene COL2A1 includes the primer pair shown in SEQ ID NO:55 and SEQ ID NO:56, and the probe shown in SEQ ID NO:57. A kit comprising the primer described in claim 2, or the probe described in claim 3, or the reagent described in any one of claims 7-25.

Images