TWI741418B - Multi-gene combined detection reagent - Google Patents

Abstract

This application belongs to the field of biomedicine, and particularly relates to methylation detection reagents, kits and uses thereof. In this application, by detecting the methylation level of the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes, colorectal cancer specimens can be distinguished from stool specimens. This application uses the methylation reagent methylation detection reagent containing the gene combination to detect colorectal cancer, and the detection sensitivity and specificity are as high as 90% or more.

Description

Multi-gene combined detection reagent

This application belongs to the field of biomedicine, and particularly relates to primers, capture reagents, nucleic acid probes, methylation detection reagents, kits and their uses.

Colorectal cancer, also known as colorectal cancer, is a common malignant tumor of the digestive tract. Its incidence is increasing year by year in China. In some coastal areas of China, such as Shanghai and Guangzhou, the incidence of colorectal cancer has jumped to the second place, second only to lung cancer. It is currently believed that the formation of bowel cancer is the result of accumulation of genetic defects and epigenetic defects. The early onset of colorectal cancer is hidden, often without obvious symptoms, and symptoms such as blood in the stool, abdominal pain, and diarrhea may appear in the late stage. When the symptoms appear, it is often in the late stage, which brings great pain and expensive treatment costs to the patient. Therefore, early detection, early diagnosis, and early treatment are important measures to reduce the incidence and mortality of colorectal cancer.

Screening can detect bowel cancer and precancerous lesions early, and remove the lesions, thereby preventing the occurrence of bowel cancer. The current screening methods for colorectal cancer mainly include occult blood test and colonoscopy. The occult blood test is vulnerable to food or the detection rate of adenoma is not high. Although colonoscopy is the gold standard for the diagnosis of bowel cancer, it is not highly adherent to the population when used as a screening method. Therefore, there is an urgent need for a colorectal cancer screening method with high accuracy and high compliance.

Fecal genetic testing, as a new screening method for bowel cancer, is now receiving more and more attention. This method (Cologuard ^® ) was included in the U.S. bowel cancer screening guidelines in 2016. This method is convenient, non-invasive, and has the characteristics of high detection rate for bowel cancer and precancerous adenomas. To make a high-performance stool gene detection kit for colorectal cancer detection, two major obstacles need to be overcome: stool DNA extraction and marker selection. On the one hand, the composition of feces is complex, there are many inhibitors to downstream reactions, and there are many bacterial DNA. To extract human target genes from such a mixture, a set of highly sensitive gene extraction and purification methods is required; on the other hand, There are many markers related to colorectal cancer, especially DNA methylation markers, because studies have shown that DNA methylation is an early event of tumor formation. However, many methylation markers perform well at the cell and tissue level. When used in screening media such as feces and blood, their sensitivity and specificity for colorectal cancer are reduced. For example, the vimentin gene is found in tissues. The sensitivity is 83%, which drops to 46% in stool specimens (J. Natl. Cancer Inst. 2005 Aug 3; 97(15):1124-32.).

In addition, because the pathogenesis of colorectal cancer is more complicated, it is a polygenic genetic disease. The existing methods for the detection of single methylation markers for colorectal cancer have the following two limitations: First, the existing research and product detection methods both detect a marker in a PCR reaction well, and the detection method cannot be implemented in a PCR. Multiple detection of methylation markers in reaction wells. Second, when the existing methylation markers for colorectal cancer detection, such as SDC2, ITAG4, Septin 9, etc., detect colorectal cancer by detecting the methylation level of a single gene, the sensitivity of the detection is limited by genetic factors. The detection sensitivity of methylated SDC2 gene is 84.2%, and the specificity is 97.9%; the detection sensitivity of methylated ITGA4 is 83.8%, and the specificity is 95.2%; the detection sensitivity of methylated Septin9 is 79.3%, and the specificity is 94.3%. The specificity of these single markers for colorectal cancer detection can reach more than 90%, but when the specificity reaches more than 90%, the sensitivity can not reach more than 90%.

Although a single methylation marker of colorectal cancer can detect part of colorectal cancer, it is necessary to combine colorectal cancer-related markers to detect as many colorectal cancer patients through molecular biology methods. However, the problem that needs to be faced is :1. The detection value of most colorectal cancer gene methylation markers for colorectal cancer shows overlap in performance, that is, the detection status of the same colorectal cancer patient sample is consistent in most methylation markers. Therefore, it is very difficult to screen gene methylation markers that can complement each other in colorectal cancer detection capabilities, and a lot of research work is required. In addition, the more gene methylation markers, the false positive phenomena of the detection system will also be superimposed, and the specificity of the detection will be reduced. Therefore, it is very difficult to improve the sensitivity of colorectal cancer detection under the premise of certain detection specificity. 2. It is necessary to balance detection cost, sensitivity and specificity.

Chinese patent application CN109207592A analyzed multiple markers to detect colorectal cancer models. Among them, the sensitivity of the combined detection of SEPT9, NDRG4, and SDC2 is only 88.6%, and the specificity is only 89.1%; KRAS, BMP3, NDRG4, SEPT9, and SDC2 are multiple models. In different combination detection models, the highest AUC value of the ROC curve is only 0.912, and to obtain this 0.912 AUC requires simultaneous joint detection of 5 genetic markers.

Therefore, selecting a combination of markers with extremely high sensitivity and specificity for colorectal cancer detection in the stool is the key to the detection of colorectal cancer stool, and such a combination of markers is expected to be truly used in the clinical detection of colorectal cancer, and it is a good primer, The design of capture sequences and probes is also one of the influencing factors that affect the function of the label combination.

The purpose of this application is a primer and its use in preparing reagents or kits for detecting colorectal tumors.

Another object of the present application is to provide a capture sequence and its use in preparing reagents or kits for detecting colorectal tumors.

Another object of the present application is to provide a probe and its use in preparing reagents or kits for detecting colorectal tumors.

Another objective of the present application is to provide a multi-gene methylation combined detection reagent, the genes are SDC2, COL4A1/COL4A2 and ITGA4.

Another object of the present application is to provide a colorectal tumor detection reagent and kit with strong specificity and high sensitivity.

The above purpose of this application is achieved through the following technical means:

This application provides a primer comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO : 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 , SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, at least any one of the sequence or its complementary sequence.

As a preferred embodiment of the present application, the primer includes SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID Any one of NO: 18, SEQ ID NO: 19, SEQ ID NO: 24, SEQ ID NO: 25.

As a preferred embodiment of the application, the primer includes SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID At least one primer pair shown in NO: 18 and SEQ ID NO: 19 and SEQ ID NO: 24 and SEQ ID NO: 25.

As a preferred embodiment of the present application, the primer includes SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 8, and SEQ ID NO: 11 and SEQ ID NO: 12 Introduction pair.

As a preferred embodiment of the present application, the primer includes SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 18 and SEQ ID NO: 19, and SEQ ID NO: 24 and SEQ ID NO: 25. Introduction pair.

On the other hand, the present application also provides a capture sequence, the capture reagent comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 10 or its complementary sequence shown in At least any one.

As a preferred embodiment of the present application, the capture sequence includes at least one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 10.

As a preferred embodiment of the present application, the capture sequence includes the sequences shown in SEQ ID NO: 1, SEQ ID NO: 6 and SEQ ID NO: 10.

As a preferred embodiment of the present application, the capture sequence includes the sequences shown in SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 10.

On the other hand, the present application also provides a nucleic acid probe, the nucleic acid probe comprising at least any one of the sequence shown in SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13 or its complementary sequence.

As a preferred embodiment of the present application, the nucleic acid probe includes at least one of SEQ ID NO: 5, SEQ ID NO: 9, and SEQ ID NO: 13.

As a preferred embodiment of the application, the nucleic acid probe comprises the sequences shown in SEQ ID NO: 5, SEQ ID NO: 9 and SEQ ID NO: 13.

On the other hand, this application also provides the use of the above primers or capture sequences or probes in the preparation of reagents or kits for detecting colorectal tumors.

On the other hand, this application also provides the use of the aforementioned primers or capture sequences or probes or reagents or kits in the detection of colorectal tumors.

On the other hand, this application also provides a methylation joint detection reagent for SDC2, COL4A1/COL4A2 and ITGA4 gene combination, including the capture sequence, primer and/ Or probe.

In some specific embodiments of the present application, capture sequences, primers and/or probes obtained from the CpG islands of each gene in the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes are included.

In some specific embodiments of this application, the methylation detection reagent provided in this application detects the genome, intergenic region or promoter region and promoter of each gene in the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes. The level of methylation in the area near the zone.

In some specific embodiments of the present application, the methylation detection reagent provided in the present application includes the promoter region of each gene in the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes or the CpG islands in the vicinity of the promoter region. Obtained capture sequences, primers and/or probes.

In some embodiments, SDC2, COL4A1/COL4A2, and ITGA4 can be detected for methylation levels, respectively. In other embodiments, SDC2, COL4A1/COL4A2, and ITGA4 can be simultaneously detected for methylation levels, such as using multiplex real-time fluorescent quantitative PCR to detect the methylation levels of multiple genes. In some aspects, it is more convenient for SDC2, COL4A1/COL4A2 and ITGA4 to be detected simultaneously by multiplex PCR.

"COL4A1/COL4A2" in this application refers to "COL4A1 or COL4A2". The human genes COL4A1 and COL4A2 are closely linked at the far end of the long arm of chromosome 13. These two genes are in a "head-to-head" positional relationship, and they are transcribed in opposite directions. The 5'ends of the COL4A1 and COL4A2 genes are close to each other with a gap of 127bp. This sequence is a bidirectional promoter region shared by the two genes [1]. Therefore, the sequence designed according to the bidirectional promoter shared by the two can target both COL4A1 and COL4A2. In this application, whether COL4A1 or COL4A2 is used to label sequence information, there is no difference between the two.

The "detection" in this application is the same as "diagnosis". In addition to the early diagnosis of colorectal tumors, it also includes the diagnosis of colorectal tumors in the middle and late stages, and also includes colorectal tumor screening, risk assessment, prognosis, disease identification, and disease stages. Selection of diagnostic and therapeutic targets.

The application of the colorectal tumor marker combination SDC2, COL4A1/COL4A2 and ITGA4 makes the early diagnosis of colorectal tumors possible. When it is determined that a gene that is methylated in a cancer cell is methylated in a cell that is clinically or morphologically normal, it indicates that the normal-looking cell is developing into cancer. In this way, colorectal cancer can be diagnosed at an early stage through the methylation of colorectal tumor-specific SDC2, COL4A1/COL4A2, and ITGA4 gene combinations in normal-appearing cells.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, preferably before the morphological changes of tissues or cells can be observed.

In addition to the early diagnosis of colorectal tumors, the reagents/kits of the present application are also expected to be used for colorectal tumor screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

As an alternative embodiment of the disease stage, the progression of colorectal tumors in different stages or periods can be diagnosed by measuring the methylation degree of the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes obtained from the sample. By comparing the methylation degree of SDC2, COL4A1/COL4A2, and ITGA4 gene combination of nucleic acids isolated from samples of each stage of colorectal cancer with one or one isolated from samples of intestinal tissue without abnormal cell proliferation The methylation degree of SDC2, COL4A1/COL4A2 and ITGA4 gene combination of multiple nucleic acids can detect the specific stage of colorectal tumor in the sample.

Generally speaking, CpG islands refer to regions rich in CpG dinucleotides, usually located in the promoter and its vicinity. The detection sites for methylation in this application include not only CpG islands, but also other regions such as A heterozygous methylated CpG site in the gene body or intergenic region, or an isolated CpG site.

The methylation joint detection reagent of the combination of SDC2, COL4A1/COL4A2 and ITGA4 genes may be a methylation detection reagent in the prior art. In the prior art, there are many methods to detect the methylation of the target gene, such as methylation-specific PCR (MSP), methylation-specific quantitative PCR (qMSP), and PCR for methylated DNA-specific binding proteins. Quantitative PCR and DNA chips, methylation-sensitive restriction endonucleases, bisulfite sequencing or pyrosequencing, etc. In addition, other methylation detection methods can be introduced through patent US62007687. Each detection method has its corresponding reagents, and these reagents can be used in this application to detect the methylation of SDC2, COL4A1/COL4A2 and ITGA4 gene combination.

In some specific embodiments of the present application, the primers and/or probes detect the methylation of each gene in the combination of SDC2, COL4A1/COL4A2 and ITGA4 through quantitative Methylation-Specific PCR (qMSP).

In some specific embodiments of the present application, the SDC2 gene capture sequence in the methylation combined detection reagent provided in the present application includes any one of the following nucleotide sequences: 1. The nucleotide sequence shown in any one of SEQ ID NO: 1 or 2; II. The complementary sequence of the sequence shown in I;

The capture sequence for the methylation detection of the COL4A1/COL4A2 gene includes any one of the following nucleotide sequences: III. The nucleotide sequence shown in SEQ ID NO: 6; IV. The complementary sequence of the sequence shown in III;

The capture sequence for the methylation detection of the ITGA4 gene includes any one of the nucleotide sequences shown below: V. The nucleotide sequence shown in SEQ ID NO: 10; VI. The complementary sequence of the sequence shown in V.

In some specific embodiments of the present application, the upstream primer in the primer for methylation detection of the SDC2 gene provided in the present application includes any one of the following nucleotide sequences: VII. The nucleotide sequence shown in SEQ ID NO: 3; VIII. The complementary sequence of the sequence shown in VII;

The downstream primer in the primer for methylation detection of the SDC2 gene contains any one of the following nucleotide sequences: IX, the nucleotide sequence shown in SEQ ID NO: 4; X. The complementary sequence of the sequence shown in IX;

The upstream primer in the primer for methylation detection of the COL4A1/COL4A2 gene contains any one of the following nucleotide sequences: XI, the nucleotide sequence shown in any one of SEQ ID NO: 7 or SEQ ID NO: 18; XII. The complementary sequence of the sequence shown in XI;

The downstream primer in the primer for methylation detection of the COL4A1/COL4A2 gene contains any one of the following nucleotide sequences: The nucleotide sequence shown in any one of XIII, SEQ ID NO: 8 or SEQ ID NO: 19; XIV, the complementary sequence of the sequence shown in XIII;

In some specific embodiments of the present application, the primer pair for methylation detection of the COL4A1/COL4A2 gene is shown in SEQ ID NO: 7 and SEQ ID NO: 8;

In some specific embodiments of the present application, the primer pair for methylation detection of the COL4A1/COL4A2 gene is shown in SEQ ID NO: 18 and SEQ ID NO: 19;

The upstream primer in the primer for methylation detection of ITGA4 gene contains any one of the following nucleotide sequences: XV, the nucleotide sequence shown in any one of SEQ ID NO: 11 or SEQ ID NO: 24; XVI, the complementary sequence of the sequence shown in XV;

The downstream primer in the primer for methylation detection of ITGA4 gene contains any one of the following nucleotide sequences: The nucleotide sequence shown in any one of XVII, SEQ ID NO: 12 or SEQ ID NO: 25; XVIII, the complementary sequence of the sequence shown in XVII;

In some specific embodiments of the present application, the primer pair for methylation detection of the ITGA4 gene is shown in SEQ ID NO: 11 and SEQ ID NO: 12;

In some specific embodiments of the present application, the primer pair for methylation detection of the ITGA4 gene is shown in SEQ ID NO: 24 and SEQ ID NO: 25;

In some specific embodiments of this application, the probe for methylation detection of the SDC2 gene in the methylation detection reagent provided in this application contains any one of the following nucleotide sequences: XIX, the nucleotide sequence shown in SEQ ID NO: 5; XX, the complementary sequence of the sequence shown in XIX;

The COL4A1/COL4A2 gene methylation detection probe contains any one of the following nucleotide sequences: XXI, the nucleotide sequence shown in SEQ ID NO: 9; XXII, the complementary sequence of the sequence shown in XXI;

The ITGA4 gene methylation detection probe contains any one of the following nucleotide sequences: XXIII, the nucleotide sequence shown in SEQ ID NO: 13; XXIV, the complementary sequence of the sequence shown in XXIII.

In some embodiments, the nucleic acid probe further includes a label such as one or more of radioisotopes, fluorescent groups, bioluminescent compounds, chemiluminescent compounds, metal chelates, and enzymes.

In some embodiments, the label of the probe is a fluorescent group, and these fluorescent groups include but are not limited to one or more of VIC, ROX, FAM, Cy5, HEX, TET, JOE, NED, Texas Red and the like.

In some embodiments, the probes of the SDC2, COL4A1/COL4A2, and ITGA4 genes are labeled with the same fluorescent group, so that the sum of the methylation levels of these genes can be easily detected through a fluorescent channel, There is no need to detect each gene with a different fluorescent channel, which reduces the complexity of the experiment.

The application also provides a kit for detecting tumors, including the methylation detection reagent.

In some specific embodiments of the present application, the kit provided by the present application includes: a first container, which contains a capture reagent; a second container, which contains a primer pair for amplification; and a third container, which contains a probe.

In some specific embodiments of the present application, the kit provided in the present application also includes the commonly used reagents in the kit, such as a commonly used conversion agent in qMSP, which is used to convert all unmethylated cytosine groups into uracil, The methylated cytosine group remains unchanged. The conversion agent is not particularly limited. The reagents reported in the prior art that can convert cytosine to uracil can be used, such as hydrazine salt, bisulfite and bisulfite (such as sodium metabisulfite, sulfurous acid). One or more of potassium hydrogen, cesium hydrogen sulfite, ammonium hydrogen sulfite, etc.). Another example is DNA polymerases, dNTPs, Mg²⁺ ions and buffers commonly used in the amplification of the COL4A1 gene.

In some specific embodiments, the kit includes: a first container, which contains a capture reagent; a second container, which contains a primer pair for amplification; and a third container, which contains a probe. The fourth container contains a conversion reagent for converting unmethylated cytosine.

In some specific embodiments, the kit further includes instructions.

In some specific embodiments, the kit further includes a nucleic acid extraction reagent.

In some specific embodiments, the kit further includes a sampling device.

This application also provides the methylation detection reagents, kits, capture sequences, primers and/or probes in the preparation of methylation detection reagents or kits, or preparation of reagents or kits for detecting colorectal tumors. use.

The application also provides the use of the above-mentioned methylation detection reagents, kits, capture sequences, primers and/or probes in methylation detection, or in the detection of colorectal tumors.

This application also provides a tumor detection system, which includes the following components: (1) SDC2, COL4A1/COL4A2 and ITGA4 gene methylation joint detection components: (2) Data processing components; (3) Result output component;

In some specific embodiments of the present application, the methylation detection component contains a methylation detection instrument;

In some specific embodiments of the present application, the methylation detection component further contains one or more of the methylation detection reagents, kits, capture sequences, primers, and probes.

In some specific embodiments of the present application, the methylation detection instrument includes one or more of a fluorescent quantitative PCR machine, a PCR machine, and a sequencer.

In some specific embodiments of the present application, the data processing component includes a data processing machine.

The data processing machine includes any equipment or instrument or device that can perform data processing that can be used by those skilled in the art.

In some specific embodiments of the present application, the data processing machine includes one or more of a calculator and a computer.

The computer is loaded with any software or program that can be used by those skilled in the art that can perform data processing or statistical analysis.

In some specific implementations of the present application, the computer includes a computer loaded with one or more software of SPSS, SAS, and Excel.

In some specific embodiments of the present application, the result output member includes a result output device.

The output device includes any equipment or instrument or device that can display the data processing result as readable content.

In some specific implementations of the present application, the result output device includes one or more of a screen and a paper report.

In some specific implementations of the present application, the data processor is configured to a. receive test data of the test sample and the normal control sample; b. store the test data of the test sample and the normal control sample; c. compare Test data of the same type of test sample and normal control sample; d. According to the comparison result, respond to the probability or possibility of the subject suffering from a tumor.

In some specific embodiments of the present application, the result output component is used to output the probability or possibility that the subject has a tumor.

This application also provides a method for diagnosing colorectal tumors, which includes the following steps: (1) Detect the methylation level of the SDC2, COL4A1/COL4A2 and ITGA4 genes in the test sample from the subject; (2) Compare the methylation levels of SDC2, COL4A1/COL4A2 and ITGA4 genes between the sample to be tested and the normal control sample; (3) Diagnose colorectal tumors based on the deviation of the methylation level of the test sample and the normal control sample.

The diagnostic method of the present application can be used before and after the treatment of colorectal tumors or in combination with the treatment of lung cancer. After treatment, such as evaluating the success of the treatment or monitoring the remission, recurrence and/or progress (including metastasis) of the colorectal tumor after treatment.

Another aspect of the present application provides a method for the treatment of colorectal tumors, the method comprising administering surgery, chemotherapy, radiotherapy, radiotherapy and chemotherapy, immunotherapy, oncolytic virus therapy, or other Any other types of colorectal tumor treatment methods used in the art and combinations of these treatment methods.

In some specific embodiments of the present application, the data processing component in the tumor detection system, or the judgment standard of the colorectal tumor diagnosis method is: according to the boundary of the Ct value of methylation-specific quantitative PCR (qMSP) Value to judge tumor specimens and normal specimens.

In some specific embodiments of the present application, the cutoff value of the Ct value is 36-39.

In some specific embodiments of the present application, the cutoff value of the Ct value is 38.

In some specific embodiments of the present application, the aforementioned Ct value threshold is 36-39 or 38, and the sample targeted is a stool sample.

In some specific implementations of the present application, when the Ct value of the sample to be tested is less than the threshold of the Ct value, it is determined as a tumor sample, and when the Ct value of the sample to be tested is greater than or equal to the threshold of the Ct value The value is judged to be a normal sample.

In some specific embodiments of the present application, the tumor described in the present application is a colorectal tumor.

In some specific embodiments of the present application, the tumor described in the present application is colorectal cancer or adenoma.

In some specific embodiments of this application, the sample or sample type targeted by this application includes tissue, body fluid, or excrement.

In some specific embodiments of the present application, the tissue described in the present application includes intestinal tissue.

In some specific embodiments of the present application, the body fluid described in the present application includes blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid, or aqueous humor.

In some specific embodiments of the application, the excrement comprises sputum, urine, saliva or feces.

In some specific embodiments of the application, the excrement comprises feces.

This application has discovered through research that in some specific embodiments, the methylation level of the promoter region of each gene in the SDC2, COL4A1/COL4A2, and ITGA4 gene combination can be detected through the primers, capture reagents, and nucleic acid probes. It is a good way to distinguish colorectal cancer specimens from stool specimens. And the detection sensitivity and specificity for bowel cancer are extremely high.

Compared with the existing markers for the detection of colorectal cancer, the primers, capture reagents, nucleic acid probes, and SDC2, COL4A1/COL4A2 and ITGA4 gene combinations and technical solutions provided by this application can detect colorectal with extremely high sensitivity and specificity. Cancer, the detection sensitivity and specificity of the technical solution of this application for colorectal cancer are both higher than 90%. The specific points are as follows:

1. A technical solution of this application performs joint detection of methylation of SDC2, COL4A1/COL4A2 and ITGA4 gene combination. This method can realize joint detection of multiple genes, greatly reducing the complexity of the test and improving the detection efficiency .

2. In the above-mentioned another technical solution, the methylation detection reagent of the combination of SDC2, COL4A1/COL4A2 and ITGA4 gene can detect 91.36% of colorectal cancer with a specificity of 95.28% in stool specimens, which can be easily Stool is used as a test sample to make a reliable diagnosis of colorectal cancer. The stool sample is very easy to obtain, the sampling is non-invasive and simple, and it will not cause any pain and inconvenience to the patient.

3. The methylation detection reagent containing the combination of SDC2, COL4A1/COL4A2 and ITGA4 gene in the above-mentioned another technical solution. The extraction detection method can easily and accurately determine colorectal cancer and normal people. The methylation of this gene combination Chemical testing reagents are expected to be used in stool genetic testing kits and serve the clinical testing of bowel cancer.

4. The reagent/kit in the other technical solution mentioned above is to detect and diagnose cancer through the level of methylation. More and more studies have confirmed that methylation changes are an early event in the process of tumorigenesis, and methylation is detected. Abnormalities are easier to find early lesions.

The technical solutions of the present application are further described below through specific embodiments, and the specific embodiments do not represent a limitation on the protection scope of the present application. Some non-essential modifications and adjustments made by others based on the concept of this application still belong to the scope of protection of this application.

The "capture sequence", "primer" or "probe" in the present application refers to an oligonucleotide that includes a region complementary to a sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (for example, a target gene). In some embodiments, at least a portion of the sequence of the primer or probe is not complementary to the amplified sequence. In some embodiments, the primer or probe contains at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 relative to the target molecule. A region where the sequence of consecutive nucleotides is complementary. When a primer or probe contains a region "complementary to at least x consecutive nucleotides of the target molecule", the primer or probe is at least 95% of at least x consecutive or discontinuous block nucleotides of the target molecule Complementary. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

In this application, "normal" samples refer to samples of the same type isolated from individuals who are known to be free of the cancer or tumor.

In this application, the "subject" is a mammal, such as a human.

The samples for methylation detection in this application include but are not limited to DNA, or RNA, or DNA and RNA samples containing mRNA, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

In this application, "methylation level" and "methylation degree" can usually be expressed as the percentage of methylated cytosine, which is the number of methylated cytosine divided by the number of methylated cytosine and the amount of unmethylated cytosine. The sum of the number of methylated cytosines; and the current general method of dividing the number of methylation target genes by the number of internal reference genes to express the methylation level; and other methods of expressing the methylation level in the prior art.

In this application, "sample" is the same as "specimen". Example 1

According to Table 1, design SDC2 three pairs of primers to study the specificity of amplification. [Table 1] Introduction to SDC2 Gene Cited subname Sequence information SDC2 S0 SEQ ID NO.3 FP GAGGAAGCGAGCGTTTTC SEQ ID NO.4 RP AAAATACCGCAACGATTACGA S1 SEQ ID NO.14 FP GTAGGAGGAGGAAGCGAGCGTTTTC SEQ ID NO.15 RP CGCAACGATTACGACTCAAACTCGA S2 SEQ ID NO.16 FP CGGGGCGTAGTTGCGGGCGGC SEQ ID NO.17 RP CGCTCGACGCAACCCGCG

The above three pairs of primers were used to detect the DNA of two stool samples from colorectal cancer patients and the DNA from two normal human stool samples to analyze the specificity of amplification.

The amplification curve of SDC2 amplified by 3 pairs of primers is shown in Figure 1-3.

The results show that the SDC2 primer has good amplification specificity for S0; while the amplification curves of the other two pairs of primers have little difference between negative and positive samples, which can not effectively distinguish between negative and positive samples. Example 2

According to Table 2, three pairs of COL4A1/COL4A2 primers were designed to study the specificity of amplification. [Table 2] Introduction of COL4A1/COL4A2 Gene Primer name Sequence information COL4A1/ COL4A2 C0 SEQ ID NO.7 FP AGAGAGTTTAGTAAGGTCGGGC SEQ ID NO.8 RP GACTTCAAAAACTACTACCCG C1 SEQ ID NO.18 FP AGAGAGTTTAGTAAGGTCGGAC SEQ ID NO.19 RP GACTTCAAAAACTACTACCCG C2 SEQ ID NO.20 FP AGAGAGTTTAGTAAGGTCGGGC SEQ ID NO.21 RP TTAGGGTTTGGGCGTCGTTCG

The above three pairs of primers were used to detect the DNA of the stool samples of 3 patients with colorectal cancer and the DNA of 3 normal human stool samples to analyze the specificity of amplification.

The amplification curve of COL4A1/COL4A2 amplified by 3 pairs of primers is shown in Figure 4-6.

The results showed that the COL4A1/COL4A2 primer had better amplification specificity for C0 and C1; while the primer pair C2 did not amplify COL4A1/COL4A2. Example 3

According to Table 3, design three pairs of ITGA4 primers to study the specificity of amplification. [Table 3] Introduction to ITGA4 Gene Primer name Sequence information ITGA4 I0 SEQ ID NO.11 FP ACGCGAGTTTTGCGTAGAC SEQ ID NO.12 RP GCTAAATAAAATCCCGAACG I1 SEQ ID NO.22 FP ACGCGAGTCCTGCGCAGCC SEQ ID NO.23 RP GCTAAATAAAATCCCGAACG I2 SEQ ID NO.24 FP ACGCGAGTTTTGCGTAGTC SEQ ID NO.25 RP GCTAAATAAAATCCCGAACG

The above three pairs of primers were used to detect the DNA of the stool samples of 3 patients with colorectal cancer and the DNA of 3 normal human stool samples to analyze the specificity of amplification.

The amplification curve of ITGA4 amplified by 3 pairs of primers is shown in Figure 7-9.

The results show that the ITGA4 primer has good amplification specificity for I0 and I2; while the amplification curve of primer pair I1 has a small difference between negative and positive samples, which can not effectively distinguish between negative and positive samples. Example 4

935 stool specimens (359 cases of colorectal cancer, 67 cases of adenoma (≥1 cm), 509 cases of non-tumor individuals, all confirmed by colonoscopy or pathology) were selected for grinding and centrifugation, and 50 µL capture magnetic beads (containing SDC2 , COL4A2, ITGA4 and the capture sequence of the internal reference gene ACTB), and operate according to the technical scheme described below,

The technical solutions are as follows:

1) Collect stool specimens of normal people and colorectal tumor patients with colonoscopy pathology results, mix and grind 1g stool: 4mL protective solution, centrifuge at 5000 rpm for 10 min, take the supernatant and discard the precipitate;

2) Take out 10 mL of the supernatant and centrifuge again, take 3.2 mL of the supernatant, add 2 mL of lysate and 50 µL of capture magnetic beads M1, incubate at 95°C for 15 min, and then leave it at room temperature for 30 min;

3) Put a portion of the supernatant on a magnetic stand, wash the magnetic beads and transfer to a 2 mL centrifuge tube, add 800 µL washing solution W1, incubate at 1300 rpm at room temperature for 1 min, place on the magnetic stand to aspirate the supernatant, repeat 2 Second-rate;

4) Add 50 µL of eluent, incubate at 1300 rpm at room temperature for 5 minutes, place it on a magnetic stand, and transfer the eluent to a new EP tube within 3 minutes;

5) Use EZ DNA Methylation Kit (Zymo Research) to methylate the DNA fragments in the previous step according to the method in Reference [2], and the final eluate 20 µL is used for qMSP detection.

Finally, 20 µL of Bisulfite-transformed DNA was obtained. Then perform qMSP detection, and finally determine the methylation level of the SDC2, COL4A1/COL4A2 and ITG4 gene combination in the specimen according to the CT value.

The qMSP reaction system of this example: 30 µL (nuclease-free water 2.98 µL, 5×Colorless GoTaq Flexi Buffer 6 µL, MgCl₂ (25 mM) 5 µL, dNTPs (10 mM) 1 µL, GoTaq Hot Start polymerase 0.6 µL, ACTB -FP (100 µM) 0.08 µL, ACTB-RP (100 µM) 0.08 µL, ACTB-Probe (100 µM) 0.06 µL, SDC2-FP (100 µM) 0.12 µL, SDC2-RP (100 µM) 0.12 µL, SDC2 -Probe (100 µM) 0.04 µL, COL4A2-FP (100 µM) 0.06 µL, COL4A2-RP (100 µM) 0.06 µL, COL4A2-Probe (100 µM) 0.04 µL, ITGA4-FP (100 µM) 0.06 µL, ITGA4 -RP (100 µM) 0.06 µL, ITGA4-Probe (100 µM) 0.04 µL, DNA 10 µL). Reaction program: 95 °C 5 min, (95 °C 15 s, 58 °C 30 s, 72 °C 30 s) × 48 Cycles, 40 °C 30 s.

The capture and PCR reaction uses ACTB as the internal reference gene, and finally judges the methylation level in the specimen according to the CT value. The target gene is judged as positive with a CT value ≦38, and it is judged as negative with a CT value> 38.

Because the 5'ends of the COL4A1 and COL4A2 genes are close to each other, they are separated by 127bp, which is a shared bidirectional promoter region. The methylation region detected in this example is the bidirectional promoter region of the COL4A1 and COL4A2 genes. Therefore, in this embodiment, the gene direction of COL4A2 of the two genes is selected to annotate sequence information.

The methylation sites of SDC2, COL4A1/COL4A2 and ITGA4 genes are mainly located in the promoter region or nearby CpG islands.

In this example, the same fluorescent group is used to label the PCR probes of SDC2, COL4A2 and ITGA4, so the sum of the methylation levels of these genes can be easily detected through a fluorescent channel, without the need for each Each gene is detected by different fluorescent channels, which reduces the complexity of the experiment.

The capture sequence and primer probe of this embodiment are as follows:

SDC2 capture sequence 1: SEQ ID NO. 1: 5’-AGCCCGCGCACACGAATCCGGAGCAGAGTACCG-3’ or

SDC2 capture sequence 2: SEQ ID NO. 2: 5’-CTCCTGCCCAGCGCTCGGCGCAGCCCGC-3’

SDC2 qMSP primer probe: SEQ ID NO.3: SDC2-FP: 5’-GAGGAAGCGAGCGTTTTC-3’ SEQ ID NO.4: SDC2-RP: 5’-AAAATACCGCAACGATTACGA-3’ SEQ ID NO.5: SDC2-Probe: 5’-AGTTTCGAGTTCGAGTTTTCGAGTTTG-3’

Capture sequence of COL4A1/COL4A2: SEQ ID NO. 6: 5’-GCTGCTGCCCGAACGCATTGGCCCTTCCAGAAGCA-3’

QMSP primer probe for COL4A1/COL4A2: SEQ ID NO.7: COL4A1/COL4A2-FP: 5’-AGAGAGTTTAGTAAGGTCGGGC-3’ SEQ ID NO.8: COL4A1/COL4A2-RP: 5’-GACTTCAAAAACTACTACCCG-3’ SEQ ID NO.9: COL4A1/COL4A2-Probe: 5’-TGTCGGTGTGTCGTCGGC-3’

The capture sequence of ITGA4: SEQ ID NO.10: 5’-CTACGCGCGGCTGCAGGGGGCGCTGGGGAACCT-3’

The qMSP primer probe of ITGA4: SEQ ID NO.11: ITGA4-FP: 5’-ACGCGAGTTTTGCGTAGAC-3’ SEQ ID NO.12: ITGA4-RP: 5’-GCTAAATAAAATCCCGAACG-3’ SEQ ID NO.13: ITGA4-Probe: 5’-ACGGAGTTCGGTTTTGCGTTTTC-3’

Based on the results of these 935 stool specimens, the ROC curve for the detection of colorectal cancer and adenomas using the IBM SPSS statistics 20 software was drawn, as shown in Figure 9.

The results showed that the combined detection of SDC2, COL4A1/COL4A2 and ITG4 gene methylation has a sensitivity of 91.36% for colorectal cancer and a sensitivity of 50.75% for adenoma when the specificity is 95.28%; SDC2, COL4A1/COL4A2 and The combined detection of ITG4 gene methylation showed that the area under the ROC curve for colorectal cancer was 0.979, with a 95% CI of 0.970 to 0.988, and the area under the ROC curve for adenoma was 0.832, and the 95% CI was 0.771 to 0.894. Example 5

Select 23 patients diagnosed with colorectal cancer, collect the stool specimens of the patients before and 3-6 months after the operation, and use the marker combination (SDC2, COL4A1/COL4A2 and ITGA4) of this application to detect the preoperative and postoperative A total of 46 stool samples were used to compare the methylation levels of the marker combination in the feces before and after surgery.

The detection process and result judgment standard of the label combination are the same as in Example 4. Target gene CT value ≦ 38 is judged as positive, CT value> 38 is judged as negative. The result is shown in Figure 10.

The results showed that the test results of these 23 patients with colorectal cancer were all positive before the operation, and the stool specimens were tested again after the operation, and the results were all negative. It shows that the methylation level of the marker combination is significantly reduced after the tumor is surgically removed, indicating that the marker combination can be used for postoperative follow-up monitoring of patients with colorectal cancer. Comparative example 1

The study found that the detection of methylated SOX21 gene in feces can be used for the auxiliary diagnosis of colorectal cancer. Now, methylated SOX21 is used to detect colorectal cancer in feces as a comparative example. The following is the procedure and results of detecting SOX21 gene in feces.

Select 240 stool specimens (80 cases of colorectal cancer, 77 cases of adenomas ≥1 cm, 83 cases of normal, all confirmed by colonoscopy or pathology), grinding and centrifugation, adding 50 µL capture magnetic beads (containing SOX21 and internal reference gene ACTB) Capture sequence of ), and operate according to the "technical solution" described in Example 4, and finally obtain 20 µL of Bisulfite-transformed DNA. Then perform qMSP detection, and finally determine the SOX21 methylation level in the specimen according to the CT value.

The capture sequence, primer probes, and qMSP reaction system and procedures contained in the reagents can be found in reference [2]. Based on the results of 240 stool specimens, the ROC curve of SOX21 gene detection for colorectal cancer and adenoma was drawn, as shown in Figure 11.

The results showed that when the specificity of methylated SOX21 was 97.6%, the sensitivity to colorectal cancer was 80%, and the sensitivity to adenoma was 33.8%; the area under the ROC curve for SOX21 detection of colorectal cancer was 0.926, 95% The CI ranged from 0.885 to 0.968, the area under the ROC curve for detecting adenoma was 0.667, and the 95% CI ranged from 0.583 to 0.751. Comparative example 2

Selected 161 stool specimens (79 cases of colorectal cancer, 82 cases were normal, all confirmed by colonoscopy or pathology), milled and centrifuged, and added 50 µL capture magnetic beads (containing SOX21, SDC2 and internal reference gene ACTB capture sequence), and Operate according to the "technical solution" described in Example 4, and finally obtain 20 µL of Bisulfite-transformed DNA. Then perform qMSP detection, and finally determine the methylation level of SOX21 and SDC2 in the specimen according to the CT value.

The capture sequence, primer probe, and qMSP reaction system and procedures of SOX21 were the same as those in Comparative Example 1; the capture sequence, primer probe, and qMSP reaction system and procedures of SDC2 were the same as those in Example 4.

The test results showed that the sensitivity of methylated SDC2 gene detection was 88.6%, the specificity was 93.9%; the area under the curve was 0.939. The sensitivity of methylated SOX21 gene detection was 79.7%, the specificity was 86.6%; the area under the curve was 0.924. The detection sensitivity of methylated SOX21 gene and methylated SDC2 gene combination was 87.34%, and the specificity was 93.9%. The detection sensitivity of the combined detection of methylated SDC2 gene and methylated SOX21 gene is lower than the detection sensitivity of methylated SDC2 gene alone as a colorectal cancer marker, and also lower than the methylation of SDC2, COL4A1/COL4A2 and ITG4 of the application The sensitivity of chemical combined detection. Comparative example 3

Selected 109 stool samples (61 cases of colorectal cancer, 48 cases were normal, all confirmed by colonoscopy or pathology), milled and centrifuged, and added 50 µL capture magnetic beads (containing the capture sequence of ITGA4, COL4A1/COL4A2 and internal reference gene ACTB)

The capture sequences of ITGA4, COL4A1/COL4A2, primer probes, and qMSP reaction system and procedures are the same as in Example 4.

Based on the results of these 109 stool specimens, the ROC curve of the marker combination for colorectal cancer detection was drawn, as shown in Figure 12.

The results showed that the area under the curve distinguishing colorectal cancer from normal samples was 0.964. When the positive judgment Ct value is 38, the sensitivity of methylated ITGA4+ COL4A1/COL4A2 gene for colorectal cancer detection is 86.89%, and the specificity is 91.67%. Its sensitivity and specificity are lower than the sensitivity and specificity of the combined detection of SDC2, COL4A1/COL4A2 and ITG4 gene methylation in this application.

The above are only the preferred embodiments of this application. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of this application, several improvements and modifications can be made, and these improvements and modifications are also Should be regarded as the scope of protection of this application.

references: 1. Fischer G, Schmidt, Cornelia, et al. Identification of a novel sequence element in the common promoter region of human collagen type IV genes, involved in the regulation of divergent transcription. Biochem. J. 1993 292: 687-695. 2. Niu F, Wen J, Fu X, et al. Stool DNA Test of Methylated Syndecan-2 for the Early Detection of Colorectal Neoplasia. Cancer Epidemiol Biomarkers Prev 2017;26:1411-1419. 3. Liu Xianglin, Wen Jialing, Niu Feng, et al. Application value of detection of SOX21 gene methylation in feces in the diagnosis of colorectal cancer[J]. Chinese Journal of Cancer Prevention and Treatment,2018(24):1710-1715.

without.

Figure 1 is the amplification curve of the primer pair S0 in Example 1; Figure 2 is the amplification curve of the primer pair S0 in Example 1; Figure 3 is the amplification curve of the primer pair S0 in Example 1; Figure 4 is the amplification curve of the primer pair C0 in Example 2; Figure 5 is the amplification curve of the primer pair C1 in Example 2; Figure 6 is the amplification curve of primer pair C2 in Example 2; Figure 7 is the amplification curve of the primer pair I0 in Example 3; Figure 8 is the amplification curve of the primer pair I1 in Example 3; Figure 9 is the amplification curve of the primer pair I0 in Example 3; Figure 10 shows the ROC curve of 935 stool specimens in Example 4 for the combined detection of SDC2, COL4A1/COL4A2 and ITG4 genes for colorectal cancer and adenoma (≥1 cm); Figure 11 shows the detection results of 23 cases of colorectal cancer patients with pre- and post-operative stool samples using the method of combined detection of SDC2, COL4A1/COL4A2 and ITG4 genes in Example 5; Figure 12 shows the ROC curve of 240 stool specimens in Comparative Example 1, SOX21 gene detection for colorectal cancer and adenoma; Figure 13 shows the ROC curve of colorectal cancer in 109 stool specimens in Comparative Example 2. ITGA4, COL4A1/COL4A2 gene combined detection of colorectal cancer.

Claims (22)

A primer pair combination, which has the primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 7 and SEQ ID NO: 8; and SEQ ID NO: 11 and SEQ ID NO: 12; Or have SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 18 and SEQ ID NO: 19; and SEQ ID NO: 24 and SEQ ID NO: 25, as shown in the primer pair. A multi-gene methylation combined detection reagent, including SDC2, COL4A1/COL4A2 and ITGA4 gene methylation detection reagent, including primer pairs for SDC2, COL4A1/COL4A2 and ITGA4 genes; wherein the primer pair has SEQ ID NO : 3 and SEQ ID NO: 4; SEQ ID NO: 7 and SEQ ID NO: 8; and SEQ ID NO: 11 and SEQ ID NO: 12, as shown in the primer pair; or with SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 18 and SEQ ID NO: 19; and SEQ ID NO: 24 and SEQ ID NO: 25, as shown in the primer pair; wherein the multi-gene methylation joint detection reagent further includes SDC2 Capture sequences and/or probes for COL4A1/COL4A2 and ITGA4 genes. The multi-gene methylation combined detection reagent according to claim 2, wherein the capture sequence has the sequence shown in SEQ ID NO: 1, SEQ ID NO: 6 and SEQ ID NO: 10; or SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 10. The multi-gene methylation combined detection reagent according to claim 2, wherein the probe has the sequence shown in SEQ ID NO: 5, SEQ ID NO: 9 and SEQ ID NO: 13. A kit containing the primer pair combination described in claim 1. A kit containing the reagent described in any one of Claims 2-4. The kit according to claim 5 or 6, the kit comprising: a first container, which contains a capture reagent; a second container, which contains a primer pair for amplification; and a third container, which contains a probe. The use of the primer pair combination described in claim 1 in the preparation of a reagent or kit for methylation detection. The use of the reagent described in any one of Claims 2-4 in the preparation of a reagent or kit for methylation detection. The use of the primer pair combination described in claim 1 in the preparation of reagents or kits for detecting colorectal tumors. The use of any one of the reagents described in Claims 2-4 in the preparation of reagents or kits for detecting colorectal tumors. The use of the primer pair combination in methylation detection as described in claim 1. The use of the reagent described in any one of claims 2-4 in methylation detection. The use of the kit described in claim 5 or 6 in methylation detection. The use of the primer pair combination in the detection of colorectal tumors as described in claim 1. The use of the reagent described in any one of claims 2-4 in the detection of colorectal tumors. Use of the kit according to claim 5 or 6 in detecting colorectal tumors. The use according to claim 10 or 15, wherein the colorectal tumor is colorectal cancer or adenoma. The use according to claim 11, wherein the colorectal tumor is colorectal cancer or adenoma. The use according to claim 16, wherein the colorectal tumor is colorectal cancer or adenoma. The use according to claim 17, wherein the colorectal tumor is colorectal cancer or adenoma. The use according to any one of claim 8, 10, 12, or 15, wherein the sample to be tested for the test is feces.

Images