CN112575084A

CN112575084A - Methylation detection kit for evaluating benign and malignant lung nodules based on algorithm and application

Info

Publication number: CN112575084A
Application number: CN202011531425.7A
Authority: CN
Inventors: 韦玉军; 朱丽君; 刘文干; 桂林; 王娟; 朱丹萍; 李成俊; 付丽娜
Original assignee: Anhui Anlong Gene Technology Co ltd
Current assignee: Anhui Anlong Gene Technology Co ltd
Priority date: 2020-12-23
Filing date: 2020-12-23
Publication date: 2021-03-30

Abstract

The invention discloses a high-sensitivity methylation detection kit for evaluating the benign and malignant lung nodules and application thereof, and belongs to the technical field of gene detection. The kit comprises a detection reagent for specifically detecting DNA methylation of human SHOX2 and PTGER4 genes, and after Ct values of the human SHOX2 and PTGER4 methylated genes are detected, the benign and malignant lung nodules are evaluated by an algorithm. In particular, the invention also provides specific capture sequences for enhancing recovery of target DNA after bisulfite treatment. By combining a multi-gene joint algorithm, the positive detection rate and specificity of methylation detection can be remarkably improved, the detection sensitivity of the biomarker is improved to a picogram/nanogram DNA molecule, the accuracy of evaluating the benign and malignant lung nodules is improved, and the accuracy of early lung cancer detection is further improved.

Description

Methylation detection kit for evaluating benign and malignant lung nodules based on algorithm and application

Technical Field

The invention belongs to the technical field of gene detection, particularly relates to a gene methylation detection technology, and particularly relates to a methylation detection kit for evaluating the benign and malignant lung nodules based on a joint algorithm and application thereof.

Background

The lung cancer is a malignant tumor with the fastest incidence rate increase in 30 years in China, and the first death cause review survey data of China developed in the middle of 70 years in the 20 th century shows that the death rate of lung cancer in China occupies the 5 th death cause of cancer, and accounts for 7.43 percent of all cancer deaths; the second cause of death sampling survey result in China shows that the lung cancer death rate has already resided in the 3 rd cause of death of cancer in the 90 th year of the 20 th century; the third review of the causes of death conducted in the 21 st century showed that lung cancer was the first cause of death for cancer. According to the latest Chinese cancer data published by the national cancer center in 2017 in 2 months, the incidence and mortality of lung cancer are the first two rates (the lung cancer mortality in large, medium and small cities is between 40% and 54%), which are about one time of the second two rates of other cancers, and the mortality is high, which is the first cancer in 2017. A report issued by 2018 of the international agency for research on cancer (IARC) of the World Health Organization (WHO) indicates that lung cancer is the most common malignancy in china, with up to 78 and 65 million cases of new onset and death. Clinical data show that 5-year overall survival rates for stage I-II lung cancer patients range from 30-49%, while 1-14% during and after stage III. However, the overall 5-year survival rate is only about 10% for patients with advanced lung cancer at clinical outcome and stage IV lung cancer, relative to early stage lung cancer patients. Therefore, the early detection and timely treatment have important influence on the prognosis and survival time of lung cancer patients, but the current clinical reality is that 75% of lung cancer patients in China are diagnosed in an advanced stage, and the 5-year survival rate is about 16.1%.

The existing lung cancer screening and diagnosing method mainly depends on low-dose spiral CT and chest X-ray image data, and auxiliary diagnosing methods comprise fiber bronchoscopy, sputum cytology screening, tumor marker detection and the like. The low-dose spiral CT has some limitations as the lung cancer screening, such as low detectable rate of central lung cancer, and anxiety and psychological burden of a subject caused by false positive rate; the chest X-ray image has low resolution, and easily omits the lesions at the overlapped parts of the heart, the diaphragm and the like, the middle and late stage cancers can be detected by X-rays, but the early stage cancers expressed as ground glass-like nodules are completely omitted by adopting chest film screening, the death rate of the disease position is reduced, and therefore, the chest X-ray image is not used as an early screening tool; the fiber bronchoscope can not detect peripheral cells, the operation is complex, the operation is traumatic, the compliance of the examinee is poor, and the large-scale application is difficult; the detection of the sputum cytology is insensitive to the peripheral lung cancer, the quality of a sputum sample is often not ideal, and the detection sensitivity is influenced; although the tumor marker is widely applied to clinic, no index with good specificity to the lung cancer is found or proved at present, and the tumor marker can be used for large-scale screening of the lung cancer.

Lung cancer is often characterized by pulmonary nodules. Pulmonary nodules are small focal, round-like, imagewise density-increasing shadows, can be single-shot or multiple-shot, are not accompanied by atelectasis, pulmonary enlargement and pleural effusion, are basically divided into two categories, namely benign nodules and malignant nodules, and the benign nodules are benign tumors, tuberculosis, sarcoidosis or inflammatory nodules and the like; the malignant nodules comprise lung cancer, metastatic tumors and the like, the occurrence of the lung cancer is in a series of stages such as hyperplasia-atypical hyperplasia-carcinoma in situ-invasive carcinoma, and the like, the law is that the lung cancer develops slowly at first and rapidly increases after the lung cancer develops to a certain stage. Therefore, the lung nodules are effectively distinguished and diagnosed, the benign and malignant properties of the lung nodules are quickly determined, the lung cancer patient can be found early, the lung cancer patient can be treated by means of early excision of the malignant nodules and the like, and meanwhile unnecessary over-treatment is avoided.

Studies suggest that methylation of the human short small homeobox2 (SHOX homeobox2, SHOX2) gene and the prostaglandin E receptor 4 (prostagladin E receptor 4, PTGER4) gene occurs early in the development of lung cancer, and that methylation of both the SHOX2 and PTGER4 genes is currently detected in lung cancer tissues and in the plasma of lung cancer patients. The research of Kneip et al shows that the specificity of the methylation detection of human dwarf homeobox 2(short status homeobox2, SHOX2) in plasma for diagnosing lung cancer is up to 90 percent, and the research shows that the positive rate of the methylation detection of SHOX2 and PTGER4 genes has a certain relation with histological typing. The positive rate of small cell lung cancer is the highest, reaching 80-97%, and the lung squamous carcinoma is the second, reaching 63-91%, while the positive rate of adenocarcinoma is the lowest, only 39-77%. Konecny et al study Scale cancer and small cell lung cancer patient specimens SHOX2 methylation was 100%, adenocarcinoma 67%.

Chinese invention patent CN110656180A discloses a gene methylation detection primer probe composition, a kit and application thereof, the patent selects three target regions aiming at SHOX2, designs a sense strand, an antisense strand primer and a probe, simultaneously selects a PTGER4 gene to select two target regions, designs a sense strand, an antisense strand primer and a probe, carries out methylation detection on sample peripheral blood free DNA, detects 3 multiple holes, detects methylation in at least two multiple holes of the SHOX2 or PTGER4 gene, or simultaneously detects methylation in at least one multiple hole of the SHOX2 and PTGER4, a sample to be detected is positive in methylation, and abnormal cell proliferation exists in the sample to be detected. However, the patent only amplifies 10 pairs of PCR primers, and non-specific amplification is easily caused during amplification; secondly, the detection of the SHOX2 and PTGER4 genes in this patent is only a simple superposition and does not reveal the association between the two.

In addition, a sample to be detected needs to be treated by bisulfite before methylation, and in the process of vulcanization treatment, on one hand, if a target fragment is in a single-chain state, the target fragment is easy to degrade and lose; on the other hand, the recovered product contains a large amount of non-target fragments, which results in low recovery and purity of the sample after the sulfurization treatment. At present, most methylation detection kits on the market need to perform 2-3 parallels during sample detection, and the minimum value is taken as a detection result to reduce the detection omission phenomenon, so that more samples need to be extracted and vulcanized, and the extraction and vulcanization costs are correspondingly increased.

Disclosure of Invention

1. Objects of the invention

The kit comprises a detection reagent for specifically detecting DNA methylation of human SHOX2 and PTGER4 genes, and after Ct values of the SHOX2 and PTGER4 methylation genes are detected, the benign and malignant lung nodules are evaluated by an algorithm. Meanwhile, the specific capture sequences of the SHOX2 gene and the PTGER4 gene are provided by the invention, and are used in the purification process after sample bisulfite treatment, the sequences can distinguish methylated sequences from non-methylated sequences, and are specifically combined with the methylated sequences, so that the recovery rate and purity of a vulcanized sample, especially a low-concentration sample are improved, the instability of the sample in the vulcanization process is reduced, and the specificity and sensitivity of the kit are improved. The high sensitivity and the high specificity of the method provide valuable reference information for identifying benign and malignant lung nodules and diagnosing lung cancer.

2. Technical scheme

In order to solve the problems, the technical scheme adopted by the invention is as follows:

the invention provides a reagent for detecting methylation of a SHOX2 gene, which comprises a specific primer and a probe of a SHOX2 gene, wherein the specific primer sequence and the probe sequence are shown as SEQ ID NO. 1-2 and SEQ ID NO. 3.

Preferably, the gene probe has a fluorescent label, and further, the probe SEQ ID NO 3 nucleotide sequence has a 5 'end labeled with FAM and a 3' end labeled with MGB.

Preferably, the reagent also contains a specific primer and a probe for detecting the methylation state of the internal reference gene, further, the internal reference gene is ACTB gene, wherein the sequences of the specific primer and the probe are shown as SEQ ID NO. 7-8 and SEQ ID NO. 9.

Preferably, the gene probe has a fluorescent label, and further, the nucleotide sequence of the probe SEQ ID NO. 9 is labeled with VIC at the 5 'end and MGB at the 3' end.

Preferably, the reagent further comprises PCR Buffer and dNTPs.

The invention also provides a PTGER4 gene methylation detection reagent which contains PTGER4 gene specific primers and probes, wherein the sequences of the specific primers and the probes are shown as SEQ ID NO. 4-5 and SEQ ID NO. 6.

Preferably, the gene probe is fluorescently labeled, and further, the 5 'end of the nucleotide sequence of the probe SEQ ID NO. 6 is labeled with ROX, and the 3' end is labeled with MGB.

Preferably, the reagent further comprises PCR Buffer and dNTPs.

Preferably, the specific primers SEQ ID NO. 1, 2, 4, 5, 7, 8 are phosphorothioate-modified and hybridize to the methylated target gene region under stringent conditions.

Preferably, the probes SEQ ID NO 3, 6, 9 are designed based on TaqMan (TM) and hybridize under stringent conditions to a methylated target gene region.

The invention also provides a methylation specific capture sequence of the SHOX2 gene, the sequence is positioned at the upstream or downstream of the target gene fragment of the SHOX2 gene, the interval between the specific capture sequence and the 5' end of the target gene fragment is 2 bp-20 bp, the size of the capture sequence fragment is 15 bp-50 bp, the content of C basic group is about 10% -30%, the Tm value is about 50 ℃ -70 ℃, and no cross influence is caused on the primer probe sequence. The sequence is applied to the purification process of a sample after bisulfite treatment of the sample, can be specifically combined with a methylated fragment after sulfuration treatment, changes a single chain of a target fragment into a double chain, can reduce the recovery of non-target fragments, improves the recovery rate and purity of a sulfurated sample, particularly a low-concentration sample, reduces the instability of the low-concentration sample in the sulfuration process, and makes the low-concentration sample closer to a real sample. The method is favorable for further real-time fluorescent quantitative PCR detection, improves the reliability and stability of the detection result of the sample, enables the single-hole detection to obtain reliable data when the sample is detected without doing parallel operation, saves the sample requirement for extraction and vulcanization, and reduces the cost.

Preferably, the specific capture sequence is designed at an interval of 10-20 bp upstream or downstream of the amplified region of the SHOX2 gene.

Preferably, the size of the specific capture sequence fragment is about 20-30 bp.

Preferably, the specific capture sequence contains 10-30% of C basic groups, and the main function is to distinguish methylated sequences from non-methylated sequences, so that the sequences are specifically combined with the methylated sequences, and the specificity of a sample and the accuracy of a detection result are improved.

Preferably, the annealing temperature of the specific capture sequence is 55-65 ℃.

Preferably, the methylation specific capture sequence of SHOX2 gene is shown in SEQ ID NO 10.

The invention also provides a PTGER4 gene methylation specific capture sequence, which is located at the upstream or downstream of the target gene fragment of PTGER4 gene, the specific capture sequence is separated from the 5' end of the target gene fragment by 2 bp-20 bp, the size of the capture sequence fragment is 15 bp-50 bp, the content of C base is about 10% -30%, the Tm value is about 50-70 ℃, and no cross influence is caused on the primer probe sequence. The sequence is applied to the purification process of a sample after bisulfite treatment of the sample, can be specifically combined with a methylated fragment after sulfuration treatment, changes a single chain of a target fragment into a double chain, can reduce the recovery of non-target fragments, improves the recovery rate and purity of a sulfurated sample, particularly a low-concentration sample, reduces the instability of the low-concentration sample in the sulfuration process, and makes the low-concentration sample closer to a real sample. The method is particularly beneficial to further real-time fluorescent quantitative PCR detection, improves the reliability and stability of the detection result of the sample, enables the single-hole detection to obtain reliable data when the sample is detected without doing parallel operation, saves the sample requirement for extraction and vulcanization, and reduces the cost.

Preferably, the specific capture sequence is designed at an interval of 10-20 bp upstream or downstream of the amplification region of the PTGER4 gene.

Preferably, the Tm of the specific capture sequence is 55-65 ℃.

Preferably, the PTGER4 gene methylation specific capture sequence is set forth in SEQ ID NO. 11.

The invention also provides a kit for detecting methylation of pulmonary nodule assessment, which comprises the SHOX2 gene methylation detection reagent and/or PTGER4 gene methylation detection reagent.

Preferably, the kit further comprises an enzyme system, a negative control and a positive control.

Preferably, the negative control is 1% BSA solution, and the positive control is the product of bisulfite conversion treatment of H460 cell line DNA after ultrasonication.

Preferably, the kit further comprises the specific capture sequence.

The invention also provides an application method of the kit for assessing methylation of pulmonary nodules, which comprises the following steps:

(1) extraction of plasma free DNA using methods common in the art;

(2) sulfurizing and transforming free DNA, treating peripheral blood free DNA with a bisulfite transforming reagent, purifying to obtain sample DNA, and further, in the purification process, adding a specific capture sequence to enrich the sample DNA;

(3) detecting methylation, namely detecting methylation of SHOX2 and PTGER4 genes of the sample DNA purified in the step (2), and obtaining a Ct value of the SHOX2 methylated gene and a Ct value of the PTGER4 methylated gene by real-time fluorescence quantitative PCR;

(4) and (3) comprehensively scoring the benign and malignant lung nodules by a joint algorithm, wherein the joint algorithm is as follows: LUNG-CRA ═ 34.383-0.443 × ct.shox2-0.432 × ct.ptger4, wherein LUNG-CRA is a LUNG nodule benign and malignant composite score; shox2 is the Ct value of SHOX2 methylated gene in step (3); ptger4 is the Ct value of PTGER4 methylated gene in step (3);

(5) and (4) comprehensively judging whether the LUNG nodules are benign or malignant, wherein the Lung-CRA >1.83 is a high risk area, a middle risk area is formed between-0.61 < Lung-CRA < 1.83, and a low risk area is formed between-0.61 < Lung-CRA < 0.61. Wherein the high risk area prompts that the potential risk of the pulmonary nodule malignancy of the examined person is high, and further special examination is carried out after negotiation with a doctor; the stroke risk area prompts the potential risk of malignant pulmonary nodules of the examinee to be moderate, and further special examination is carried out after consultation with a doctor is suggested; the low-risk area prompts that the potential risk of the pulmonary nodule malignancy of the examinee is low, still recommends that the examinee keep healthy living habits, and carries out the examination of the item regularly.

Preferably, in step (1), the plasma-free DNA is extracted by a magnetic bead method.

Preferably, in the step (3), the reaction system (25. mu.L) of the real-time fluorescence quantitative PCR is 5 XBuffer, 5.0. mu.L; 250 × SI, 0.1 μ L; 25mM dNTPs, 0.2. mu.L; 0.3 μ L of HiTaq enzyme; PTGER4/SHOX2 forward primer, 0.5-0.7 μ L; PTGER4/SHOX2 reverse primer, 0.5-0.7 μ L; PTGER4/SHOX2 probe, 0.2-0.4. mu.L; ACTB forward primer, 0.3-0.5. mu.L; ACTB reverse primer, 0.3-0.5. mu.L; ACTB probe, 0.2-0.4. mu.L; supplementing pure water to 15 mu L; DNA template, 10. mu.L. Further, PTGER4/SHOX2 forward primer, 0.6. mu.L; PTGER4/SHOX2 reverse primer, 0.6. mu.L; PTGER4 probe, 0.25 μ L; SHOX2 probe, 0.3 μ L; ACTB forward primer, 0.5. mu.L; ACTB reverse primer, 0.5. mu.L; ACTB probe, 0.25. mu.L; further, the concentration of the DNA template may be further diluted for use according to the actual condition.

Preferably, in the step (3), the fluorescent PCR amplification procedure is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, signal collection at 58 ℃ for 30s, 40 cycles.

The sequences of the primers, probes, and capture sequences are shown in Table 1.

TABLE 1 specific primer and Probe sequences in the kits of the invention

3. Advantageous effects

Compared with the prior art, the invention has the beneficial effects that:

(1) the kit has high sensitivity, achieves the purposes of screening early lung cancer and assisting in diagnosing the benign and malignant lung nodules by detecting the gene methylation state in a plasma sample, has the lowest detection line of 1 percent for the methylation of the SHOX2 and PTGER4 genes, and can improve the detection sensitivity of biomarkers to picogram/nanogram DNA molecules through experimental tests.

(2) The specificity is high, by optimizing a specific nucleotide sequence primer probe and adding a specific capture sequence of the methylation state of the SHOX2 and PTGER4 genes in the bisulfite treatment process of plasma free DNA, the sequence can be specifically combined with methylated fragments after vulcanization treatment, the single strand of a target fragment is changed into a double strand, the degradation is prevented, in addition, the recovery of non-target fragments can be reduced, the recovery rate and the purity of a vulcanized sample are improved, as shown in the table 10, the recovery rate and the purity reach 1.5-2 times, and the specificity of a detection reagent is increased.

(3) The sequence of the specific capture sequence obtained by the invention improves the recovery rate and purity of a vulcanized sample, particularly a low-concentration sample, simultaneously reduces the instability of the sample in the vulcanization process, makes the sample closer to a real sample, improves the reliability and stability of the detection result of the sample, enables single-hole detection to obtain reliable data in the sample detection process, does not need to be carried out in parallel, saves the sample requirement for extraction and vulcanization, and reduces the cost. Meanwhile, the result is detected by adopting the joint detection of the two genes, and the detection result is interpreted by using a joint algorithm, so that the positive detection rate of early lung cancer can be obviously improved.

Drawings

FIG. 1 is a ROX curve of a combined algorithm for testing Ct values of SHOX2 and PTGER4 genes in 449 clinical specimens;

FIG. 2 is a ROX curve of the Ct value of the SHOX2 gene tested in 449 clinical specimens;

FIG. 3 is a ROX curve of Ct values of PTGER4 gene tested in 449 clinical specimens.

Detailed Description

The invention is further described with reference to specific examples.

It should be noted that the terms "upper", "lower", "left", "right" and "middle" used in the present specification are for the sake of clarity, and are not intended to limit the scope of the present invention, and changes or adjustments of the relative relationship thereof may be made without substantial technical changes.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; as used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

As used herein, the term "about" is used to provide the flexibility and inaccuracy associated with a given term, measure or value. The degree of flexibility for a particular variable can be readily determined by one skilled in the art.

As used herein, at least one of the terms "is intended to be synonymous with one or more of. For example, "at least one of A, B and C" explicitly includes a only, B only, C only, and combinations thereof, respectively.

Concentrations, amounts, and other numerical data may be presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a numerical range of about 1 to about 4.5 should be interpreted to include not only the explicitly recited limit values of 1 to about 4.5, but also include individual numbers (such as 2, 3, 4) and sub-ranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges reciting only one numerical value, such as "less than about 4.5," which should be construed to include all of the aforementioned values and ranges. Moreover, such an interpretation should apply regardless of the breadth of the range or feature being described.

Any steps recited in any method or process claims may be executed in any order and are not limited to the order presented in the claims.

Example 1

Performing SHOX2 gene methylation by using a SHOX2 gene methylation detection reagent, comprising the following steps of:

(1) taking the DNA of the blood of a patient with confirmed diagnosis of lung cancer as a template, carrying out ultrasonic disruption, carrying out vulcanization conversion by using bisulfite, taking the purified DNA as the template, and sequentially diluting by 5 times in a gradient manner for 4 gradients, wherein the gradients are marked as 1, 2, 3 and 4.

(2) The fluorescent PCR reaction system was prepared as shown in Table 2.

TABLE 2 SHOX2 Gene methylation detection fluorescent PCR reaction System (25. mu.L)

(3) Fluorescent PCR amplification

The fluorescent PCR instrument used ABI 7500.

Fluorescent PCR reaction amplification procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10s, signal collection at 58 ℃ for 30s, 40 cycles.

(4) The results of the fluorescent PCR amplification are shown in Table 3. As is clear from Table 3, the reagent of the present invention was able to detect methylation of SHOX2 gene in template DNA at various concentrations.

TABLE 3 fluorescent PCR results for detecting methylation of SHOX2 gene

Example 2

PTGER4 gene methylation is carried out by utilizing a PTGER4 gene methylation detection reagent, and the method comprises the following steps:

(2) The fluorescent PCR reaction system was prepared as shown in Table 4.

TABLE 4 PTGER4 Gene methylation detection fluorescent PCR reaction System (25. mu.L)

(3) Fluorescent PCR amplification

The fluorescent PCR instrument used ABI 7500.

(4) The results of the fluorescent PCR amplification are shown in Table 5. As is clear from Table 5, the reagent of the present invention was able to detect methylation of PTGER4 gene in template DNA at various concentrations.

TABLE 5 fluorescent PCR results for methylation detection of PTGER4 Gene

Example 3

A methylation detection kit for evaluating pulmonary nodules. The kit components of the present invention include the following as shown in table 6.

TABLE 6 kit Components Table

Example 4

The performance evaluation of the detection kit of the invention is that the components of the kit are shown in example 3, and the specific implementation contents are as follows:

1. reference article

The internal reference product of the kit enterprise comprises:

(1)9 positive reference products P1-P9 for controlling the detection capability of the kit on human SHOX2/PTGER4 nucleic acid. Wherein, the P1-P3 are reference products with different methylation contents, which are prepared by purifying DNA of a H460 cell line DNA peripheral blood sample by bisulfite and then according to different proportions; P4-P6 are references with different methylation contents, which are prepared by artificially synthesizing methylated SHOX2 plasmid DNA, artificially synthesizing methylated PTGER4 plasmid DNA and DNA of a healthy human peripheral blood sample through bisulfite purification according to different proportions; the P7-P9 are reference products with different methylation contents, which are prepared by artificially synthesizing methylated PTGER4 plasmid DNA and DNA of a healthy human peripheral blood sample through bisulfite purification according to different proportions.

(2) And 5 negative reference products N1-N5 for controlling the specificity of the kit. Wherein, N1 is prepared by purifying blood plasma cf DNA of healthy people through bisulfite; n2 was prepared from hamartoma patient plasma cf DNA purified with bisulfite; n3 is prepared by purifying the blood plasma cf DNA of pneumonia patients by bisulfite; n4 was prepared from plasma cf DNA of benign tumor patients in lung by bisulfite purification; n5 is a methylated SHOX2/PTGER4 reference substance (0.1%) which is prepared by mixing 1 ng/mul of ultrasonically-broken H460 cell line DNA and healthy human plasma cf DNA according to the proportion of 1:999 and purifying by bisulfite.

(3)4 detection limit reference substances L1, L2, L3 and L4 for determining the lowest detection amount of the kit

(4)2 portions of precision reference products R1 and R2 for controlling the precision of the kit

2. Performance evaluation

And (4) evaluating the performance of the kit, wherein each round of experiment is provided with a positive control and a negative control, and the positive control and the negative control meet the quality control requirement.

(1) Accuracy and specificity assessment

P1-P9 and N1-N5 are used as samples to be detected, the detection is carried out by using a kit, the results are shown in Table 7, and the detection results of positive reference products P1-P3 show that two targets of a SHOX2 gene and a PTGER4 gene are positive; the detection results of positive reference products P4-P6 of the SHOX2 gene show that the single target of the SHOX2 gene is positive; the detection results of positive reference products P7-P9 of the PTGER4 gene show that a single target point of the PTGER4 gene is positive; the kit can accurately detect the human SHOX2/PTGER4 gene methylation; the detection results of the positive reference products P1-P9 all accord with expected results, and the detection results of N1-N5 are all negative, which indicates that the kit has good specificity and no cross reaction.

(2) Precision evaluation

R1-R2 are used as samples to be detected, the detection is carried out by using the kit, each sample is detected for 10 times, each round of experiment is provided with positive control and negative control, the quality control requirements are met, the specific results are shown in Table 8, the variation Coefficient (CV) range of Ct values of the precision detection results of R1 and R2 is smaller than 2%, and the kit is good in stability and high in precision.

TABLE 7 test results of reference products P1-P9 and N1-N5

Note: N/A is data representing no amplification

TABLE 8 detection results of reference products R1-R2

(3) Detection limit evaluation

The detection limit of the kit is confirmed by using the kit for detection and repeating the steps for 20 times by using L1-L4 as a sample to be detected, counting the detection result, wherein the result shows that the methylation content of the product can be detected to be 1%, the specific result is shown in Table 9, and the lowest detection limit of the kit is determined to be 1% by analyzing the experimental result.

TABLE 9 results of detection of SHOX2 reaction solution and PTGER4 reaction solution

Example 5

449 clinical lung nodule samples were tested, and the samples collected in this example all had pathological results, 122 negative samples and 327 positive samples.

The kit provided by the invention is used for detecting the methylation of the SHOX2 and PTGER4 genes of the samples, and the Ct value of the SHOX2 methylated gene and the Ct value of the PTGER4 methylated gene are obtained by real-time fluorescent quantitative PCR.

Processing the numerical data of amplified Ct of SHOX2 and PTGERT4 genes by adopting IBM SPSS statics, and solving the prediction probability by utilizing Logistic regression to obtain a combined algorithm formula: LUNG-CRA (34.383-0.443) SHOX2-0.432 PTGER4, wherein LUNG-CRA is LUNG nodule benign and malignant comprehensive score; SHOX2 is the Ct value of SHOX2 methylated gene; ptger4 is the Ct value of PTGER4 methylated gene. The ROC curve of the algorithm is shown in fig. 1, the AUC of the ROC curve is 0.91, and the detection method has higher authenticity compared with the ROC curve and AUC values (shown in fig. 2-fig. 3) of the SHOX2 single gene and the PTGER4 single gene. According to the clinical practical situation, the false positive rate of the clinical test sample is 5%, the sensitivity is 73.1%, the specificity is 94.3%, the detection result is divided into a potential low risk zone less than or equal to-0.61 and a potential middle risk zone less than or equal to-0.61 according to a calculation formula LUNG-CRA, the potential middle risk zone is more than or equal to 1.83, the potential high risk zone prompts that the potential risk of pulmonary nodule malignancy of a detected person is high, and further special examination is recommended after negotiation with a doctor; the stroke risk area prompts the potential risk of malignant pulmonary nodules of the examinee to be moderate, and further special examination is carried out after consultation with a doctor is suggested; the low-risk area prompts that the potential risk of the pulmonary nodule malignancy of the examinee is low, still recommends that the examinee keep healthy living habits, and carries out the examination of the item regularly. Has higher auxiliary diagnostic value for clinic.

Example 6

A kit for detecting methylation in pulmonary nodule assessment, which comprises the components substantially the same as in example 3, except that the kit further comprises a specific capture sequence, wherein the sequence of the specific capture sequence of SHOX2 gene is GTTTTTTGGTTCGGTTTGGGCGGCGAGTTT; the sequence of the PTGER4 gene-specific capture sequence was TACGCGGTCGCGGTCGTTTCGG.

Example 7

Use of the test kit of example 6. The specific embodiment is as follows:

(1) extracting free DNA, namely extracting 16 parts of clinical lung cancer positive plasma samples and 4 parts of lung cancer negative plasma samples by using a magnetic bead method, wherein two parts of each sample are extracted;

(2) converting peripheral blood free DNA, dividing the extracted clinical sample free DNA into two groups, wherein one group is not added with a specific capture sequence in the process of bisulfite sulfuration treatment and is marked as a combination 1, the other group is added with a specific capture sequence and is marked as a combination 2, and the samples of the combination 1 and the combination 2 are provided with three negative controls in the sulfuration process, are ultrapure water and are marked as a control 1, a control 2 and a control 3;

(3) and (3) methylation detection, namely performing detection on methylation of the SHOX2 and PTGER4 genes on the sample DNA purified in the step (2) by using a kit detection reagent, and obtaining the Ct value of the SHOX2 methylated gene and the Ct value of the PTGER4 methylated gene by real-time fluorescence quantitative PCR (polymerase chain reaction), wherein specific results are shown in Table 10.

TABLE 10 Effect of addition of specific Capture on sample sulfurization Process

Note: N/A is data representing no amplification

Sequence listing

<110> Anhui Anlong Gene science and technology Co., Ltd

<120> methylation detection kit for evaluating benign and malignant pulmonary nodule based on algorithm and application

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> artificial sequence SEQ ID NO:1 (Artificial sequence)

<400> 1

aggtaatttt cgtttcgttt gtt 23

<210> 2

<211> 22

<212> DNA

<213> artificial sequence SEQ ID NO: 2 (Artificial sequence)

<400> 2

cctcctacct tctaacccga ct 22

<210> 3

<211> 22

<212> DNA

<213> artificial sequence SEQ ID NO:3 (Artificial sequence)

<400> 3

tacgagtata ggcgtttacg tt 22

<210> 4

<211> 21

<212> DNA

<213> artificial sequence SEQ ID NO:4 (Artificial sequence)

<400> 4

tagttttgtc gcgttttagc g 21

<210> 5

<211> 21

<212> DNA

<213> artificial sequence SEQ ID NO: 5 (Artificial sequence)

<400> 5

aaccatctaa atctcgacgc c 21

<210> 6

<211> 22

<212> DNA

<213> artificial sequence SEQ ID NO:6 (Artificial sequence)

<400> 6

tttcggcgtc gtcggagttt tc 22

<210> 7

<211> 22

<212> DNA

<213> artificial sequence SEQ ID NO:7 (Artificial sequence)

<400> 7

tggattgtga atttgtgttt gt 22

<210> 8

<211> 25

<212> DNA

<213> artificial sequence SEQ ID NO: 8 (Artificial sequence)

<400> 8

ccaataaaac ctactcctcc cttaa 25

<210> 9

<211> 19

<212> DNA

<213> artificial sequence SEQ ID NO:9 (Artificial sequence)

<400> 9

accaccaccc aacacacaa 19

<210> 10

<211> 30

<212> DNA

<213> artificial sequence SEQ ID NO:10 (Artificial sequence)

<400> 10

gttttttggt tcggtttggg cggcgagttt 30

<210> 11

<211> 22

<212> DNA

<213> artificial sequence SEQ ID NO:11 (Artificial sequence)

<400> 11

tacgcggtcg cggtcgtttc gg 22

Claims

1. A gene methylation detection reagent is characterized by comprising a SHOX2 gene methylation detection reagent and/or a PTGER4 gene methylation detection reagent, wherein the SHOX2 gene methylation detection reagent comprises a SHOX2 gene specific primer and a probe, the specific primer sequence is shown as SEQ ID NO 1-2, and the probe sequence is shown as SEQ ID NO 3; the PTGER4 gene methylation detection reagent contains PTGER4 gene specific primers and probes, wherein the specific primer sequences are shown as SEQ ID NO. 4-5, and the probe sequences are shown as SEQ ID NO. 6.

2. The reagent for detecting gene methylation of claim 1, wherein the probe SEQ ID NO 3 has a nucleotide sequence with a 5 'end labeled FAM and a 3' end labeled MGB; the probe SEQ ID NO. 6 nucleotide sequence is marked with ROX at the 5 'end and MGB at the 3' end.

3. The gene methylation detection reagent according to claim 1 or 2, wherein the reagent further comprises specific primers and probes for detecting methylation states of internal reference ACTB genes, and the sequences of the specific primers and probes are shown as SEQ ID NO. 7-8 and SEQ ID NO. 9.

4. The reagent for detecting gene methylation of claim 3, wherein the probe has the nucleotide sequence of SEQ ID NO. 9, the 5 'end is labeled with VIC, and the 3' end is labeled with MGB.

5. A kit for detecting methylation of pulmonary nodule, comprising the gene methylation detection reagent of claim 4.

6. The kit for detecting methylation of a pulmonary nodule assessment according to claim 5, wherein the kit further comprises a methylation specific capture sequence of SHOX2 gene and/or a methylation specific capture sequence of PTGER4 gene.

7. The kit for detecting methylation of pulmonary nodule assessment according to claim 6, wherein the specific capture sequence is located at the upstream or downstream of the target gene fragment, the interval between the specific capture sequence and the 5' end of the target gene fragment is 2 bp-20 bp, the size of the capture sequence fragment is 15 bp-50 bp, the content of C base is 10% -30%, the Tm value is 55 ℃ -70 ℃, and no cross effect is caused on the primer probe sequence.

8. The kit for detecting methylation of lung nodule assessment according to claim 7, wherein the methylation specific capture sequence of SHOX2 gene is shown in SEQ ID NO. 10; the PTGER4 gene methylation specific capture sequence is shown as SEQ ID NO. 11.

9. The method for using the kit for detecting methylation of pulmonary nodule assessment according to claims 5-8, wherein the method comprises the following steps:

(1) extracting free DNA of blood plasma;

(2) carrying out sulfuration transformation on the free DNA, treating the free DNA by using a bisulfite transformation reagent, and purifying to obtain sample DNA;

(3) detecting methylation, namely detecting methylation of SHOX2 and PTGER4 genes of the purified DNA in the step (2), and obtaining a Ct value of the SHOX2 methylated gene and a Ct value of the PTGER4 methylated gene by real-time fluorescent quantitative PCR;

(5) and (4) comprehensively judging whether the LUNG nodules are benign or malignant, wherein the Lung-CRA >1.83 is a high risk area, a middle risk area is formed between-0.61 < Lung-CRA < 1.83, and a low risk area is formed between-0.61 < Lung-CRA < 0.61.

10. The use of the kit for detecting methylation of pulmonary nodule assessment according to claim 9, wherein the specific capture sequence is added during the purification process of step (2) to recover and purify the sample DNA.