TWI730328B - Tumor markers, methylation detection reagents, kits and applications thereof - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to tumor markers, methylation detection reagents, kits and applications thereof. The present invention found through research that: by detecting the methylation level of the promoter region of the TMEM240 gene, colorectal cancer specimens can be well distinguished from normal human stool specimens. The present invention uses the methylation detection reagent containing the gene to detect colorectal cancer, and the detection sensitivity and specificity for colorectal cancer are very high. The present invention verifies for the first time that the methylation level of the gene is associated with the incidence of colorectal cancer.

Description

Tumor markers, methylation detection reagents, kits and applications thereof

The invention relates to the field of biotechnology, in particular to tumor markers, methylation detection reagents, kits and applications thereof.

Colorectal cancer, also known as colorectal cancer, is a common malignant tumor of the digestive tract. Its incidence is increasing year by year in my country. In some coastal areas of my country, such as Shanghai and Guangzhou, the incidence of colorectal cancer has jumped to the second place, second only to lung cancer. It is currently believed that the formation of bowel cancer is the result of accumulation of genetic defects and epigenetic defects. The early onset of colorectal cancer is hidden, often without obvious symptoms, and symptoms such as blood in the stool, abdominal pain, and diarrhea may appear in the late stage. When the symptoms appear, it is often in the late stage, which brings great pain and expensive treatment costs to the patient. Therefore, early detection, early diagnosis, and early treatment are important measures to reduce the incidence and mortality of colorectal cancer.

Screening can detect bowel cancer and precancerous lesions early, and remove the lesions, thereby preventing the occurrence of bowel cancer. The current screening methods for colorectal cancer mainly include occult blood test and colonoscopy. The occult blood test is vulnerable to food or the detection rate of adenoma is not high. Although colonoscopy is the gold standard for the diagnosis of bowel cancer, it is not highly adherent to the population when used as a screening method. Therefore, there is an urgent need for a colorectal cancer screening method with high accuracy and high compliance.

Fecal genetic testing, as a new screening method for bowel cancer, is now receiving more and more attention. This method (Cologuard®) was included in the U.S. bowel cancer screening guidelines in 2016. This method is convenient, non-invasive, and has the characteristics of high detection rate for bowel cancer and precancerous adenomas. To make a high-performance stool gene detection kit for colorectal cancer detection, two major obstacles need to be overcome: stool DNA extraction and marker selection. On the one hand, the composition of feces is complex, there are many inhibitors to downstream reactions, and there are many bacterial DNA. To extract human target genes from such a mixture, a set of highly sensitive gene extraction and purification methods is required; on the other hand, At present, there are many markers related to colorectal cancer, especially DNA methylation markers, because studies have shown that DNA methylation is an early event of tumor formation. However, many methylation markers perform well at the cell and tissue level. When used in screening media such as feces and blood, their sensitivity and specificity for colorectal cancer are reduced. For example, the vimentin gene, which is used in tissues The sensitivity in fecal specimens is 83%, which is reduced to 46% in stool samples. Similar genes include SFRP1 and SFRP2. Such markers cannot meet the needs of clinical detection of colorectal cancer. Therefore, the selection of stools with extremely high sensitivity and specificity for colorectal cancer detection is the key to the detection of colorectal cancer stool genes, and such markers are expected to be truly used in the clinical detection of colorectal cancer.

In view of this, the present invention provides a tumor marker, capture sequence, primer pair, probe, methylation detection reagent, kit and application thereof. This tumor marker is very sensitive to bowel cancer in feces.

Another object of the present invention is to provide a marker, capture sequence, primer pair, probe, methylation detection reagent, kit and method for non-invasive detection of tumor.

In order to achieve the above-mentioned purpose of the invention, the present invention provides the following technical solutions:

The invention provides the application of TMEM240 gene in the preparation of tumor markers.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has at least 97.8% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has at least 98.9% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has at least 99.9% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11.

In some specific embodiments of the present invention, the tumor is a colorectal tumor.

In some specific embodiments of the present invention, the tumor is colorectal cancer or adenoma. In some specific embodiments of the present invention, the sample to be tested is tissue, body fluid or excrement.

In some specific embodiments of the invention, the tissue is intestinal tissue.

In some specific embodiments of the present invention, the body fluid includes, but is not limited to, blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid, or aqueous humor.

In some specific embodiments of the present invention, the excrement is sputum, urine, saliva or feces.

The invention also provides the application of the methylation detection reagent of TMEM240 gene in the preparation of tumor detection reagents or kits.

The methylation detection reagent for the TMEM240 gene can be a methylation detection reagent in the prior art. In the prior art, there are already many methods to detect the methylation of the target gene, such as methylation-specific PCR (MSP) , Methylation-specific quantitative PCR (qMSP), PCR for methylated DNA-specific binding proteins, quantitative PCR and DNA chips, methylation-sensitive restriction enzymes, bisulfite sequencing or pyrosequencing and many more. Each detection method has its corresponding reagents, and these reagents can be used to detect the methylation of TMEM240 gene in the present invention.

The present invention also provides a capture sequence, which has any one of the following nucleotide sequences:

1. Having the nucleotide sequence shown in SEQ ID NO:1;

II. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO:1 or having the nucleotide sequence shown in SEQ ID NO:1 CpG islands obtain nucleotide sequences with similar functions;

III. A sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO:1 or has a nucleus shown in SEQ ID NO:1 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

IV. The complementary sequence of the sequence shown in I, II or III.

The present invention also provides a primer pair, the upstream primer has any one of the following nucleotide sequences:

V. Having the nucleotide sequence shown in SEQ ID NO: 2;

VI. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 2;

VII. A sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 2 or has the nucleus shown in SEQ ID NO: 2 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

VIII, the complementary sequence of the sequence shown in V, VI or VII;

The downstream primer has any one of the nucleotide sequences shown below:

IX, having the nucleotide sequence shown in SEQ ID NO: 3;

X. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 3;

XI. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or a sequence having the nucleus shown in SEQ ID NO: 3 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

XII. The complementary sequence of the sequence shown in IX, X or XI.

The present invention also provides a probe which has any one of the following nucleotide sequences:

XIII, having the nucleotide sequence shown in SEQ ID NO: 4;

XIV, a nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 4;

XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or a sequence having the nucleus shown in SEQ ID NO: 4 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

XVI, the complementary sequence of the sequence shown in XIII, XIV or XV.

The present invention also provides a methylation detection reagent for TMEM240 gene, including a capture sequence, primer and/or probe for TMEM240 gene.

In some specific embodiments of the present invention, capture sequences, primers and/or probes obtained for the CpG islands of the TMEM240 gene are included.

In some specific embodiments of the present invention, the primers and/or probes detect the methylation of the TMEM240 gene by methylation-specific quantitative PCR (quantitative Methylation-Specific PCR, Qmsp).

In some specific embodiments of the present invention, the methylation detection reagent provided by the present invention detects the methylation level of the gene body, intergenic region or promoter region of the TMEM240 gene and the region near the promoter region.

Methylation in tumor tissues is considered to be an apparent modification of DNA with potential clinical value. Genes, intergenic regions, promoters, or nearby regions all have methylation, and the methylation of these regions may be related to tumors. At present, it has been confirmed in a variety of tumors that abnormal methylation of the CpG islands of the tumor suppressor gene promoter or its vicinity leads to transcription inactivation.

In some specific embodiments of the present invention, the methylation detection reagent provided by the present invention includes capture sequences, primers and/or probes obtained from the promoter region of the TMEM240 gene or the CpG islands in the vicinity of the promoter region.

In some specific embodiments of the present invention, the capture sequence in the methylation detection reagent provided by the present invention has any one of the following nucleotide sequences:

1. Having the nucleotide sequence shown in SEQ ID NO:1;

II. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO:1 or having the nucleotide sequence shown in SEQ ID NO:1 CpG islands obtain nucleotide sequences with similar functions;

III. A sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO:1 or has a nucleus shown in SEQ ID NO:1 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

IV. The complementary sequence of the sequence shown in I, II or III.

In some specific embodiments of the present invention, in the methylation detection reagent provided by the present invention, the upstream primer in the primer has any one of the following nucleotide sequences:

V. Having the nucleotide sequence shown in SEQ ID NO: 2;

VI. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 2;

VII. A sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 2 or has the nucleus shown in SEQ ID NO: 2 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

VIII, the complementary sequence of the sequence shown in V, VI or VII.

In some specific embodiments of the present invention, in the methylation detection reagent provided by the present invention, the downstream primer in the primer has any one of the following nucleotide sequences:

IX, having the nucleotide sequence shown in SEQ ID NO: 3;

X. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 3;

XI. A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 3 or a sequence having the nucleus shown in SEQ ID NO: 3 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

XII. The complementary sequence of the sequence shown in IX, X or XI.

In some specific embodiments of the present invention, the probe in the methylation detection reagent provided by the present invention has any one of the following nucleotide sequences:

XIII, having the nucleotide sequence shown in SEQ ID NO: 4;

XIV, a nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence shown in SEQ ID NO: 4;

XV, a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the nucleotide sequence shown in SEQ ID NO: 4 or a sequence having the nucleus shown in SEQ ID NO: 4 Nucleotide sequences with similar functions obtained by the CpG islands of the nucleotide sequence;

XVI, the complementary sequence of the sequence shown in XIII, XIV or XV.

The present invention also provides a kit for detecting tumors, which includes the capture sequence, primer pair, probe or methylation detection reagent.

In some specific embodiments of the present invention, the kit provided by the present invention includes one or more containers divided into one or more containers for receiving reagents therein.

In some specific embodiments of the present invention, the kit provided by the present invention includes: a first container, which contains a capture sequence; a second container, which contains a primer pair for amplification; and a third container, which contains a probe.

In some specific embodiments of the present invention, the kit provided by the present invention also includes commonly used reagents in the kit, such as a commonly used conversion agent in qMSP, which is used to convert unmethylated cytosine bases into uracil, and The methylated cytosine base remains unchanged. The conversion agent includes, but is not limited to, bisulfite, bisulfite or hydrazine salt and the like. Another example is DNA polymerase, dNTPs, Mg²⁺ ions and buffers commonly used in the amplification of TMEM240 genes.

The invention also provides the application of the above-mentioned capture sequence, primer pair, probe, methylation detection reagent, and kit in tumor detection.

The present invention also provides a tumor detection method, which distinguishes normal samples from tumor samples by detecting the methylation level of TMEM240 gene.

In some specific embodiments of the present invention, it includes the following steps:

(1) Detect the methylation level of the subject's TMEM240 gene;

(2) Compare the methylation level of the subject's TMEM240 gene with the methylation level of the normal control sample;

(3) According to the increase in the methylation level of the subject's TMEM240 gene compared with the methylation level of the normal control sample, it is indicated that the subject has or is at risk of developing a tumor to distinguish normal samples And tumor samples.

In some specific embodiments of the present invention, the present invention detects the methylation level of the gene body, intergenic region or promoter region of the TMEM240 gene and the region near the promoter region.

In some specific embodiments of the present invention, the present invention distinguishes normal samples from tumor samples by detecting the methylation level of the promoter region of the TMEM240 gene and the region near the promoter region.

In some specific embodiments of the present invention, the methylation level is determined by methylation-specific PCR, or methylation-specific quantitative PCR (qMSP), or PCR or quantitative PCR of methylated DNA-specific binding proteins. , And DNA chip, or methylation-sensitive restriction endonuclease, or bisulfite sequencing method, or pyrosequencing detection.

In some specific embodiments of the present invention, the methylation level is detected by methylation-specific quantitative PCR (qMSP).

In some specific embodiments of the present invention, the methylation level is detected using the capture sequence, primer pair, probe, methylation detection reagent or the kit.

In some specific embodiments of the present invention, in step (1), detecting the methylation level of the subject's TMEM240 gene includes the following steps:

Use magnetic bead capture method to extract the DNA of the sample to be tested;

The DNA of the sample to be tested is transformed with bisulfite, bisulfite or hydrazine salt;

Methylation specific quantitative PCR (qMSP) detection.

In some specific embodiments of the present invention, in step a), using magnetic bead capture method to extract DNA from the sample to be tested includes the following steps;

Take the sample to be tested, mix, grind, centrifuge, and take the supernatant in the protective solution;

Centrifuge the supernatant again, take the supernatant, add the lysate and the magnetic beads with the specific complementary oligonucleotide capture sequence to the supernatant and incubate;

Discard a portion of the supernatant, wash the magnetic beads and transfer to a clean centrifuge tube, add the washing solution, incubate at room temperature 100-2000 rpm for 0.5-5 min, place on a magnetic stand to remove the supernatant, repeat 3 times;

The target gene DNA is eluted with buffer.

In some specific embodiments of the present invention, the detection standard is: judging tumor specimens and normal specimens according to the cut-off value, the cut-off value of the Ct value in the stool specimen is 32 to 42, preferably, the cut-off value of the Ct value in the stool specimen If the stool specimen has a Ct value less than the threshold value of the Ct value, it is determined as a tumor specimen, and the stool specimen has a Ct value greater than or equal to the threshold value of the Ct value, then it is determined as a normal specimen. The limit value can be adjusted according to the actual situation.

The present invention also provides a tumor detection system, which includes the following components: a TMEM240 gene methylation detection component; a data processing component; a result output component.

In some specific embodiments of the present invention, the methylation detection component contains one or more of a fluorescent quantitative PCR machine, a PCR machine, and a sequencer; in some specific embodiments of the present invention, the methyl group The chemical detection component also contains the capture sequence, primer pair, probe, methylation detection reagent or kit.

In some specific embodiments of the present invention, the data processing component is configured to a. receive the test data of the test sample and the normal control sample; b. store the test data of the test sample and the normal control sample; c. Test data of the same type of test sample and normal control sample; d. According to the comparison result, respond to the probability or possibility of the tester suffering from a tumor.

In some specific embodiments of the present invention, the result output component is used to output the probability or possibility of a tester suffering from a tumor.

In some specific embodiments of the present invention, the judgment standard of the data processing component is:

Judging tumor specimens and normal specimens according to the cutoff value, the cutoff value of the Ct value in the stool specimen is 32 to 42, preferably, the cutoff value of the Ct value in the stool specimen is 35, and the Ct value of the stool specimen is less than the Ct The boundary value of the value is judged as a tumor specimen, and the Ct value of the stool specimen is greater than or equal to the boundary value of the Ct value, and it is judged as a normal specimen. The limit value can be adjusted according to the actual situation.

In some specific embodiments of the present invention, the tumor of the present invention is a colorectal tumor.

In some specific embodiments of the present invention, the tumor of the present invention is colorectal cancer or adenoma.

In some specific embodiments of the present invention, the sample or sample type to be tested provided by the present invention is tissue, body fluid or excrement.

In some specific embodiments of the invention, the tissue is intestinal tissue.

In some specific embodiments of the present invention, the body fluid includes blood, serum, plasma, extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid, or aqueous humor.

In some specific embodiments of the present invention, the excrement is sputum, urine, saliva or feces.

The present invention found through research that: by detecting the methylation level of the promoter region of the TMEM240 gene, colorectal cancer specimens can be well distinguished from normal human stool specimens. The present invention uses the methylation detection reagent containing the gene to detect colorectal cancer, and the detection sensitivity and specificity for colorectal cancer are very high. The present invention verifies for the first time that the methylation level of the gene is associated with the incidence of colorectal cancer.

Compared with the existing markers for the detection of colorectal cancer, the markers and technical solutions provided by the present invention can detect colorectal cancer with high sensitivity and specificity, specifically as follows:

1. In one of the above technical solutions, the methylation detection reagent containing TMEM240 gene provided by the present invention can detect 83% of colorectal cancers in stool specimens with a specificity of 94%, which can be easily done in stool. In order to test samples, make a reliable diagnosis of colorectal cancer. The stool sample is very easy to obtain, the sampling is non-invasive and simple, and it will not cause any pain and inconvenience to the patient.

2. In one of the above technical solutions, the methylation detection reagent and extraction detection method containing the TMEM240 gene can easily and accurately determine colorectal cancer and normal people. The methylation detection reagent of this gene is expected to be used in stool Genetic testing kits, and serve for the clinical testing of bowel cancer.

3. The reagents/kits in one of the above technical solutions detect and diagnose cancer by methylation level. More and more studies have confirmed that methylation changes are an early event in the process of tumorigenesis and detect abnormal methylation. Easier to find early lesions.

The invention discloses a tumor marker, a methylation detection reagent, a kit and applications thereof, and those skilled in the art can learn from the content of this article and appropriately improve the process parameters to achieve. In particular, it should be pointed out that all similar replacements and modifications are obvious to those skilled in the art, and they are all deemed to be included in the present invention. The method and application of the present invention have been described through the preferred embodiments. It is obvious that relevant persons can make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to achieve and Apply the technology of the present invention.

The tumor markers, methylation reagents, kits and raw materials used in their applications, auxiliary materials and reagents provided by the present invention can all be purchased or synthesized in the market.

As long as there are CpG sites that can detect differential methylation, any nucleic acid fragment of the TMEM240 gene can be used in the present invention. CpG islands are CpG-rich regions in nucleic acid sequences. CpG islands start upstream of the promoter and extend downstream to the transcription region. The methylation of CpG islands on the promoter usually suppresses gene expression. The CpG island in the promoter is part of the methylation, and the CpG open sea in the gene body has a conservative DNA methylation target. Recent studies have revealed the synergistic effect of methylation of non-promoter regions (such as genome and UTR) on gene expression, and gene methylation may be a potential therapeutic target in cancer.

Generally speaking, CpG islands refer to regions rich in CpG dinucleotides, usually located in the promoter and its vicinity. The CpG islands in the present invention not only refer to the promoter and its surrounding regions being rich in CpG dinuclei. Glycolic acid also includes heteromethylated CpG sites or isolated CpG sites.

Generally, the CpG-containing nucleic acid is DNA. However, the present invention is applicable to, for example, samples containing DNA, or DNA and RNA containing mRNA, where DNA or RNA may be single-stranded or double-stranded, or DNA-RNA hybrid strands may also be included in the sample.

The "primer" or "probe" in the present invention refers to an oligonucleotide comprising a region complementary to the sequence of at least 6 consecutive nucleotides of a target nucleic acid molecule (for example, a target gene). In some embodiments, the primer or probe contains at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 relative to the target molecule. A continuous or discontinuous block of nucleotide sequence complementary regions. When the primer or probe includes a region complementary to at least x consecutive nucleotides of the target molecule, the primer or probe is at least 95% complementary to at least x consecutive nucleotides of the target molecule. In some embodiments, the primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

The "detection" in the present invention is the same as the diagnosis, in addition to the early diagnosis of colorectal tumors, it also includes the diagnosis of the middle and late stages of colorectal tumors, and also includes colorectal tumor screening, risk assessment, prognosis, disease identification, disease stage diagnosis, and Selection of therapeutic targets.

The application of colorectal tumor marker TMEM240 makes the early diagnosis of colorectal tumors possible. When it is determined that a gene methylated in a cancer cell is methylated in a cell that is clinically or morphologically normal, it indicates that the normal-looking cell is developing into cancer. In this way, colorectal cancer can be diagnosed at an early stage by methylation of the colorectal tumor-specific gene TMEM240 in cells that appear to be normal.

Among them, early diagnosis refers to the possibility of detecting cancer before metastasis, preferably before the morphological changes of tissues or cells can be observed.

In addition to the early diagnosis of colorectal tumors, the reagents/kits of the present invention are also promising for colorectal tumor screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

As an alternative embodiment for the stage of the disease, diagnosis can be made by measuring the degree of methylation of TMEM240 obtained from a sample by the progression of colorectal tumors in different stages or periods. By comparing the degree of methylation of the TMEM240 gene of nucleic acids isolated from samples of each stage of colorectal cancer with the TMEM240 gene of one or more nucleic acids isolated from samples of intestinal tissue without abnormal cell proliferation The degree of basalization can detect the specific stage of the colorectal tumor in the sample.

The following examples further illustrate the present invention:

Example 1

Select 36 stool specimens (18 cases of colorectal cancer, 18 cases of normal, all confirmed by colonoscopy or pathology), grinding and centrifugation, adding 100 µl capture magnetic beads (containing the capture sequence of the TMEM240 gene), and follow the above-mentioned technique According to the protocol operation, 15 µl of Bisulfite-transformed DNA was finally obtained. Then qMSP was performed to detect the methylation level of TMEM240.

qMSP reaction system: 25 µl (nuclease-free water 8.2 µl, 5×Colorless GoTaq Flexi Buffer 5 µl, MgCl₂ (25 mM) 5 µl, dNTPs (10 mM) 1 µl, GoTaq Hot Start polymerase 0.5 µl, Forward primer (100 µM) 0.125 µl, Reverse primer (100 µM) 0.125 µl, Probe (100 µM) 0.05 µl, DNA 5 µl). Reaction procedure: 95 ℃ 4 min, (95 ℃ 20 s, 56 ℃ 30 s, 72 ℃ 30 s) × 45 Cycles, 37 ℃ 30 s.

Finally, calculate the copy number of the gene in the specimen according to the standard curve.

The location of TMEM240 gene methylation is relatively constant, mainly located in the promoter region or nearby CpG islands. A set of capture sequences, primers and probes were designed for these regions and used in TMEM240 gene methylation detection reagents.

The capture sequence and primer probe contained in the reagent are as follows:

Capture sequence of TMEM240 (SEQ ID NO:1): 5’- GGTTGTGGACTCACCGGCCACAGTTGCAGTGGCAGACGC -3’

The qMSP primer probe of TMEM240: Forward Primer (SEQ ID NO: 2): 5’- CGCGTGTTTGATGGATATGAAC -3’ Reverse Primer (SEQ ID NO: 3): 5’- CGACCACAATTACAATAACAAACG -3’ Probe (SEQ ID NO: 4): 5’- CGTATTTGCGGGGCGAGGATC -3’

In the stool experiment, the ROC curve of TMEM240 gene detection for colorectal cancer is shown in Figure 1:

For colorectal cancer, the sensitivity of TMEM240 gene detection is 83% (15/18), the specificity is 94% (17/18), and the area under the ROC curve is 0.949 (95% CI: 0.883-1, p <0.0001)

In the stool experiment, the amplification chart of the standard curve of TMEM240 gene is shown in Figure 2:

The amplification efficiency of the standard curve is 101%, and the linearity R² = 0.999.

表1 註：「無擴增」表示無擴增曲線，無Ct數據，屬於大於界值的範圍。 [ Table 1] Raw data of stool experiment

Table 1 Note: "No amplification" means that there is no amplification curve, no Ct data, and it belongs to the range greater than the threshold.

Comparison 1

There are currently studies using QIAamp DNA Stool Mini Kit (QIAGEN) to extract DNA from stool specimens, and then use methylation-specific PCR (MSP) or quantitative methylation-specific PCR (qMSP) to qualitatively or quantitatively detect markers in the specimens The level of things. Among them, the detection of colorectal cancer by MSP requires electrophoresis, which is more inconvenient, and there is a risk of product contamination; the DNA in feces extracted by QIAamp DNA Stool Mini Kit is the total DNA of humans and bacteria, and there is very little real human tumor DNA , Is not conducive to subsequent PCR detection.

Comparison 2

Studies have shown that SFRP1 gene methylation is related to colorectal cancer, and colorectal cancer can be detected by detecting the degree of methylation of this gene in feces. In the experiment of 53 stool specimens (29 cases of colon cancer, 7 cases of adenoma, 17 cases of normal), when the specificity was 86%, 89% of colorectal tumors could be detected. (Zhang W, Bauer M, Croner RS, Pelz JO, Lodygin D, Hermeking H, Sturzl M, Hohenberger W, Matzel KE. DNA stool test for colorectal cancer: Hypermethylation of the secreted frizzled-related protein-1 gene. DISEASES OF THE COLON & RECTUM 2007; 50(10): 1618-26; discussion 1626-7.)

The methylation level of SFRP1 gene was also detected in 19 pairs of tissues and 36 stool samples. The method of extracting target genes in stool samples was the same as that in Example 1. In 19 pairs of tissue experiments, QIAamp DNA Kit (QIAGEN) was used according to the Protocol. Extract tissue DNA, and then use EZ DNA Methylation Kit (Zymo Research) to transform DNA.

Then qMSP was performed to detect the methylation level of SFRP1.

The qMSP reaction system and reaction steps were the same as the stool experiment in Example 1. Finally, calculate the methylation value of the gene in the specimen according to the standard curve: (Target/ACTB)*100. The qMSP primer probe used was the same as in Example 1.

The ROC curve of SFRP1 gene detection for colorectal cancer is shown in Figure 4:

For colorectal cancer, the sensitivity of SFRP1 gene detection is 89%, the specificity is 95%, and the area under the ROC curve is 0.972 (95% CI: 0.929-1, p <0.001).

In 36 stool experiments, the ROC curve of SFRP1 gene detection for colorectal cancer is shown in Figure 5:

For colorectal cancer, the sensitivity of SFRP1 gene detection is 67%, the specificity is 94%, and the area under the ROC curve is 0.892 (95% CI: 0.790-0.994, p <0.0001).

It can be seen that the SFRP1 gene has high detection sensitivity and specificity for colorectal cancer tissues, while its sensitivity is greatly reduced in stool samples.

The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications are also It should be regarded as the protection scope of the present invention.

no.

In order to explain the embodiments of the present invention or the technical solutions in the prior art more clearly, the following will briefly introduce the drawings that need to be used in the description of the embodiments or the prior art.

Figure 1 shows the ROC curve of TMEM240 gene detection for colorectal cancer in the stool experiment of Example 1;

Figure 2 shows the amplification chart of the standard curve of TMEM240 gene in the stool experiment of Example 1;

Figure 3 shows the ROC curve of SFRP1 gene detection for colorectal cancer in 19 pairs of tissue experiments in Comparative Example 2;

Figure 4 shows the ROC curve of SFRP1 gene detection for colorectal cancer in 36 stool experiments of Comparative Example 2.

Claims (25)

A primer pair, wherein the upstream primer has the nucleotide sequence shown in SEQ ID NO: 2; the downstream primer has the nucleotide sequence shown in SEQ ID NO: 3. An application of a TMEM240 gene methylation detection reagent in the preparation of tumor detection reagents or kits; the TMEM240 gene methylation detection reagent has a primer pair, wherein the upstream primer has the nucleotide shown in SEQ ID NO: 2 Sequence, the downstream primer has the nucleotide sequence shown in SEQ ID NO: 3; the tumor is colorectal cancer. According to the application described in claim 2, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11. As in the application described in claim 2, the sample to be tested for the detection reagent is feces. A methylation detection reagent for TMEM240 gene, comprising capture sequences, primers and/or probes for methylation detection of TMEM240 gene; the upstream primer in the primer has the nucleotide sequence shown in SEQ ID NO: 2; The downstream primer in the primer has the nucleotide sequence shown in SEQ ID NO:3. In the methylation detection reagent according to claim 5, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11. The methylation detection reagent according to claim 5, wherein the capture sequence has the nucleotide sequence shown in SEQ ID NO:1. The methylation detection reagent according to claim 5, wherein the probe has the nucleotide sequence shown in SEQ ID NO:4. A kit comprising the primer pair described in claim 1 or the methylation detection reagent described in claim 5. The kit according to claim 9, which includes: a first container, which contains a capture sequence; a second container, which contains a primer pair for amplification; and a third container, which contains a probe. An application of the primer pair described in claim 1 or the methylation detection reagent described in claim 5 in the preparation of a kit for detecting tumors; the tumor is colorectal cancer. In the application described in claim 11, the sample to be tested for the detection is feces. An application of the primer pair described in claim 1, the methylation detection reagent described in claim 5, or the kit described in claim 9 in detecting a tumor; the tumor is colorectal cancer. In the application described in claim 13, the sample for detection is feces. A tumor detection method, including: (1) detecting the methylation level of the subject's TMEM240 gene; (2) comparing the methylation level of the subject's TMEM240 gene with the methylation level of a normal control sample; ( 3) According to the increase in the methylation level of the subject's TMEM240 gene compared to the methylation level of the normal control sample, it indicates that the subject has or is at risk of developing a tumor to distinguish between normal samples and tumor samples The tumor is colorectal cancer; the methylation level is detected using the primer pair described in claim 1, or the methylation detection reagent described in claim 5, or the kit described in claim 9. According to the detection method described in claim 15, in step (1), detecting the methylation level of the subject's TMEM240 gene includes the following steps: a) extracting the DNA of the sample to be tested by the magnetic bead capture method; b) the sample to be tested The DNA is transformed with bisulfite, bisulfite or hydrazine salt; c) methylation specific quantitative PCR detection. According to the detection method of claim 16, in step a), extracting the DNA of the sample to be tested by the magnetic bead capture method includes the following steps; taking the sample to be tested in a protective solution, mixing, grinding, centrifuging, and taking the supernatant; Centrifuge, take the supernatant, add lysate and magnetic beads with specific complementary oligonucleotide capture sequence to the supernatant and incubate; After discarding part of the supernatant, wash the magnetic beads and transfer to a clean centrifuge tube, add washing solution, incubate at room temperature 100-2000 rpm for 0.5-5 min, place on a magnetic stand to aspirate the supernatant, repeat 3 times; use buffer to transfer the target gene DNA Eluted. The method according to any one of Claims 15-17, wherein the test sample type of the method is feces. According to the method described in any one of Claims 15-17, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11. A tumor detection system, comprising: (1) a methylation detection component of TMEM240 gene; (2) a data processing component; (3) a result output component; the tumor is colorectal cancer; the methylation detection component also contains such The primer pair described in claim 1, or the methylation detection reagent described in claim 5, or the kit described in claim 9. According to the detection system of claim 20, the data processing component is configured to a. receive test data of the test sample and the normal control sample; b. store the test data of the test sample and the normal control sample; c. compare the same species Types of test samples and test data of normal control samples; d. According to the comparison result, respond to the probability or possibility of the tester suffering from tumor. According to the detection system according to claim 20, the result output component is used to output the probability or possibility that the tester has a tumor. For the detection system described in claim 20, the judgment standard of the data processing component is: judging tumor specimens and normal specimens according to the cut-off value; the cut-off value of the Ct value in the stool specimen is 35, and the Ct value of the stool specimen is less than the Ct value The cutoff value of is judged to be a tumor specimen, and the Ct value of the stool specimen is greater than or equal to the cutoff value of the Ct value to be judged as a normal specimen. The detection system according to claim 20, wherein the detection sample type of the system is feces. According to the detection system according to claim 20, the sequence of the TMEM240 gene has 100% identity with the sequence shown in Genebank Accession No. NC_000001.11.

Images