TWI775169B - Lung cancer detection reagent and kit - Google Patents

Abstract

The invention belongs to the field of gene detection, and in particular relates to a lung cancer detection reagent and kit, wherein the reagent or kit includes a detection reagent for methylation of a specific nucleic acid fragment, and is used to detect the modified sequence of the specific nucleic acid fragment. Tests prove that the reagent of the invention can detect and diagnose lung cancer with high sensitivity and high specificity, and has extremely high clinical application value.

Description

Lung cancer detection reagents and kits

The invention belongs to the field of gene detection, and more particularly, the invention relates to a lung cancer detection reagent and a kit.

Lung cancer is a malignant tumor of the lung originating from the bronchial mucosa, glands or alveolar epithelium. According to the pathological type, it can be divided into: 1) small cell lung cancer (SCLC): a special pathological type of lung cancer, with obvious tendency of distant metastasis and poor prognosis, but most patients are sensitive to radiotherapy and chemotherapy; 2) Non-small cell lung cancer (NSCLC): other pathological types of lung cancer other than small cell lung cancer, including squamous cell carcinoma, adenocarcinoma, large cell carcinoma, etc. There are some differences in biological behavior and clinical course. According to the location of occurrence, it can be divided into: 1) central lung cancer: lung cancer that grows at or above the bronchial opening of the segmental lung; 2) peripheral lung cancer: lung cancer that grows beyond the bronchial opening of the lung segment .

In recent years, due to the influence of factors such as population aging, air pollution and smoking, the incidence and mortality of lung cancer in China have increased year by year. According to the "2017 China Cancer Registration Annual Report" released by the National Cancer Center, about 7 people are diagnosed every minute nationwide. Cancer, of which lung cancer incidence and mortality are the first. China has become the country with the largest number of lung cancer patients in the world, and experts predict that the number of lung cancer patients in China will reach 1 million by 2025. According to epidemiological studies, smoking is an important factor in causing lung cancer. About 80%-90% of lung cancers in the world can be attributed to smoking. Compared with non-smokers, those aged 45-64 who smoked 1-19 cigarettes a day and 20 or more cigarettes a day had a relative risk of lung cancer of 4.27 and 8.61, respectively, compared with never-smokers, long-term daily smoking of 1-19 The relative risk of dying from lung cancer was 6.14 and 10.73 for those with more than 20 lung cancers, respectively. Although the treatment technology of lung cancer is changing with each passing day, the 5-year survival rate has only increased from 4% to about 12%. The existing anti-tumor drugs can still only play a role in relieving the disease, and the average progression-free survival of patients is only extended by 3 months to 5 months. However, for patients with stage I lung cancer, the 5-year survival rate after surgery is as high as about 60% to 70%. Therefore, the early diagnosis and early operation of lung cancer is one of the most effective methods to improve the 5-year survival rate of lung cancer and reduce the mortality rate.

The current clinical auxiliary diagnosis of lung cancer mainly includes the following, but none of them can fully achieve early detection and early diagnosis:

(1) Blood biochemical examination: There is currently no specific blood biochemical examination for primary lung cancer. Lung cancer patients with elevated blood alkaline phosphatase or blood calcium should consider the possibility of bone metastasis, and elevated blood alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase or bilirubin should consider the possibility of liver metastasis.

(2) Examination of tumor markers: 1) CEA: 30% to 70% of lung cancer patients have abnormally high levels of CEA in the serum, but mainly in patients with advanced lung cancer. At present, the detection of CEA in serum is mainly used to estimate the prognosis of lung cancer and monitor the treatment process. 2) NSE: It is the first-choice marker for small cell lung cancer. It is used for the diagnosis of small cell lung cancer and monitoring the response to treatment. The reference value is different depending on the detection method and reagents used. 3) CYFRA21-1: It is the first-choice marker for non-small cell lung cancer, with a sensitivity of 60% for the diagnosis of squamous cell carcinoma of the lung. The reference value is different depending on the detection method and reagent used.

(3) Imaging examination: 1) Chest X-ray examination: should include frontal and lateral chest radiographs. In primary hospitals, frontal and lateral chest radiographs are still the most basic and preferred imaging diagnostic method for the initial diagnosis of lung cancer. Once lung cancer is diagnosed or suspected, a chest CT scan is performed. 2) CT examination: Chest CT is the most common and important examination method for lung cancer, and is used for the diagnosis and differential diagnosis, staging and follow-up of lung cancer. CT-guided lung biopsy is an important diagnostic technique for lung cancer. Conditional hospitals can use it for the diagnosis of pulmonary lesions that are difficult to characterize, as well as for patients whose clinical diagnosis of lung cancer needs to be confirmed by cytology and histology, but other methods are difficult to obtain. case. In recent years, multi-slice spiral CT and low-dose CT (LDCT) are effective screening tools to detect early lung cancer and reduce mortality. The National Lung Cancer Screening Study (NLST) has shown that LDCT can reduce 20% compared with chest X-ray screening. Lung cancer mortality. Low-dose spiral CT is recommended as an important method for early lung cancer screening, but there are many human factors and the false positive rate is very high. 3) Ultrasound examination: It is mainly used to find out whether there is metastasis in the vital organs of the abdomen and the lymph nodes in the abdominal cavity and retroperitoneum. It is also used for the examination of lymph nodes in the neck. For intrapulmonary lesions or chest wall lesions adjacent to the chest wall, cystic and solid lesions can be identified and ultrasound-guided needle biopsy can be performed; ultrasound is also commonly used for pleural effusion extraction and localization. 4) Bone scan: It has a high sensitivity in detecting bone metastases from lung cancer, but has a certain false positive rate. It can be used in the following situations: preoperative examination of lung cancer; patients with local symptoms.

(4) Other examinations: 1) Sputum cytology examination: At present, a simple and convenient non-invasive diagnosis method for lung cancer, continuous smear examination can increase the positive rate by about 60%, and it is a routine diagnosis method for suspected lung cancer cases. 2) Fiberoptic bronchoscopy: one of the most important means in the diagnosis of lung cancer, plays an important role in the qualitative localization diagnosis of lung cancer and the selection of surgical plans. It is a necessary routine inspection item for patients who are going to undergo surgical treatment. While transbronchial needle biopsy (TBNA) is beneficial for pre-treatment staging, it is technically difficult and risky, and those who need it should be transferred to a higher-level hospital for further examination. 3) Others: such as percutaneous lung biopsy, thoracoscopy biopsy, mediastinoscopy biopsy, pleural effusion cytology, etc., if there are indications, they can be used according to the existing conditions to assist the diagnosis.

Multi-slice spiral CT and low-dose CT (LDCT) in imaging examinations are effective screening tools to detect early lung cancer and reduce mortality. 20% of lung cancer mortality. It has been proved in clinical practice that the success or failure of any lung cancer screening program depends on the identification of high-risk groups. The risk prediction model integrating multiple high-risk factors has been recognized as one of the methods for identifying high-risk groups of lung cancer. Risk models further improve outcomes for patients with lung cancer by assisting clinicians in improving interventions or treatments. Although the world has recognized that screening for high-risk groups can reduce the current high mortality rate of lung cancer, the definition of high-risk groups is still an intractable problem. In order to maximize the benefit-harm ratio of lung cancer screening, the key question is how to define the high-risk population; the second is how to screen this population, including the definition of high-risk factors, the overall risk Quantitative summarization of and selection of screening benefit cut-offs.

With the rapid development of technology, tumor marker detection has become a new field of tumor diagnosis and treatment following imaging diagnosis and pathological diagnosis, which can have a significant impact on tumor diagnosis, detection, and treatment. Tumor markers can be detected in body fluids or tissues, and can reflect the presence of tumors, the degree of differentiation, prognosis estimation and personalized medicine and treatment effects. Patients with early-stage lung cancer have no obvious symptoms and are difficult to be detected by doctors and patients. In addition, there are no obvious specific markers in blood or biochemical items, so it is difficult to detect and diagnose early through conventional diagnostic methods. Early diagnosis, especially the large-scale application of population screening, is difficult.

An increasing number of studies have shown that there are two main types of mechanisms involved in tumor formation. One is the formation of mutations through changes in the DNA nucleotide sequence, the genetic mechanism. Tumor as a genetic disease has been confirmed in the field of molecular biology. Another is the mechanism of epigenetics, that is, changes in gene expression levels that do not depend on changes in DNA sequence, and its role in tumor formation has received more and more attention. The two mechanisms of genetics and epigenetics intersect with each other and jointly promote the formation of tumors. Aberrant methylation of genes can appear in the early stage of tumorigenesis, and the degree of aberrant methylation of genes increases during the progressive development of tumors. Analysis of the genomes of 98 common human primary tumors revealed at least 600 aberrantly methylated CpG islands in each tumor.

Many studies have shown that promoter aberrant methylation is a frequent early event in the development of many tumors, so the methylation status of tumor-related genes is an early sensitive indicator of tumorigenesis and is considered to be a promising tumor. Molecular biomarkers. More importantly, cancerous cells can release DNA into peripheral blood. Nanogram-level cell-free DNA exists in normal human peripheral blood. Studies have found that abnormal methylation of the promoters of tumor-related genes in tumor tissues can also be detected in peripheral blood plasma/serum and body fluids related to tumor-involved organs (such as saliva, sputum, etc.). These biological samples are relatively easy to obtain, and the DNA in them can be detected very sensitively after a large number of amplifications by PCR technology. Therefore, detecting the methylation status of the promoter regions of some tumor-related genes can be an early detection tool for tumors. Diagnosis provides very valuable information. Compared with other types of tumor molecular markers, detection of abnormal promoter methylation has more advantages. In different types of tumors, the abnormally methylated region of the promoter of a gene is the same, which is convenient for detection; in addition, compared with markers such as allele deletion, abnormal methylation is a positive signal, which is easy to detect. Distinguished from negative background in normal tissue. Esteller et al. detected the abnormal methylation status of the promoter regions of genes such as p16, DAPK, GSTP1 and MGM T in tumor tissues and serum of 22 cases of non-small cell lung cancer (NSCLC), and found that 68% (15/22) of tumor tissues Promoter methylation of at least one gene was present in at least one gene; and 11 of the 15 tissue-positive cases also detected the presence of abnormal promoter methylation in serum. Many other researchers also detected the promoter methylation of some tumor-related genes in tumor tissues and serum of patients with liver cancer, head and neck cancer, esophageal cancer and colon cancer.

The existing lung cancer detection technologies mainly have low sensitivity, high false positives, and invasiveness, and the current conventional detection technologies are difficult to detect early lung cancer.

Non-invasive detection of lung cancer, such as sputum detection, is even more difficult. Although some researchers have also studied tumor markers in the sputum of lung cancer patients, the success rate of sputum samples is low compared to the detection and evaluation of tumor markers in blood samples from other tumor patients. This is mainly due to the following reasons: ① The composition of sputum is relatively complex, and the composition and viscosity of sputum vary greatly among different groups of people under different diseases or environments; ② There are many tracheal epithelial cells and bacteria in sputum, and oral cavity For the components of non-lung cancer cells such as mucosal cells, the general sample processing method cannot effectively enrich the DNA of sufficient lung cancer origin; ③ There are many smoking patients who do not show sputum. A J Hubers et al. in "Molecular sputum analysis for the diagnosis of lung cancer" studied the past 10 literatures and showed that the median methylation degree of markers in lung cancer tissue was 48%, while the median methylation degree of sputum was 48%. The degree of methylation was 38%, and the results showed that the detection rate of methylation markers in tissues was significantly higher than that in sputum. Meanwhile, Rosalia Cirincione (Methylation profile in tumor and sputum samples of lung cancer patients detected by spiral computed tomography: A nested case–contro) reported that the detection rates of RARbeta2, P16, and RASSF1A in lung cancer tissues reached 65.5%, 41.4%, and 51.7%, respectively. %, and only 44.4%, 5%, and 5% in sputum.

At present, the missed detection rate of lung cancer is relatively high. In particular, for the type of adenocarcinoma, non-invasive detection of sputum is even more difficult, and the detection rate is extremely low. This is because most adenocarcinomas originate in the smaller bronchi, which are peripheral lung cancers, and exfoliated cells deep in the lung are more difficult to expectorate through sputum. Therefore, the current sputum detection methods for adenocarcinoma are almost zero.

In some embodiments, the present invention provides a nucleic acid fragment having at least 85% or at least 90% or at least 91% or at least 92% or at least 93% with the nucleic acid fragment shown in SEQ ID NO: 4 (hereinafter "nucleic acid fragment") Or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identity of nucleotide sequences in the preparation of lung cancer detection reagents or kits. The "application" includes the application of any part of the nucleic acid fragment shown in SEQ ID NO: 4, that is, any part of the nucleic acid fragment shown in SEQ ID NO: 4 (e.g., a smaller fragment ) in the preparation of lung cancer detection reagents or kits all fall within the protection scope of the present invention.

In some embodiments, the nucleic acid fragment of the present invention has high specificity and sensitivity for different types of lung cancer, including squamous cell carcinoma and adenocarcinoma in small cell lung cancer and non-small cell lung cancer, and has a wide range of applications, basically Can be used as a tumor marker for all lung cancers. The existing clinical markers of lung cancer are generally only suitable for the detection of one type of lung cancer, such as NSE for the diagnosis of small cell lung cancer and monitoring of treatment response, while CYFRA21-1 is the preferred marker for non-small cell lung cancer.

In some embodiments, the present invention provides a method of designing primers comprising targeting at least 85% or at least 90% or at least 91% or at least 92% or at least a nucleotide sequence as set forth in SEQ ID NO: 4 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotide sequences, the step of designing primers.

In some embodiments, the present invention also provides a primer selected from the group consisting of at least 85% or at least 90% with the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5 % or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to sequences, and their complements at least any of the .

In some embodiments, the primers are selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; and at least one pair of primers set forth in SEQ ID NO: 5 and SEQ ID NO: 2.

In some embodiments, the primers are selected from the primer pair set forth in SEQ ID NO: 1 and SEQ ID NO: 2.

In some embodiments, the present invention also provides a probe selected from the group consisting of at least 85% or at least 90% or at least 91% or at least 92% or at least the sequence shown in SEQ ID NO: 3 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to at least any of a sequence and its complement.

In some embodiments, the probe is selected from the sequence set forth in SEQ ID NO:3.

In some embodiments, the present invention also provides the use of the above primers and/or probes in the preparation of lung cancer detection reagents or kits.

The detection reagent and method for specific nucleic acid fragments provided by the present invention can very conveniently and accurately determine patients with lung cancer and benign lung diseases, and the gene detection method is expected to be transformed into a gene detection kit and serve for lung cancer screening, Clinical testing and prognostic monitoring.

"Detection" in the present invention is the same as diagnosis, in addition to the early diagnosis of lung cancer, it also includes the diagnosis of middle and advanced stage of lung cancer, and also includes lung cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stage and selection of therapeutic targets .

As an alternative embodiment of the stage of the condition, the diagnosis can be made by the progression of lung cancer at different stages or stages, which can be made by measuring the degree of methylation of the nucleic acid fragment obtained from the sample. By comparing the degree of methylation of said nucleic acid fragments isolated from samples of each stage of lung cancer to the methylation of said nucleic acid fragments in one or more nucleic acids isolated from samples without cell proliferative abnormalities The degree to which the specific stage of lung cancer in the sample can be detected.

In some embodiments, the present invention provides a lung cancer detection reagent, the reagent contains at least 85% or at least 90% or at least 91% or at least 92% or at least 93% of the nucleic acid fragment as shown in SEQ ID NO: 4. % or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to a methylation detection reagent of a nucleotide sequence.

Although, in the prior art, it has been reported that the methylation of some gene markers can be used as one of the tumor markers of lung cancer. However, there are countless reports on tumor markers of lung cancer, which can actually be used in clinical practice, but very few are used as markers for lung cancer detection. The detection reagent for specific nucleic acid fragments of the present invention has high sensitivity and specificity for lung cancer, and is very promising as a tumor marker for clinical diagnosis of lung cancer.

The "methylation detection reagent for nucleic acid fragments" includes the following: a reagent for detecting the nucleic acid fragment sequence or any smaller/shorter sequence in the nucleic acid fragment. That is to say, any detection and detection reagents performed on any site in the nucleic acid fragment (eg, a smaller fragment) all fall within the protection scope of the present invention.

Methylation occurs when an additional methyl group is added to cytosine. After being treated with bisulfite or bisulfite or hydrazine salt, cytosine will become uracil, because uracil interacts with uracil during PCR amplification. Thymine is similar to thymine and will be recognized as thymine. It is reflected in the PCR amplification sequence that the unmethylated cytosine becomes thymine (C becomes T), and the methylated cytosine (C) does not occur. Variety. The technology of PCR detection of methylated genes is usually MSP. The primers are designed for the treated methylated fragments (ie, the unaltered C in the fragment), and PCR amplification is performed. If there is amplification, it means that methylation has occurred. Amplification is not methylated.

In some embodiments, the methylation detection reagent detects the sequence of the nucleic acid fragment modified with bisulfite or bisulfite or hydrazine salt.

In some embodiments, the bisulfite-modified sequence of the nucleic acid fragment is detected.

In some embodiments, the methylation detection reagent includes primers and/or probes for methylation detection of the nucleic acid fragment shown in SEQ ID NO:4.

In some embodiments, the upstream primer of the primers has any one of the nucleotide sequences shown below:

1. Have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% with the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 5 % or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotide sequences; and

II. The complementary sequence of the sequence shown in I.

In some embodiments, the downstream primer of the primers has any of the following nucleotide sequences:

III, having at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% of the nucleotide sequence shown in SEQ ID NO: 2 or Nucleotide sequences of at least 97% or at least 98% or at least 99%, or 100% identity; and

IV. The complement of the sequence shown in III.

Reducing the missed detection rate is especially important in early cancer screening. If an early tumor screening product cannot screen out all or most of the patients, those missed will not be able to get enough risk indications, thus delaying the timing of treatment, which is a huge problem for patients. loss.

Although some lung cancer-related tumor markers have been discovered in the prior art, the sensitivity and specificity of these tumor markers cannot meet the needs due to the limitation of detection reagents or detection methods for these tumor markers. There is still a need for further research in the field of screening methods that can be practically applied to lung cancer. However, although non-invasive screening has unique advantages in sampling, it also has other limitations, such as adenocarcinoma in lung cancer, which is difficult to expectorate through sputum due to the exfoliated cells in the deep part of the lung. , Generally speaking, those skilled in the art will consider that this type of lung cancer is not suitable for non-invasive screening. On the other hand, even for other types of lung cancer, the currently reported non-invasive screening methods are difficult to meet the requirements for clinical use. Although relevant research has progressed for many years, there is still no non-invasive screening method for lung cancer that can be promoted to the clinic.

The primers are used to amplify the nucleic acid fragments. It is well known in the art that the successful design of primers is critical for PCR. Compared with general PCR, the design of primers is more critical in methylation detection. This is because the methyl sulfide reaction promotes the conversion of "C" in the DNA chain to "U", resulting in a decrease in GC content, which makes the PCR reaction difficult. The appearance of a long continuous "T" in the sequence can easily cause DNA strand breakage, making it difficult to select primers with appropriate Tm values and stability; in some embodiments, in order to distinguish between sulfurized and unsulfided and incomplete DNA requires primers with a sufficient number of "Cs", which increases the difficulty of selecting stable primers. Therefore, in DNA methylation detection, the selection of the amplified fragment targeted by primers, such as the length and position of the amplified fragment, as well as the selection of primers, all have an impact on the sensitivity and specificity of the detection. The inventors have also found through experiments that the detection effects of different amplified target fragments and primer pairs are different. Many times, it is found that some genes or nucleic acid fragments have differences in expression between tumors and non-tumors. However, there is still a long distance between their translation into tumor markers and clinical applications. The main reason is that the detection sensitivity and specificity of the potential tumor marker are difficult to meet the detection requirements due to the limitation of detection reagents, or the detection method is complicated to operate and high cost, which is difficult to be applied on a large scale in the clinic.

In some embodiments, the probe has any of the following nucleotide sequences:

V. have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least the nucleotide sequence shown in SEQ ID NO: 3 Nucleotide sequences of 97% or at least 98% or at least 99%, or 100% identity; and

VI. The complement of the sequence shown in V.

In some embodiments, the reagent contains a detection reagent including an internal reference gene.

In some embodiments, the internal reference gene is β-actin.

In some embodiments, the detection reagents for the internal reference gene are primers and probes for the internal reference gene.

In some embodiments, based on the nucleic acid fragments and detection reagents of the present invention, the detection rate of lung cancer in tissue samples with a specificity of 97.8% and a sensitivity of 71.8% can be achieved. Among the most difficult to detect adenocarcinomas, the specificity reached 97.8% and the sensitivity reached 89.5%.

In some embodiments, the detection reagent of the internal reference gene is the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7 and the probe shown in SEQ ID NO: 8.

In some embodiments, the reagent further includes at least one of bisulfite, bisulfite or hydrazine salt to modify the nucleic acid fragment, but of course it may not be included.

In some embodiments, the reagents contain one or more of DNA polymerase, dNTPs, Mg ²⁺ ions, and buffers, preferably PCR reactions that include DNA polymerase, dNTPs, Mg ²⁺ ions, and buffers System for the amplification of modified nucleic acid fragments.

The sample detected by the detection/diagnostic reagent of the present invention can be selected from at least one of bronchoalveolar lavage fluid, tissue, pleural effusion, sputum, blood, serum, plasma, urine, prostatic fluid or feces.

In some embodiments, the sample is selected from at least one of bronchoalveolar lavage fluid, tissue, and sputum.

In some embodiments, the sample is selected from at least one of bronchoalveolar lavage fluid or sputum.

In some embodiments, the present invention also provides a kit comprising the above primers, or probes, or lung cancer detection reagents.

In some embodiments, the kit includes: a first container containing primer pairs for amplification; and a second container containing probes.

The tissue targeted by the detection reagent of the present invention is selected from lung cancer tissue and adjacent normal tissue (or benign lung disease tissue).

In some embodiments, the lung cancer is selected from small cell lung cancer and non-small cell lung cancer.

In some embodiments, the non-small cell lung cancer is selected from squamous cell carcinoma, adenocarcinoma.

In some embodiments, the present invention also provides a method for detecting methylation of the nucleic acid fragment, characterized by comprising the following steps: (1) subjecting the sample to be tested to bisulfite or bisulfite or hydrazine salt treatment to obtain a modified sample to be tested; (2) using the above reagent or kit to detect the methylation status of the nucleic acid fragment on the modified sample to be tested in step (1).

As a preferred embodiment, in step (2), real-time fluorescence quantitative methylation-specific polymerase chain reaction is used for detection.

In other embodiments, the present invention also provides a detection system for lung cancer. The system described contains: (1) the nucleic acid fragment methylation detection component shown in SEQ ID NO: 4, and, (2) Result judgment system;

In some embodiments, the methylation detection component contains the above-mentioned detection reagent or kit.

In some embodiments, the result judgment component is used to output the risk of lung cancer and/or the type of lung cancer according to the methylation result of the nucleic acid fragment shown in SEQ ID NO: 4 detected by the detection system.

In some embodiments, the risk of disease is determined by comparing the methylation results of the sample to be tested and the normal sample based on the results, and when the methylation of the sample to be tested and the normal sample is significantly different or extremely significantly different, The results determined that the samples to be tested had a high risk of disease.

In some embodiments, if the nucleic acid fragment is positive for methylation, it indicates that the provider of the sample to be tested is a high-risk lung cancer or a lung cancer patient. As a preferred embodiment, the positive refers to comparing the obtained detection result with the detection result of the normal sample. When the amplification result of the sample to be tested and the normal sample has a significant or extremely significant difference, the The donor of the sample was positive.

In some embodiments, the judging criteria of the judging system include: judging lung cancer specimens and normal specimens according to a cutoff value.

In some embodiments, the methylation level of the specimen is determined according to the Cp value and/or ΔCp value of the target gene, that is, the nucleic acid fragment (ΔCp value=Cp target gene-Cp internal reference gene).

In some embodiments, the Cp value in the specimen ranges from about 35 to 39, and the ΔCp value ranges from about 4 to 12.

In some embodiments, the cutoff value for ACp values in tissue samples is about 6.5, the cutoff values for Cp values in sputum samples are about 37.6, and the cutoff values for ACp values in lavage fluid samples are about 10.

In some embodiments, if the ΔCp value of the tissue and lavage fluid samples is less than the threshold value of the ΔCp value, it is determined to be a lung cancer sample, and the ΔCp value of the tissue and lavage fluid samples is greater than or equal to the threshold value of the ΔCp value value is judged as a normal sample. If the Cp value of the sputum sample is less than the threshold value of the Cp value, it is determined as a lung cancer sample, and if the Cp value of the sputum sample is greater than or equal to the threshold value of the Cp value, it is determined as a normal sample.

In some embodiments, the present invention provides the use of the primer, the probe, or the lung cancer detection reagent, or the kit in the detection of lung cancer.

In some embodiments, the present invention provides a method for detecting lung cancer, the method comprising the steps of: detecting that a sample to be tested derived from a subject has at least 85% with the nucleic acid fragment shown in SEQ ID NO: 4 or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotides sequence, or the methylation level of its complementary sequence; the test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% with the nucleic acid fragment shown in SEQ ID NO: 4 or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to nucleotide sequences, or the methylation levels of their complements comparing; and diagnosing lung cancer based on the deviation of the methylation level of the test sample from the normal control sample.

In some embodiments, the present invention provides a method for detecting lung cancer, the method comprising the steps of: detecting that a sample to be tested derived from a subject has at least 85% with the nucleic acid fragment shown in SEQ ID NO: 4 or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotides Sequence, or the methylation level of its complementary sequence; Described detection comprises subject to be tested sample and detection and nucleic acid fragment as shown in SEQ ID NO: 4 have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to a nucleotide sequence, or its complement The detection reagent of methylation level is contacted; the test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% with the nucleic acid fragment shown in SEQ ID NO: 4 or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotide sequences, or a comparison of the methylation levels of their complements; and The test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% of the nucleic acid fragment shown in SEQ ID NO: 4 % or at least 97% or at least 98% or at least 99%, or a deviation in the methylation level of a nucleotide sequence of 100% identity, or its complement, to diagnose lung cancer.

In some embodiments, the present invention provides a method for treating lung cancer, the method comprising the steps of: detecting a sample to be tested derived from a subject having at least 85% of the nucleic acid fragment shown in SEQ ID NO: 4 or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotides Sequence, or the methylation level of its complementary sequence; Described detection comprises subject to be tested sample and detection and nucleic acid fragment as shown in SEQ ID NO: 4 have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to a nucleotide sequence, or its complement The detection reagent of methylation level is contacted; the test sample and the normal control sample have at least 85% or at least 90% or at least 91% or at least 92% or at least 93% with the nucleic acid fragment shown in SEQ ID NO: 4 or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99%, or 100% identical to nucleotide sequences, or a comparison of the methylation levels of their complements; and The nucleic acid fragment shown in SEQ ID NO: 4 in the test sample and the normal control sample has at least 85% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% Or at least 97% or at least 98% or at least 99%, or 100% identical to the nucleotide sequence, or the deviation of the methylation level of its complementary sequence, diagnosis of lung cancer; if the subject is diagnosed as a lung cancer patient, then The subject is administered a lung cancer drug treatment.

In some embodiments, the nucleotide sequence is an isolated sequence.

The technical solutions of the present invention are further described below through specific embodiments, which do not represent limitations on the protection scope of the present invention. Some non-essential modifications and adjustments made by others according to the concept of the present invention still belong to the protection scope of the present invention.

A "primer" or "probe" in the present invention refers to an oligonucleotide comprising a region complementary to a sequence of at least 6 contiguous nucleotides of a target molecule (eg, a target nucleic acid fragment). In some embodiments, at least a portion of the primer or probe sequence is not complementary to the amplified sequence. In some embodiments, the primer or probe comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 associations with the target molecule. A region of sequence complementarity of contiguous nucleotides. When a primer or probe comprises a region "complementary to at least x contiguous nucleotides of the target molecule", the primer or probe is at least 95% at least 95% complementary to at least x contiguous or discontinuous block nucleotides of the target molecule Complementary. In some embodiments, the primer or probe is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88%, at least 88%, at least 80%, at least 80%, at least 80%, at least 80%, at least 80%, at least 80%, at least 85% 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary.

In the present invention, a "normal" sample refers to a sample of the same type isolated from an individual known to be free of the cancer or tumor.

In the present invention, samples for methylation detection include, but are not limited to, DNA, or RNA, or mRNA-containing DNA and RNA samples, or DNA-RNA hybrids. The DNA or RNA can be single-stranded or double-stranded.

In the present invention, "methylation level" is the same as "methylation degree", which can usually be expressed as the percentage of methylated cytosines, which is the number of methylated cytosines divided by the number of methylated cytosines and the number of unmethylated cytosines. The sum of the number of methylated cytosines; and the method of dividing the number of methylation target genes by the number of reference genes is generally used to express the methylation level; and other methods of expressing the methylation level in the prior art.

In the present invention, "sample" is the same as "specimen".

As used herein, the term "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and/or" means that any one of the listed items can be used alone or any combination of two or more of the listed items can be used. For example, if a composition, combination, construction, etc. is described as including (or comprising) components A, B, C and/or D, the composition may include A alone; B alone; C alone; D alone ; Combinations containing A and B; Combinations containing A and C; Combinations containing A and D; Combinations containing B and C; Combinations containing B and D; Combinations containing C and D; Combinations containing A, B and C Combination; A, B, and D combination; A, C, and D combination; B, C, and D combination; or A, B, C, and D combination used.

Example 1 : detection in tissue samples

The inventors screened hundreds of gene markers and nucleic acid fragments, studied the distribution of methylation sites of each gene, and designed primers and probes for real-time fluorescence quantitative methylation-specific polymerase chain reaction (real-time fluorescence quantitative methylation-specific polymerase chain reaction). time fluorescent quantitative methylation-specific PCR, qMSP) detection. Screening is performed in tissue samples, and the β-actin gene is used as an internal reference gene, and the nucleic acid fragment shown in SEQ ID NO: 4 is finally obtained through screening and has better detection results for lung cancer. The SEQ ID NO: 4 fragment was compared with the detection effect of commonly used lung cancer detection gene markers (PCDHGA12, HOXD8), and the primer probes for each gene detection were as follows:

The detection primers and probes of the nucleic acid fragments are: SEQ ID NO: 1 Primer F: TCGTGTGTCGTCGTTCAGAC SEQ ID NO: 2 Primer R: GAAATACCCGCGAAAATACTG SEQ ID NO: 3 Probe P: FAM-AGTTTTACGTTGGAGAAGCGTCGG-BQ1

The detection primers and probes for PCDHGA12 are: SEQ ID NO: 9 PCDHGA12 Primer F: TGGTTTTTACGGTTTTCGAC SEQ ID NO: 10 PCDHGA12 Primer R: AAATTCCGAAACGCTCG SEQ ID NO: 11 PCDHGA12 Probe P: FAM-ATTCGGTGCGTATAGGTATCGCGC-BQ1

The detection primers and probes for HOXD8 are: SEQ ID NO: 12 HOXD8 Primer F: TTAGTTTCGGCGCGTAGC SEQ ID NO: 13 HOXD8 Primer R: CCTAAAACCGACGCGATCTA SEQ ID NO: 14 HOXD8 probe P: FAM-AAAACTTACGATCGTCTACCCTCCG-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 6 β-actin Primer F: GGAGGTTTAGTAAGTTTTTTGGATT SEQ ID NO: 7 β-actin Primer R: CAATAAAACCTACTCCTCCCTTA SEQ ID NO: 8 β-actin probe P: FAM-TTGTGTGTTGGGTGGTGGTT-BQ1

experiment procedure:

1 ) extract DNA

Specimens from patients diagnosed with lung cancer and those from non-lung cancer patients were collected, including paraffin tissue specimens, sputum specimens, and lavage fluid specimens, respectively. After the samples were pretreated and cells were isolated, DNA extraction was carried out according to the instructions of the HiPure FFPE DNA Kit (D3126-03) of the US Biotechnology company.

2 ) DNA retouch

Bisulfite modification was performed as described in the ZYMO RESEARCH Bio Kit EZ DNA MethylationTM KIT (D5002).

3 ) Amplification and detection [Table 1] Liquid dispensing system nucleic acid fragment PCDHGA12 HOXD8 β-actin reactive components Addition amount (μl) Addition amount (μl) Addition amount (μl) Addition amount (μl) Upstream primer (100 μM) 0.125 0.125 0.05 0.125 Downstream primer (100 μM) 0.125 0.125 0.125 0.125 Probe (100 μM) 0.05 0.05 0.05 0.05 Magnesium (25 mM) 6 6 6 6 dNTPs (10 mM) 1 1 1 1 Taq polymerase (5 unit/μl) 0.5 0.5 0.5 0.5 5X buffer 6 6 6 6 Sterilized water 11.2 11.2 11.275 11.2 template DNA 5 5 5 5 total capacity 30 30 30 30

Amplification system: see Table 2 for the amplification system. 【Table 2】 Amplification system of nucleic acid fragments and β-actin step temperature and time Number of cycles predenaturation 95ºC for 5 minutes 1 Amplify 95℃ for 15 seconds 48 58ºC for 30 seconds 72℃ for 30 seconds cool down 40℃ for 30 seconds 1 Amplification system of PCDHGA12 and HOXD8 step temperature and time Number of cycles predenaturation 95ºC for 5 minutes 1 Amplification 1 95℃ for 20 seconds 10 60ºC for 30 seconds 70℃ for 30 seconds Amplification 2 95℃ for 20 seconds 45 55℃ for 60 seconds 72℃ for 30 seconds cool down 40℃ for 30 seconds 1

4 ) Test results

Sample information: There are 169 lung tissue samples in total, including 91 normal tissue samples, 78 cancer tissue samples, 27 squamous cell carcinomas, 38 adenocarcinomas, 3 small cell carcinomas, and 4 large cell carcinomas in the 78 cancer group samples. Cases, 1 case of compound cancer, 5 cases of unclassified lung cancer, including 77 pairs of cancer and adjacent control samples.

Calculation method:

Nucleic acid fragment: Using ACTB as the internal reference gene, the methylation level of the sample is determined according to the ΔCp value of the target gene, that is, the nucleic acid fragment (ΔCp value = Cp _{nucleic acid fragment} - Cp _ACTB ). The threshold line of the nucleic acid fragment is: ΔCp value = 6.5 . When the ΔCp value of the test result is less than 6.5, it can be judged as positive, and if the ΔCp value of the test result is greater than or equal to 6.5, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 25.9, and the threshold line of HOXD8 is Cp value = 27.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than The corresponding threshold line can be judged as positive.

According to this standard, the ROC curves of nucleic acid fragments detected in all tissue samples are shown in Figure 1. The statistical results of the detection of each gene in the tissue are shown in Table 3. 【Table 3】Test results in tissues Analysis group index nucleic acid fragment PCDHGA12 HOXD8 Comparison of normal group and all cancer groups specificity 97.8% 97.8% 97.8% Sensitivity 71.8% 50.0% 53.8% Comparison between normal group and squamous cell carcinoma group specificity 97.8% 97.8% 97.8% Sensitivity 51.9% 44.4% 81.5% Comparison of normal group and adenocarcinoma group specificity 97.8% 97.8% 97.8% Sensitivity 89.5% 50.0% 50% Comparison of normal group and small cell carcinoma group specificity 97.8% 97.8% 97.8% Sensitivity 33.3% 66.7% 33.3% Comparison between normal group and large cell carcinoma group specificity 97.8% 97.8% 97.8% Sensitivity 75.0% 50.0% 0%

It can be seen from the above results that in tissue samples, the nucleic acid fragment has a sensitivity of 71.8% with a specificity of 97.8%. The nucleic acid fragment of the present invention still has high sensitivity under high specificity in tissue samples.

As a non-invasive detection sample, sputum is more important in the diagnosis of lung cancer. For this reason, the inventors detected nucleic acid fragments in sputum.

Example 2 : Detection in sputum samples

Sample information: A total of 107 sputum samples were tested, including 51 normal control samples, 56 cancer control samples, 20 squamous cell carcinomas, 8 small cell carcinomas, 20 adenocarcinomas, and 56 cancer samples. 1 case of cell carcinoma, 1 case of giant cell carcinoma, and 6 cases of unclassified lung cancer.

Experimental procedure:

In this example, the primer probe sequences of nucleic acid fragments, the primer probe sequences of β-actin, and the DNA modification are the same as those in Example 1.

a. Collect sputum samples from patients diagnosed with lung cancer and patients with non-lung cancer. After thickening with NaOH, centrifuge to separate cells, wash twice with PBS, and then use Magen DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) to extract DNA.

b. The liquid distribution system is as follows: [Table 4] Liquid distribution system nucleic acid fragment PCDHGA12 HOXD8 β-actin reactive components Addition amount (μl) Addition amount (μl) Addition amount (μl) Addition amount (μl) Upstream primer (100 μM) 0.125 0.125 0.05 0.125 Downstream primer (100 μM) 0.125 0.125 0.125 0.125 Probe (100 μM) 0.05 0.05 0.05 0.05 Magnesium (25 mM) 6 6 6 6 dNTPs (10 mM) 1 1 1 1 Taq polymerase (5 unit/μl) 0.5 0.5 0.5 0.5 5X buffer 6 6 6 6 Sterilized water 11.2 11.2 11.275 11.2 template DNA 5 5 5 5 total capacity 30 30 30 30

c. The amplification system is as follows: [Table 5] Amplification system of nucleic acid fragments and β-actin step temperature and time Number of cycles predenaturation 95ºC for 5 minutes 1 Amplify 95℃ for 15 seconds 48 58ºC for 30 seconds 72℃ for 30 seconds cool down 40℃ for 30 seconds 1 【Table 6】Amplification system of PCDHGA12 and HOXD8 step temperature and time Number of cycles predenaturation 95ºC for 5 minutes 1 Amplification 1 95℃ for 20 seconds 10 60ºC for 30 seconds 70℃ for 30 seconds Amplification 2 95℃ for 20 seconds 45 55℃ for 60 seconds 72℃ for 30 seconds cool down 40℃ for 30 seconds 1

d. The test results are as follows:

Nucleic acid fragments: ACTB is used as the internal reference gene, and the methylation level of the sample is determined according to the Cp value of the target gene, that is, the nucleic acid fragment. The threshold line of the nucleic acid fragment is: Cp value=37.6. When the Cp value of the test result is less than 37.6, it can be judged as positive, and if the Cp value of the test result is greater than or equal to 37.6, it can be judged as negative.

PCDHGA12, HOXD8: The threshold line of PCDHGA12 is Cp value = 23.48, and the threshold line of HOXD8 is Cp value = 26.4. When the detection result of each marker is greater than or equal to the corresponding threshold line, it can be judged as negative; if the detection result of the marker is less than The corresponding threshold line can be judged as positive. 【Table 7】 Test results in sputum Analysis group index nucleic acid fragment PCDHGA12 HOXD8 Comparison of normal group and all cancer groups specificity 94.1% 96.1% 96.1% Sensitivity 60.7% 16.1% 23.2% Comparison of normal group and all squamous cell carcinoma groups specificity 94.1% 96.1% 96.1% Sensitivity 55.0% 25.0% 50.0% Comparison of normal group and all adenocarcinoma group specificity 94.1% 96.1% 96.1% Sensitivity 55.0% 10.0% 5.0% Comparison between normal group and all small cell carcinoma groups specificity 94.1% 96.1% 96.1% Sensitivity 100% 12.5% 12.5%

The ROC curve of nucleic acid fragments detected in sputum samples is shown in Figure 2, and the statistical results are shown in Table 7. It can be seen from the above results that in sputum samples, when the specificity reaches 94.1%, the nucleic acid fragments The detection rate of lung cancer can reach 60.7%. Especially for small cell carcinoma, with a specificity of 94.1%, the sensitivity was as high as 100%.

Example 3 : Detection in lavage fluid samples

Sample information: A total of 176 samples of bronchoalveolar lavage fluid were tested, including 94 samples from the normal control group, 82 samples from the cancer group, 20 samples of squamous cell carcinoma, 40 samples of adenocarcinoma, and 9 samples of small cell carcinoma. , 13 cases of unspecified type of lung cancer. The primer probes for each gene detection are as follows:

The detection primers and probes for nucleic acid fragments are: SEQ ID NO: 1 Primer F: TCGTGTGTCGTCGTTCAGAC SEQ ID NO: 2 Primer R: GAAATACCCGCGAAAATACTG SEQ ID NO: 3 Probe P: FAM-AGTTTTACGTTGGAGAAGCGTCGG-BQ1

The detection primers and probes for β-actin are: SEQ ID NO: 6 β-actin Primer F: GGAGGTTTAGTAAGTTTTTTGGATT SEQ ID NO: 7 β-actin Primer R: CAATAAAACCTACTCCTCCCTTA SEQ ID NO: 8 β-actin probe P: Texas Red-TTGTGTGTTGGGTGGTGGTT-BQ2

Experimental procedure:

a. Collect bronchoalveolar lavage fluid samples from patients diagnosed with lung cancer and patients with non-lung cancer, centrifuge to separate cells, and then use the DNA extraction kit (HiPure FFPE DNA Kit, D3126-03) of Megbio to extract DNA.

b. Bisulfite modification of DNA was performed using the DNA transformation kit (EZ DNA Methylation Kit, D5002) from ZYMO RESEARCH.

c. The amplification detection system is as follows: [Table 8] Amplification system reactive components Addition amount (μl) F1 (100 μM) 0.125 R1 (100 μM) 0.125 P1 (100 μM) 0.05 β-actin-F1 (100 μM) 0.125 β-actin-R1 (100 μM) 0.125 β-actin-P2 (100 μM) 0.05 Magnesium (25 mM) 6 dNTPs (10 mM) 1 Taq polymerase (5 unit/μl) 0.5 5X buffer 6 Sterilized water 10.9 template DNA 5 total capacity 30

d. The detection system is as follows: [Table 9] Amplification system step temperature and time Number of cycles predenaturation 95ºC for 5 minutes 1 Amplify 95℃ for 15 seconds 48 58ºC for 30 seconds 72℃ for 30 seconds cool down 40℃ for 30 seconds 1

e. The test results are as follows:

Using ACTB as the internal reference gene, the methylation level of the specimen was determined according to the ΔCp value of the target gene, that is, the nucleic acid fragment (ΔCp value = Cp _{nucleic acid fragment} - Cp _ACTB ), and the threshold line of the nucleic acid fragment was: ΔCp value = 10. When the test result ΔCp value is less than 10, it can be judged as positive, and if the test result ΔCp value is greater than or equal to 10, it can be judged as negative. The test results of 176 lavage fluid samples are as follows: [Table 10] Test results Analysis group index nucleic acid fragment Comparison of normal group and all cancer groups specificity 95.7% Sensitivity 64.6% Comparison of normal group and all squamous cell carcinoma groups specificity 95.7% Sensitivity 50.0% Comparison of normal group and all adenocarcinoma group specificity 95.7% Sensitivity 72.5% Comparison between normal group and all small cell carcinoma groups specificity 95.7% Sensitivity 88.9%

The ROC curves of nucleic acid fragments detected in the lavage fluid samples are shown in Figure 3, the amplification curves are shown in Figure 4, and the statistical results are shown in Table 10. It can be seen from the above results that the detection of nucleic acid fragments has a high specificity of 95.7%, and the sensitivity reaches 64.6%; especially for the detection of adenocarcinoma, the detection sensitivity of nucleic acid fragments is as high as 72.5%. This breakthrough is of great significance for the detection of adenocarcinoma, because adenocarcinoma is generally peripheral, and due to the dendritic structure of the bronchi, the bronchoalveolar lavage fluid is not easily accessible to the alveoli or cancer tissue in the deep lung.

Example 4 Primer probe Influence on the detection effect

Primers and probes also have a great impact on the detection effect of tumor markers. During the research process, the inventors designed multiple pairs of primers and their corresponding probes to find probes that can improve the detection sensitivity and specificity as much as possible. and primers, so that the detection reagent of the present invention can be practically applied to clinical detection. Some primers and probes are shown in Table 11 below, and the detection results are shown in Table 11. 【Table 11】Primers and probes name serial number sequence effect F1 SEQ ID NO: 1 TCGTGTGTCGTCGTTCAGAC Nucleic acid fragment upstream primer R1 SEQ ID NO: 2 GAAATACCCGCGAAAATACTG Nucleic acid fragment downstream primer P1 SEQ ID NO: 3 AGTTTTACGTTGGAGAAGCGTCGG Nucleic acid fragment detection probe F2 SEQ ID NO: 5 TATCGTGTATCGTCGTTCGGAC Nucleic acid fragment upstream primer R1 SEQ ID NO: 2 GAAATACCCGCGAAAATACTG Nucleic acid fragment downstream primer P1 SEQ ID NO: 3 AGTTTTACGTTGGAGAAGCGTCGG Nucleic acid fragment detection probe A3-TqMF SEQ ID NO: 6 GGAGGTTTAGTAAGTTTTTTGGATT β-actin gene upstream primer A3-TqMR SEQ ID NO: 7 CAATAAAACCTACTCCTCCCTTA β-actin gene downstream primer A3-TqP SEQ ID NO: 8 FAM-TTGTGTGTTGGGTGGTGGTT-BQ1 β-actin gene detection probe

Each solution preparation system is consistent, and the solution preparation system is the same as Table 4; each amplification procedure is consistent, and the amplification procedure is the same as Table 5.

Different primer-probe combinations were detected in 40 sputum samples, including 15 samples from the normal control group and 25 samples from the cancer group. The primer-probe detection results of each group are as follows: [Table 12] Detection in sputum samples Results (normal group vs. all cancer group) group specificity Sensitivity F1, R1, P1 93.3% 56.0% F2, R1, P1 93.3% 52.0%

The results show that different primer pairs targeting the same region will have an impact on the detection results. In the case of the same specificity, the combination of primers and probes of F1, R1, and P1 has higher sensitivity.

none.

1 is the ROC curve of nucleic acid fragments detected in tissue samples in Example 1; Fig. 2 is the ROC curve that nucleic acid fragment detects in sputum specimen among the embodiment 2; 3 is the ROC curve detected in the nucleic acid fragment lavage fluid sample in Example 3; FIG. 4 is an amplification curve of the nucleic acid fragment in Example 3. FIG.

<110> Mainland business Guangzhou Kang Liming Biotechnology Co., Ltd.

<120> Lung cancer detection reagents and kits

<140> TW 109134191

<141> 2020-09-30

<150> CN 202010494876.1

<151> 2020-06-03

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> F1

<400> 1

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> R1

<400> 2

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> P1

<400> 3

<210> 4

<211> 851

<212> DNA

<213> Homo sapiens

<220>

<223> Target nucleic acid fragment

<400> 4

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> F2

<400> 5

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> β-actin upstream primer

<400> 6

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> β-actin downstream primer

<400> 7

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> β-actin probe

<400> 8

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PCDHGA12 upstream primer

<400> 9

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> PCDHGA12 downstream primer

<400> 10

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> PCDHGA12 probe

<400> 11

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> HOXD8 upstream primer

<400> 12

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HOXD8 downstream primer

<400> 13

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> HOXD8 probe

<400> 14

Claims (18)

A primer and probe combination, the primer is the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2; the probe is the sequence shown in SEQ ID NO: 3. A lung cancer detection reagent, comprising primers and probes; the primers are the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2; the probe is the sequence shown in SEQ ID NO: 3. A kit comprising the combination of primers and probes of claim 1; wherein, the kit comprises: a first container, which contains a primer pair for amplification; and a second container, which contains a probe. A kit comprising the lung cancer detection reagent described in claim 2; wherein, the kit comprises: a first container, which contains a primer pair for amplification; and a second container, which contains a probe. A use of the primer and probe combination according to claim 1 in the preparation of a detection reagent or kit for detecting lung cancer. A use of the lung cancer detection reagent described in claim 2 in the preparation of a detection reagent or kit for detecting lung cancer. A use of the primer and probe combination according to claim 1 in detecting lung cancer. A use of the lung cancer detection reagent according to claim 2 in detecting lung cancer. A use of the kit according to claim 3 in detecting lung cancer. According to the detection reagent according to claim 2, the sample targeted for the detection is selected from at least one of bronchoalveolar lavage fluid or sputum. According to the kit according to claim 4, the sample for the detection is selected from at least one of bronchoalveolar lavage fluid, sputum, and tissue. The use according to any one of claims 5 to 9, the sample for which the detection is directed is selected from lung At least one of bubble lavage fluid, sputum, and tissue. The detection reagent according to claim 2, wherein the lung cancer is selected from small cell lung cancer and non-small cell lung cancer. The detection reagent according to claim 13, wherein the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma. The kit according to claim 4, wherein the lung cancer is selected from small cell lung cancer and non-small cell lung cancer. The kit according to claim 15, wherein the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma. The use according to any one of claims 5 to 9, wherein the lung cancer is selected from small cell lung cancer and non-small cell lung cancer. The use according to claim 17, wherein the non-small cell lung cancer is selected from squamous cell carcinoma and adenocarcinoma.

Images