CN113981121A - A set of technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family - Google Patents
A set of technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family Download PDFInfo
- Publication number
- CN113981121A CN113981121A CN202111034566.2A CN202111034566A CN113981121A CN 113981121 A CN113981121 A CN 113981121A CN 202111034566 A CN202111034566 A CN 202111034566A CN 113981121 A CN113981121 A CN 113981121A
- Authority
- CN
- China
- Prior art keywords
- functional
- disease
- gene
- resistant
- haplotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 201000010099 disease Diseases 0.000 title claims abstract description 154
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title claims abstract description 154
- 108700028369 Alleles Proteins 0.000 title claims abstract description 109
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 62
- 235000009566 rice Nutrition 0.000 title claims abstract description 61
- 238000009412 basement excavation Methods 0.000 title claims abstract description 7
- 240000007594 Oryza sativa Species 0.000 title description 2
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 342
- 239000003550 marker Substances 0.000 claims abstract description 105
- 241000209094 Oryza Species 0.000 claims abstract description 66
- 238000001514 detection method Methods 0.000 claims abstract description 63
- 208000035240 Disease Resistance Diseases 0.000 claims abstract description 15
- 230000009897 systematic effect Effects 0.000 claims abstract description 3
- 102000054766 genetic haplotypes Human genes 0.000 claims description 124
- 239000003147 molecular marker Substances 0.000 claims description 74
- 238000000034 method Methods 0.000 claims description 45
- 238000012360 testing method Methods 0.000 claims description 35
- 238000005065 mining Methods 0.000 claims description 24
- 238000005516 engineering process Methods 0.000 claims description 17
- 238000004458 analytical method Methods 0.000 claims description 10
- 238000012163 sequencing technique Methods 0.000 claims description 9
- 238000012217 deletion Methods 0.000 claims description 5
- 230000037430 deletion Effects 0.000 claims description 5
- 238000012216 screening Methods 0.000 claims description 5
- 238000003780 insertion Methods 0.000 claims description 4
- 230000037431 insertion Effects 0.000 claims description 4
- 230000008569 process Effects 0.000 claims description 2
- 230000002068 genetic effect Effects 0.000 claims 1
- 238000009395 breeding Methods 0.000 abstract description 9
- 230000001488 breeding effect Effects 0.000 abstract description 9
- 230000004069 differentiation Effects 0.000 abstract description 7
- 238000012408 PCR amplification Methods 0.000 description 21
- 108020004414 DNA Proteins 0.000 description 20
- 238000011161 development Methods 0.000 description 17
- 238000002474 experimental method Methods 0.000 description 14
- 230000008901 benefit Effects 0.000 description 12
- 238000013461 design Methods 0.000 description 12
- 239000000969 carrier Substances 0.000 description 11
- 238000000137 annealing Methods 0.000 description 8
- 238000001976 enzyme digestion Methods 0.000 description 8
- 108091008146 restriction endonucleases Proteins 0.000 description 7
- 238000001962 electrophoresis Methods 0.000 description 6
- 102000054765 polymorphisms of proteins Human genes 0.000 description 5
- 244000052616 bacterial pathogen Species 0.000 description 4
- 230000009286 beneficial effect Effects 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 101000975474 Homo sapiens Keratin, type I cytoskeletal 10 Proteins 0.000 description 3
- 101000614627 Homo sapiens Keratin, type I cytoskeletal 13 Proteins 0.000 description 3
- 102100023970 Keratin, type I cytoskeletal 10 Human genes 0.000 description 3
- 102100040487 Keratin, type I cytoskeletal 13 Human genes 0.000 description 3
- 241001330975 Magnaporthe oryzae Species 0.000 description 3
- 238000003556 assay Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000012215 gene cloning Methods 0.000 description 3
- 108091008053 gene clusters Proteins 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- 230000002085 persistent effect Effects 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000002864 sequence alignment Methods 0.000 description 3
- 108091092878 Microsatellite Proteins 0.000 description 2
- 230000000680 avirulence Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000003776 cleavage reaction Methods 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 230000029087 digestion Effects 0.000 description 2
- 230000007613 environmental effect Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 238000002372 labelling Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000007017 scission Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 108010054576 Deoxyribonuclease EcoRI Proteins 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 241001123946 Gaga Species 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 230000010429 evolutionary process Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000003976 plant breeding Methods 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 108091033319 polynucleotide Proteins 0.000 description 1
- 102000040430 polynucleotide Human genes 0.000 description 1
- 239000002157 polynucleotide Substances 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family, which sets a secondary detection marker according to the existence of clear functional haplotype-disease-resistant allele secondary differentiation of the gene family. The technical system can be used for identifying and excavating rice blast Pi63 disease-resistant allele family functional genes and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a technical system which has inclusiveness and can accurately identify and mine a rice blast Pi63 disease-resistant allele family.
Background
Rice is one of the most important food crops in the world, and rice blast caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious obstacles to rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance relies on direct identification of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and identification results are easy to cause errors. In particular, the disease-resistant genes have the problems of overlapping resistance spectrums, coverage and the like due to gene interaction, and the direct selection efficiency of the phenotypes aggregated target genes of the same type is very low or even impossible. With the development of molecular marker identification technology, the application value and the prospect of the technology are more and more concerned due to the advantages of accuracy, reliability, no environmental influence and the like. In plant breeding, by developing molecular markers closely linked with target genes, particularly developing functional specific molecular markers in genes, the reliability of selection of the target genes is high, and the purposiveness and efficiency of breeding work are greatly accelerated.
Generally, in the long military competition process of host plant disease-resistant genes and pathogenic bacteria avirulence genes, the disease-resistant genes generate new disease-resistant specificity in the form of multiple-allele family (multiple-allele family) or gene cluster (gene cluster) with the lowest evolution cost, so that the rapid variation of the avirulence genes can be followed. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a broad-spectrum persistent resistance gene family used for a long time in breeding programs, it will further differentiate into alleles (functional alleles) with different disease resistance specificities in functional haplotypes (Zhai et al 2011, New Phytolist, 189: 321-.
There are obvious and clear nucleotide polymorphisms including Single Nucleotide Polymorphisms (SNPs) and polynucleotide polymorphisms (differentiated genomic regions) and insertions/deletions (insertions/deletions) in the secondary evolutionary processes of the above-mentioned "functional haplotype-disease resistance alleles". Herein, nucleotide polymorphisms within functional genes are collectively referred to as functional nucleotide polymorphisms. Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene family, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene families simultaneously. Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1(Pi37 family), 2(Pi63 family), 6(Pi2/Pi9 family), 8(Pi36 family), 9(Pii family), 11(Pik family) and 12(Pita family) (Sharma et al 2012, Agricultural Research,1: 37-52; Liu and Wang 2016, National Science Review,3: 295-.
Broad-spectrum persistent field resistance genes (QTL) Pi63 (formerly Pikahei-1; located on the long arm of chromosome 4) derived from the local upland rice variety Kahei of Kyushu, Japan are one of the most important broad-spectrum persistent field resistance genes (Xu et al 2008, therapeutic and Applied Genetics,117: 997-. However, since the gene was isolated and cloned, no functional specific molecular marker was developed in the gene, and the currently used molecular markers still stay in 2 linked markers: (RM6669,RM17496(ii) a Journal of Genetics,98: 73; underlining the used markers).
As described above, since Pi63 is a broad-spectrum durable field resistance gene similar to the major gene, under the continuous and strong selective pressure of rice blast fungus, functional haplotype-disease resistance allele and other secondary evolutionary levels are generatedComplex and diverse variations. However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the molecular markers used so far still stay at 2 linked markers: (RM6669,RM17496) The detection accuracy of co-separation (synchronous separation) with the target gene is not achieved, and clear comparability, logicality and inclusiveness among the target genes cannot be formed. This gives rise to 3 prominent and realistic problems: (1) any molecular marker which is not designed based on the evolution hierarchy is difficult to identify in a complex genome region, a complex gene family is easy to generate sequencing errors and the like; (2) any single molecular marker which is not designed based on the evolution hierarchy is difficult to avoid the problem of false positive of the marker due to the technical limitation of the molecular marker (the same specific fragment/locus does not represent that the test variety contains the gene completely consistent with the target gene); (3) any molecular marker which is not designed based on the evolution hierarchy is difficult to form a technical system with compatibility and comparability, so that new genes are continuously mined, identified and named in a complex gene family, and the problems of 'homonymous heterogeneous genes' and 'true and false target genes' which are easily generated in the complex gene family are identified.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a technical system which is inclusive and can accurately identify and mine the rice blast Pi63 disease-resistant allele family. The technical system sets a secondary detection marker according to the clear secondary differentiation of functional haplotype-disease-resistant allele and the like of the gene family; the optimal haplotype specific molecular marker combination for functional haplotype/non-functional haplotype detection is Pi63-F/NG932AAnd Pi63-F/NIndel(4562)(ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pi63-KH of functional haplotype is Pi63-KHT1699C(ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pi63-9311 of functional haplotype is Pi63-9311T280C(ii) a Optimal target gene specificity for disease resistance allele Pi63-ZS detection of its functional haplotypeThe sex molecule label is Pi63-ZST1260C(ii) a The optimal target gene specific molecular marker for detecting the disease-resistant allele Pi63-IR64 of the functional haplotype is Pi63-IR64A1394G(ii) a The optimal target gene specific molecular marker combination for detecting the disease-resistant allele Pi63-MH of the functional haplotype is Pi63-MH/KHA2257GAnd Pi63-KHT1699C(ii) a The optimal target gene specific molecular marker combination for detecting the disease-resistant allele Pi63-TTP of the functional haplotype is Pi63-TTP/IR64G1604CAnd Pi63-IR64A1394G(ii) a The identification result of any detection marker which is not qualified by the technical system is not the corresponding target gene, so that the detection marker is inferred to be a possible new allele of the gene family.
The second purpose of the invention is to provide a method for comparing the sequences of the disease-resistant gene family of rice blast Pi63 and identifying the specific sequences thereof.
The third objective of the invention is to provide a functional/non-functional haplotype-specific molecular marker of rice blast Pi63 disease-resistant gene family and an identification method thereof.
The fourth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-KH of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The fifth purpose of the invention is to provide a specific molecular marker of disease-resistant allele Pi63-9311 of functional haplotype of rice blast Pi63 disease-resistant gene family and an identification method thereof.
The sixth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-ZS of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The seventh object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-IR64, which is a functional haplotype of the rice blast Pi63 disease-resistant gene family, and a method for identifying the same.
An eighth object of the present invention is to provide a specific molecular marker for a disease-resistant allele Pi63-MH, which is a functional haplotype of the rice blast Pi63 disease-resistant gene family, and a method for identifying the same.
The ninth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-TTP of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The tenth purpose of the invention is to provide the application and the example of screening the true and false specific genome sequence and the target gene (Pi63-KH vs Pi63-MH) from the gene family by using the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pi63 disease-resistant allele family.
The eleventh purpose of the invention is to provide application and an example of screening true and false target genes (Pi63-TTP vs Pi63-IR64) from the gene family by using the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pi63 disease-resistant allele family.
The twelfth purpose of the invention is to provide an application and an example for identifying and mining new and old disease-resistant alleles from Guangdong province rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pi63 disease-resistant allele families.
The thirteenth purpose of the invention is to provide the application and the example for identifying and mining the new and old disease-resistant alleles from Guangxi autonomous region rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pi63 disease-resistant allele families.
The fourteenth purpose of the invention is to provide an example of comparing the identification ability of the technical system which is used for identifying and mining the rice blast Pi63 disease-resistant allele family and other marking techniques by utilizing one set of the invention.
The technical solution of the present invention for achieving the above object is as described in the claims and the embodiments.
The scheme of the invention has the following beneficial effects: the technical system can be used for identifying and excavating rice blast Pi63 disease-resistant allele family functional genes and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Drawings
FIG. 1 is a schematic diagram of the development and application of a system for identifying and mining the disease-resistant allele family of rice blast Pi 63.
FIG. 2 sequence comparison of Pi63 disease resistance gene family and identification of its specific sequence. Wherein,
cloned Pi63-KH (donor variety Kahei; Xu et al 2014, Molecular Breeding,34: 691-: AB 872116.1; for the convenience of sequence alignment analysis, 7 sequencing reference varieties 93-11, IR8, Minghui63 (Minghui 63, MH), Shuhui 498(Shuhui 498), Zhenshan97 (ZHENHAN 97, ZS), IR64, Tetep (Tetep, TTP), and 4 sequencing reference varieties Nipponbare (Nipponbare), Shennong 265(Shennong 265) which are presumed to be carriers of functional genes were added; suijing18 (Suijing 18), a genome sequence corresponding to the situation of love (Hitomebore);
all validated haplotypes and allele-specific genomic differentiation regions or SNPs have been numbered (in order of marker usage) and are labeled in green (see details in FIGS. 2-9).
In particular, since the above-mentioned 12 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pi63 disease-resistant gene family and their marker information in conjunction with FIGS. 3-9.
FIG. 3 development and application of functional/non-functional haplotype-specific molecular markers of Pi63 disease-resistant gene family
3 a-b 2 haplotype-specific optimal SNPs and genome differentiation regions;
functional haplotype variety: CK1, Kahei; CK2, 93-11; CK3, IR 8; CK4, Tetep; CK5, Tadukan; CK6, IR 64; CK7, Zhenshan 97; CK8, Minghui 63; CK9, Shuhui 498;
non-functional haplotype variety: CK10, Nipponbare; CK11, Shennong 265; CK12, Suijing 18; CK13, BL 1; CK14, K59; m, DL-500;
description of the symbols I: description of the labeling: F/N, functional (functional)/non-functional (non-functional); G932A, a marker-specific SNP; indel (4562), starting with specific insertions/deletions at the #4562 genomic position, and so on.
FIG. 4 development and application of functional haplotype disease-resistant allele Pi63-KH function-specific molecular marker of Pi63 disease-resistant gene family
4a:1 Pi63-KH function specific optimal SNP;
bottom band, target gene) of 14 first set of reference varieties, wherein,
the target gene variety: CK1, Kahei (Pi 63-KH);
non-target gene variety: CK2,93-11(Pi 63-9311); CK3, IR8(Pi 63-9311); CK4, Tetep (Pi 63-TTP); CK5, Tadukan (Pi 63-TTP); CK6, IR64(Pi63-IR 64); CK7, ZHENHAN 97(Pi 63-ZS); CK8, Minghui63(Pi 63-MH); CK9, Shuhui 498(Pi 63-MH); CK10, Nipponbare (Pi 63-Null); CK11, Shennong 265(Pi 63-Null); CK12, Suijing18 (Pi 63-Null); CK13, BL1(Pi 63-Null); CK14, K59(Pi 63-Null).
Specification of test varieties: the information of the 14 first reference varieties is as described above, and if not necessary, it is not repeated.
Description of the symbols II: the gene symbol is italicized and represents a functional gene; the gene symbol is a positive body and represents a marker; with Pi63-KHT1699CFor example, means a function-specific marker for the functional gene Pi63-KH, the superscript being its specific SNP; and so on;
in particular, 93-11, IR8, IR64, #1699T on TTP is a sequencing error and should be # 1699C.
FIG. 5 development and application of disease-resistant allele Pi63-9311 function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family
5a:1 Pi63-9311 function-specific optimal SNP;
the target gene variety: CK2,93-11(Pi 63-9311); CK3, IR8(Pi 63-9311);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 6 development and application of disease-resistant allele Pi63-ZS function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family
6a:1 optimal SNP for Pi63-ZS functional specificity;
the target gene variety: CK7, ZHENHAN 97(Pi 63-ZS);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 7 development and application of disease-resistant allele Pi63-IR64 function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family
7a:1 Pi63-IR64 function-specific optimal SNPs;
the target gene variety: CK6, IR64(Pi63-IR 64);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 8 development and application of disease-resistant allele Pi63-MH function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family
8 a-b 2 optimal SNP combinations with Pi63-MH functional specificity;
the target gene variety: CK8, Minghui63(Pi 63-MH); CK9, Shuhui 498(Pi 63-MH);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 9 development and application of disease-resistant allele Pi63-TTP function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family
9 a-b, 2 Pi63-TTP function-specific optimal SNP combinations;
the target gene variety: CK4, Tetep (Pi 63-TTP); CK5, Tadukan (Pi 63-TTP);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 10 shows the application and examples of screening for true and false specific genomic sequences and target genes (Pi63-KH vs Pi63-MH) using the above-described set of techniques for the inclusive and accurate identification and mining of disease-resistant allele families of rice blast Pi63, wherein,
10a, 1 Pi63-KH function-specific optimal SNP, and the alignment of reference sequences shows that the sequence of Kahei and reference varieties such as 93-11, IR8, IR64, Tetep and the like are completely consistent (1699T);
10b identification of 14 first set of reference varieties with the Pi63-KH optimal gene-specific marker developed from this SNP, the results showed that Kahei did not agree with the genotypes of the reference varieties 93-11, IR8, IR64, Tetep, etc., thus indicating that 93-11, IR8, IR64, Tetep were wrong in the sequence of this SNP and should be # 1699C;
10c, 1 Pi63-MH function-specific optimal SNP, and the alignment of the reference sequence shows that the sequence of Kahei and other varieties is inconsistent with the sequences of Minghui63 and Shuhui 498 (2257G);
10d identification of 14 first reference varieties by the Pi63-MH optimal gene-specific marker developed by this SNP, the results showed that Kahei is genotypically consistent with Minghui63 and Shuhui 498, thus indicating that Kahei is missequenced at this SNP and should be # 2257A. That is, the SNP should be the optimal SNP for the functional specificity Pi 63-MH/KH;
if judged by the #3 marker genotype alone, Kahei was inferred to contain Pi 63-KH; however, if the genotype of the #8 marker alone was judged, it was concluded that Kahei, Minghui63, Shuhui 498 all contained Pi 63-KH; kahei contains Pi63-KH, while Minghui63 and Shuhui 498 contains Pi63-MH, if judged in combination.
FIG. 11 is a diagram showing the application and example of screening true and false target genes (Pi63-TTP vs Pi63-IR64) by using the above-mentioned technical system for identifying and mining disease-resistant allele family of rice blast Pi63,
11b identification example of the optimal gene specificity marker Pi63-TTP/IR64 developed by the SNP on 14 first reference varieties, the result shows that the genotypes of Tetep and Tadukan are consistent with that of IR64, and the difference of the three is difficult to judge only by the genotype of the marker, thereby generating the big problem of 'same-name heterogeneous genes';
11d identification of 14 first reference varieties by the Pi63-IR64 optimal gene-specific marker developed by the SNP, the result shows that IR64 is a unique genotype;
thus, if the #6 and #8 markers were combined, it could be concluded that IR64 contained Pi63-IR64, while Tetep and Tadukan contained Pi63-TTP
FIG. 12 is an example of identifying and mining new and old disease-resistant alleles from a Guangdong province rice seed resource population for which target genes are unknown, using the above-described set of technical systems for identifying and mining rice blast Pi63 disease-resistant allele families with inclusion and precision. Wherein,
in particular, in order to identify alleles that do not delete non-functional haplotype varieties due to the small population size of the assay, to maintain the alignment of the data alignment (the same below);
12d:1 Pi63-ZS function-specific optimal marker [ #5, upper band, target gene (light blue); identifying 44 test varieties by using a lower band non-target gene, wherein the result shows that 12 varieties such as CV 1-2, CV 4-9, CV 20-21, CV26, CV41 and the like are Pi63-ZS carriers;
12g of 2 Pi63-TTP function-specific optimal marker combinations [ 8, upper band, target gene (green); lower band, non-target gene; #6, upper lane, non-target gene; identifying 44 test varieties by the target gene, wherein CV15 is a Pi63-TTP carrier;
12 a-g, wherein 4 test varieties such as CV3, CV19, CV34, CV36 and the like show different genotypes from all 6 control varieties by combining the results, and are inferred to be carriers (purple) of the novel Pi63 disease-resistant allele;
among these, 7 second set of reference varieties (used only for germplasm resource population identification) were, CK1, Kahei (Pi 63-KH); CK2,93-11(Pi 63-9311); CK3, Tetep (Pi 63-TTP); CK4, IR64(Pi63-IR 64); CK5, ZHENHAN 97(Pi 63-ZS); CK6, Minghui63(Pi 63-MH); CK7, Nipponbare (Pi 63-Null).
Specifically, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by independent color systems (the same below).
FIG. 13 is an example of identifying and mining new and old disease-resistant alleles from Guangxi province rice species resource populations with unknown target genes using the above-mentioned set of technical systems for identifying and mining rice blast Pi63 disease-resistant allele families with inclusion and precision. Wherein,
13d:1 Pi63-ZS function-specific optimal marker [ #5, upper band, target gene (light blue); lower band, non-target gene ] identifies 52 test varieties, and the result shows that 4 varieties such as CV50, CV 59-60, CV63 and the like are Pi63-ZS carriers;
13 a-g, wherein 4 test varieties such as CV53, CV55, CV57, CV61 and the like show different genotypes from all 6 control varieties by combining the results, and are inferred to be carriers (purple) of the novel Pi63 disease-resistant allele;
the information for the 7 second reference cultivars is described above.
FIG. 14 is a set of comparative examples of the capability of identifying the functional genes of the Pi63 disease-resistant gene family and other marker technologies in the invention
14a 1-7, the result of the identification of 14 first set of reference varieties by the technical system of the invention shows that CK 1-9 is a functional haplotype variety, wherein;
CK1 is Pi63-KH carrier; CK 2-3 is Pi63-9311 carrier; CK 4-5 is Pi63-TTP carrier; CK6 is Pi63-IR64 carrier; CK7 is Pi63-ZS carrier; CK 8-9 is Pi63-MH carrier;
14b identification of 14 first reference varieties by other marker technology (Xu et al 2008, the scientific and Applied Genetics,117: 997-1008; Xu et al 2014, Molecular Breeding,34: 691-700; Yadav et al 2019, Journal of Genetics,98:73), (i) the result of the detection of marker RM6629 shows that the genotypes of CK1, CK 8-9 are the same and are presumed to be Pi63-KH carriers (similar to those marked by our party # 7), and other varieties are not judged (if only 1 marker and only 1 Pi63-KH carrier are used as CK); (iv) the result of the detection of marker RM17496 shows that it is still difficult to adjust PCR amplification several times with CK1, so that no judgment can be made.
The information for the 14 first set of reference varieties is as described above.
And (4) conclusion: the technical system of the present invention has remarkable advantages.
FIG. 15 is an example of a set of secondary markers of the present invention with a technical system for the inclusive and accurate identification and mining of alleles of the rice blast Pi63 disease resistance gene family.
Detailed Description
The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
All rice varieties used in the examples: first set of reference varieties CK 1-14 and second set of reference varieties CK 1-7 (as described above); and the test varieties CV 1-96 are collected and stored in the applicant's laboratory, and are commonly used in the research field and have been disclosed in the above-mentioned documents [ ZHai et al 2011, New Phytologist 189:321-334, https:// nph.onlinezolibrary.wiley.com ]; hua et al.2012, theractical and Applied Genetics 125:1047-1055,https://www.springer.com/journal/122(ii) a Snow plum, 2021, master paper of south china university of agriculture (no relevant core information for labeling is disclosed); annex charts are available at the respective magazine web sites ].
The technical route diagram developed and applied by the patent is shown in figure 1.
Example 1 sequence comparison of the Rice blast Pi63 disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 9)
First, experiment method
Using the cloned sequence of Pi63-KH (genbank ab872116.1), 7 sequencing reference varieties 93-11, IR8, Minghui63 (Minghui 63, MH), Shuhui 498(Shuhui 498), Zhenshan97 (Zhenshan 97, ZS), IR64, Tetep (Tetep, TTP), and 4 sequencing reference varieties nipponica (Nipponbare 265) presumed to be non-functional gene carriers were retrieved and downloaded from public databases; suijing18 (Suijing 18) is shown in the genome sequence corresponding to the situation of Ottomebore (Hitomebore).
The range of the individual genes ATG-TAG is annotated with reference to NCBI.
Sequence comparison analysis was performed by conventional bioinformatics methods.
Second, experimental results
The sequence comparison results are shown in FIGS. 2-9, and the results show that:
(1) the Pi63 disease-resistant gene family has obvious genome differentiation (typical positions are shown as the marks # 1 and #2 in figure 3) of functional haplotypes (8 reference sequences of the 8 disease-resistant reference varieties) and non-functional haplotypes (4 reference sequences of the 4 disease-sensitive reference varieties);
(2) the alleles of the Pi63 resistance gene family have individual function-specific SNPs and their combinations (typical positions are shown by the markers # 3 to #8 in the markers FIG. 4 to 9).
Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pi63 disease-resistant gene family (FIG. 3)
First, experiment method
The experimental procedures of this example are described in the papers published by the Applicant (Yuan et al 2011, the or Applied Genet 122: 1017-.
The following references are the same as those described above and need not be repeated.
Briefly described, the following steps:
(1) design of haplotype-specific molecular markers: according to the alignment result of the Pi63 disease-resistant gene family sequence, aiming at 1 SNP and 1 Indel of the specificity of the functional/non-functional haplotype; for SNP, according to the design principle of CAPS and dCAPS (derived dCelegant polymorphism primers; New et al 2002, Trends in Genetics 18: 613-; then, the Primer design software Primer 5.0 is used for confirming the label design;
for Indel, the primer design software was used for the design as described above.
The following molecular markers and primer design procedures are the same as those described above and are not repeated herein.
For convenience of description, the symbols are designated as #1 and #2, respectively (the same applies below); the primer sequences are as follows:
for the #1 marker (upper band, functional haplotype; lower band, non-functional haplotype):
SEQ ID NO.1(Pi63-F/NG932A-F；5’-3’)：
GAACCCAAGGTGTATGGGAGAGATGCACTTA；
SEQ ID NO.2(Pi63-F/NG932A-R；5’-3’)：
TGATCTCGGTATACAAATCTAGCAAGTGTTG。
for the #2 marker (upper band, non-functional haplotype; lower band, functional haplotype):
SEQ ID NO.3(Pi63-F/NIndel(4562)-F；5’-3’)：
CTGAGATCTTGTCCCGACTGGAAAATCT；
SEQ ID NO.4(Pi63-F/NIndel(4562)-R；5’-3’)：
TCGCACCACGCTTGCTTCGTCCAG。
(2) amplification of haplotype-specific molecular markers: and carrying out PCR amplification on the 14 first sets of reference varieties by using the 2 sets of primers. The PCR amplification system (20.0. mu.L) was as follows:
[ the following PCR amplification System is the same as that described above, and is not repeated therein ]
The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then PCR amplification for 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate according to the object to be detected) [ 94 ℃ denaturation for 30sec, annealing for 30sec (#1/52 ℃, #2/61 ℃), extension at 72 ℃ for 25-30 sec (which can be adjusted as appropriate according to the object to be detected) ], and finally extension at 72 ℃ for 5min, and the PCR product is stored in a refrigerator at 4 ℃ for later use.
[ except for the annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated
(3) Enzyme digestion of haplotype specific molecular markers: for CAPS or dCAPS marker such as the #1 marker, the PCR product was first extracted and digested with the corresponding restriction enzyme (#1, AflII), and the reaction system (10.0. mu.L) was as follows:
after the digestion is carried out for 5 hours at 37 ℃, 10 mu L of 10x loading is added into each tube of digestion products and the mixture is mixed evenly for standby.
[ the enzyme digestion system of PCR amplification products is the same as that described above, and will not be repeated here ]
(4) Detection of haplotype-specific molecular markers:
for the cleavage marker (#1), the above cleavage product was taken out and detected according to the following procedure;
for the restriction-free tag (#2), 0.25. mu.L of the above PCR product was removed, and 0.25. mu.L of ddH was added2Mixing O and 5 μ L10 x loading, and keeping；
And (3) detection procedures: 1.5-2.0 mul of the product is sampled by a microsyringe and electrophoresed on 10% -12% modified polyacrylamide gel (250V, 20-120 min; adjusted according to the detected object), and then the molecular marker is photographed and recorded according to the conventional detection method.
[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]
Second, experimental results
The size of each molecular marker is shown in fig. 3, and the results show that the 14 first set of reference varieties present clear genotypes (haplotypes):
functional haplotype variety: CK1, Kahei; CK2, 93-11; CK3, IR 8; CK4, Tetep; CK5, Tadukan; CK6, IR 64; CK7, Zhenshan 97; CK8, Minghui 63; CK9, Shuhui 498;
non-functional haplotype variety: CK10, Nipponbare; CK11, Shennong 265; CK12, Suijing 18; CK13, BL 1; CK14, K59; m, DL-500.
Specification of test varieties: the information of the 14 first reference varieties is as described above, and if not necessary, it is not repeated.
Example 3: development and application of disease-resistant allele Pi63-KH function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 4)
First, experiment method
(1) Design of Pi63-KH function-specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 1 SNP is selected to be designed into a Pi63-KH function specific molecular marker Pi63-KHT1699C(#3 marker); the primer sequences are as follows:
for the #3 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.5(Pi63-KHT1699C-F；5’-3’)：
ACATTGGAGGACAGTTCAGG；
SEQ ID NO.6(Pi63-KHT1699C-R；5’-3’)：
CCAGTGATCCTCTGGAAACG。
(2) detection of Pi63-KH function-specific molecular marker: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #3/55 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, performing enzyme digestion according to the experimental procedure by using a restriction enzyme MboII, and performing electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the respective molecular markers are shown in FIG. 4, and the results show that the Pi63-BL function-specific molecular marker can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK1, Kahei (Pi 63-KH);
non-target gene variety: the remaining 13 first set of reference varieties;
in particular, 93-11, IR8, IR64, #1699T on TTP is a sequencing error and should be # 1699C. Example 4: development and application of disease-resistant allele Pi63-9311 function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (figure 5)
First, experiment method
(1) Design of Pi63-9311 function-specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequence, selecting the optimal 1 SNP to design the Pi63-9311 function-specific molecular marker Pi63-9311T280C(#4 marker); the primer sequences are as follows:
for the #4 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.7(Pi63-9311T280C-F；5’-3’)：
CCAATCACTGGGAAGTCTAAGAGA；
SEQ ID NO.8(Pi63-9311T280C-R；5’-3’)：
CCTATGTCATTTAGCTGCTCTCAAGT。
(2) detection of Pi63-9311 function-specific molecular markers: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #4/55 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental procedure by using the restriction enzyme HpaII, and carrying out electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the individual molecular markers are shown in FIG. 5, and the results show that the Pi63-9311 function-specific molecular marker can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK2,93-11(Pi 63-9311); CK3, IR8(Pi 63-9311);
non-target gene variety: the remaining 12 first reference varieties.
Example 5: development and application of disease-resistant allele Pi63-ZS function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (figure 6)
First, experiment method
(1) Design of Pi63-ZS function-specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 1 SNP is selected to be designed as a Pi63-ZS function specific molecular marker Pi63-ZST1260C(#5 marker); the primer sequences are as follows:
for the #5 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.9(Pi63-ZST1260C-F；5’-3’)：
CTTATCATATTGGATGATATGTGGGAATT；
SEQ ID NO.10(Pi63-ZST1260C-R；5’-3’)：
CCTTGAAGAACAGCCAAAACTCCTTTT。
(2) detection of Pi63-ZS function-specific molecular marker: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #5/55 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, performing enzyme digestion according to the experimental program by using a restriction enzyme Eco RI, and performing electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the respective molecular markers are shown in FIG. 6, and the results show that the Pi63-ZS function-specific molecular marker can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK7, ZHENHAN 97(Pi 63-ZS);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 6: development and application of disease-resistant allele Pi63-IR64 function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 7)
First, experiment method
(1) Design of Pi63-IR64 function-specific molecular markers: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 1 SNP is selected to be designed into a Pi63-IR64 function-specific molecular marker Pi63-IR64A1394G(#6 marker); the primer sequences are as follows:
for the #6 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.11(Pi63-IR64A1394G-F；5’-3’)：
AGTGGATGGGATAAGCTGTTAGCTCCATT；
SEQ ID NO.12(Pi63-IR64A1394G-R；5’-3’)：
AGCCAAAACTCCTTTTCGTCCAGACAA。
(2) detection of Pi63-IR64 function-specific molecular markers: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #6/58 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, performing enzyme digestion according to the experimental procedure by using restriction enzyme MfeI, and performing electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the individual molecular markers are shown in FIG. 7, and the results indicate that Pi63-IR64 function-specific molecular markers can distinguish the target genes from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK6, IR64(Pi63-IR 64);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 7: development and application of disease-resistant allele Pi63-MH function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 8)
First, experiment method
(1) Design of Pi63-MH function-specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 2 SNP combinations are selected to be designed into Pi63-MH function specific molecular markers, Pi63-MH/KHA2257G(#7 marker); pi63-KHT1699C(the above # 3 mark);
in particular, the sequence and detection of the #3 marker is as described above.
The primer sequences are as follows:
for the #7 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.13(Pi63-MH/KHA2257G-F；5’-3’)：
GCGGTATCTTGAATTTATTGGTG；
SEQ ID NO.14(Pi63-MH/KHA2257G-R；5’-3’)：
GATTATTCATAGAAGTAGGTACATCAT。
(2) detection of Pi63-MH function-specific molecular marker: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #7/51 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using a restriction enzyme FokI, and carrying out electrophoresis detection, photographing and recording.
Second, experimental results
The size of each molecular marker is shown in FIG. 8, and the results show that 2 Pi63-MH function-specific molecular marker combinations can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK8, Minghui63(Pi 63-MH); CK9, Shuhui 498(Pi 63-MH);
non-target gene variety: the remaining 12 first reference varieties.
Example 8: development and application of disease-resistant allele Pi63-TTP function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 9)
First, experiment method
(1) Design of Pi63-TTP function-specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 2 SNP combinations are selected to be designed into Pi63-TTP function specific molecular markers, Pi63-TTP/IR64G1604C(#8 marker); pi63-IR64A1394G(the #6 mark described above);
in particular, the sequence and detection of the #6 marker was as described above.
The primer sequences are as follows:
for the #8 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.15(Pi63-TTP/IR64G1604C-F；5’-3’)：
TTGGAGGACAGTTCAGGACAAATGGAATT；
SEQ ID NO.16(Pi63-TTP/IR64G1604C-R；5’-3’)：
CACTGAAGGTGGAAAGGTAGATAATCGTAAC。
(2) detection of Pi63-TTP function-specific molecular marker: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #8/62 ℃ C.) and the products thereof were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using restriction enzyme EcoRI, and carrying out electrophoresis detection, photographing and recording.
Second, experimental results
The size of each molecular marker is shown in FIG. 9, and the results show that 2 Pi63-TTP function-specific molecular marker combinations can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK4, Tetep (Pi 63-TTP); CK5, Tadukan (Pi 63-TTP);
non-target gene variety: the remaining 12 first reference varieties.
Example 9: the application and example of the technical system for identifying the true-false specific genome sequence and the target gene (Pi63-KH vs Pi63-MH) by using the rice blast Pi63 disease-resistant allele family with the advantages of compatibility and accurate identification and mining (FIG. 10)
(1) As described above, the Pi63 disease-resistant allele family is a broad-spectrum durable field resistance gene similar to a major gene, and generates complex and diverse variation in the secondary evolution level of functional haplotype-disease-resistant allele under the continuous and strong selective pressure of rice blast germs;
(2)1 Pi63-KH function-specific optimal SNP (T169 1699C), alignment of the reference sequences showed complete agreement of Kahei with the sequences of the reference varieties 93-11, IR8, IR64, Tetep, etc. (1699T; FIG. 10 a);
(3) however, the gene-specific marker Pi63-KH, which is optimized for Pi63-KH, was developed from this SNPT1699CThe results of the identification of the 14 first set of reference varieties showed that the genotypes of Kahei and the reference varieties 93-11, IR8, IR64, Tetep, etc. were all inconsistent, thus indicating that the sequences of 93-11, IR8, IR64, Tetep at this SNP were wrong and should be #1699C (FIG. 10 b);
(4)1 Pi63-MH functional specific optimal SNP (A2257G), alignment of the reference sequences showed that the sequence of Kahei et al was not identical to that of Minghui63 and Shuhui 498 (2257G; FIG. 10 c);
(5) however, the gene-specific marker Pi63-MH/KH, which is optimized for Pi63-MH, was developed from this SNPA2257GThe results of the identification of the 14 first reference lines showed that Kahei was genotypically identical to Minghui63 and Shuhui 498, thus indicating that Kahei is missequenced at this SNP and should be #2257A (fig. 10 c);
as described above, Kahei was inferred to contain Pi63-KH if judged by the #3 marker genotype alone; however, if the genotype of the #8 marker alone was judged, it was concluded that Kahei, Minghui63, Shuhui 498 all contained Pi 63-KH; kahei contained Pi63-KH, while Minghui63 and Shuhui 498 contained Pi63-MH, as judged by the combination of the two (FIG. 10 d).
And (4) conclusion: the technical system of the invention has strong systematicness, logicality and inclusiveness, accurately identifies the target gene on the basis of accurately discriminating true and false specific genome sequences, and avoids generating errors of 'homonymous heterogeneous genes' and the like.
Example 10: the application and example of the above technical system for identifying true and false target genes (Pi63-TTP vs Pi63-IR64) by using the above technical system with the advantages of compatibility and accurate identification and mining of rice blast Pi63 disease-resistant allele families (FIG. 11)
(1)1 Pi63-TTP/IR64 function-specific optimal SNP, sequence alignment showed that Tetep shares 1 SNP with IR64 (G1604C; FIG. 11 a);
(2) the results of the identification of the first 14 reference varieties with the Pi63-TTP/IR64 optimized gene-specific marker developed from this SNP showed that the genotypes of Tetep and Tadukan were identical to IR64, and it was difficult to determine the identity of the three by the genotype of the marker alone (FIG. 11 b);
(3)1 Pi63-IR64 function-specific optimal SNP (A1394G; FIG. 11 c);
(4) the identification of the 14 first reference lines by the Pi63-IR64 optimal gene-specific marker developed by this SNP showed that IR64 is a unique genotype, from which it was concluded that IR64 contains the target gene Pi63-IR64 (fig. 11 d);
thus, if the #6 and #8 markers were combined, it could be concluded that IR64 contained Pi63-IR64, while Tetep and Tadukan contained Pi 63-TTP.
And (4) conclusion: the technical system of the invention has strong systematicness, logicality and inclusiveness, and can accurately identify the target gene by comparing different marked genotypes in the system, thereby avoiding errors such as 'homonymous and heterogenous genes' and the like.
Example 11: an example of identifying and mining new and old disease-resistant alleles from a Guangdong province rice variety resource population with unknown target genes by using the technical system which has the advantages of inclusion and accurate identification and mining of rice blast Pi63 disease-resistant gene family alleles (FIG. 12)
First, experiment method
(1) The technical system of the invention consists of 8 basic specific markers of secondary detection markers such as functional haplotype-disease resistance allele and the like. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above (fig. 3-9; examples 2-8), and are not repeated.
In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the population of the rice species to be tested is small, the population of the rice species to be tested is entirely reserved for detection of the disease-resistant allele in order to maintain uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 44 Guangdong province rice seed resources (CV 1-44); ZHai et al.2011, New Phytologist,189: 321-; hua et al.2012, the scientific and Applied Genetics,125: 1047-; leaf snow plum, 2021, master paper of south China university of agriculture (no public mark related core information) ], identification and excavation of Pi63 disease-resistant gene family functional genes are carried out;
a second set of reference varieties (only used for germplasm resource population identification) identified by the above 7 target genes was also taken into the trial as controls.
(3) Separating and cloning novel disease-resistant alleles by using a conventional homologous gene cloning technology based on a PCR technology (Zhai et al 2011, New Phytologist,189: 321-334; Hua et al 2012, the or Appl Genet 125:1047-1055), sequencing and logging in GenBank;
in particular, according to the rules of GenBank, all the registered gene sequences are genetically annotated (annotated) to ensure their integrity and readability and are thus functional genes.
Second, experimental results
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 44 test varieties were classified as (FIG. 12 a; red marker, functional haplotype; black marker, non-functional haplotype):
functional haplotype variety: 24 varieties of CV 1-9, CV 11-12, CV 14-15, CV 18-21, CV23, CV26, CV 31-32, CV34, CV36, CV41 and the like;
non-functional haplotype variety: 20 varieties such as CV10, CV13, CV 16-17, CV22, CV 24-25, CV 27-30, CV33, CV35, CV 37-40 and CV 42-44.
(2) In the secondary marker-based detection of disease-resistant alleles, 24 functional haplotype test varieties were further identified as:
the gene of interest Pi63-KH carries the variety (FIG. 12 b; red marker): none;
the gene of interest Pi63-9311 carries the variety (FIG. 12 c; blue designation): 5 varieties of CV 11-12, CV23, CV 31-32 and the like;
the gene of interest Pi63-ZS carries the breed (FIG. 12 d; light blue designation): 12 varieties of CV 1-2, CV 4-9, CV 20-21, CV26, CV41 and the like;
the gene of interest Pi63-IR64 carried the variety (FIG. 12 e; light red designation): 1 variety, CV14, etc.;
the target gene Pi63-MH carried the variety (FIG. 12 f; light green designation): 1 variety, CV18, etc.;
the target gene Pi63-TTP carries the variety (FIG. 12 g; green designation): 1 variety, CV15, etc.;
unknown novel disease-resistant allele Pi63-AZZ carrying varieties (FIGS. 12 a-g; purple designation): 3 varieties (same genotype) such as CV3, CV19 and CV 34;
unknown novel disease-resistant alleles Pi63-YLZ carry varieties (FIGS. 12 a-g; purple designation): CV36, and the like.
Specifically, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by independent color systems (the same below).
(3) 2 novel disease-resistant alleles such as Pi63-AZZ (GenBank MZ983627) and Pi63-YLZ (GenBank MZ983628) are separated and cloned by using a conventional homologous gene cloning method based on a PCR technology and taking CV3(Aizizhan, AZZ) and CV36(Yuekuzhan, YLZ) as representatives.
This example demonstrates that the present technology system has strong compatibility and comparability, since 24 functional haplotype varieties are first identified in the rice resource population of Guangdong province with unknown target genes; then 5 identified target genes Pi63-9311, Pi63-ZS, Pi63-IR64, Pi63-MH, Pi63-TTP, in addition to 2 novel disease-resistant alleles Pi63-AZZ, Pi63-YLZ were further identified.
Example 12: an example of identifying and mining new and old disease-resistant alleles from Guangxi autonomous region rice seed resource population with unknown target genes by using the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pi63 disease-resistant gene family alleles (FIG. 13)
First, experiment method
(1) As described above, the technical system of the present invention is composed of 8 basic specific markers of secondary detection markers such as "functional haplotype-disease resistance allele".
Likewise, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the population of the rice species to be tested is small, the population of the rice species to be tested is entirely reserved for detection of the disease-resistant allele in order to maintain uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 52 Guangxi autonomous region rice seed resources (CV 45-96); leaf snow plum, 2021, master paper of south China university of agriculture (no public mark related core information) ], identification and excavation of Pi63 disease-resistant gene family functional genes are carried out;
the 7 second set of reference cultivars were also included as controls in the trial.
(3) The novel disease-resistant allele is separated and cloned by utilizing the conventional homologous gene cloning technology based on the PCR technology and sequenced.
Second, experimental results
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 52 test varieties were classified as (FIG. 13 a; red marker, functional haplotype; black marker, non-functional haplotype):
functional haplotype variety: 24 varieties of CV 45-47, CV 50-51, CV53, CV 55-64, CV 71-73, CV 76-77, CV82, CV93 and CV 96;
non-functional haplotype variety: 28 varieties including CV 48-49, CV52, CV54, CV 65-70, CV 74-75, CV 78-81, CV 83-92 and CV 94-95.
(2) In the secondary marker-based detection of disease-resistant alleles, 24 functional haplotype test varieties were further identified as:
the gene of interest Pi63-KH carries the variety (FIG. 13 b; red label): none;
the gene of interest Pi63-9311 carries the variety (FIG. 13 c; blue designation): 12 varieties of CV 45-47, CV51, CV56, CV58, CV62, CV64, CV 72-73, CV76 and CV 96;
the gene of interest Pi63-ZS carries the breed (FIG. 13 d; light blue designation): 4 varieties of CV50, CV 59-60, CV63 and the like;
the gene of interest Pi63-IR64 carried the variety (FIG. 13 e; light red designation): none;
the target gene Pi63-MH carried the variety (FIG. 13 f; light green designation): 4 varieties CV71, CV77, CV82, CV93 and the like;
the target gene Pi63-TTP carried the variety (FIG. 13 g; green designation): none;
unknown novel disease-resistant allele Pi63-AZZ carrying varieties (FIGS. 13 a-g; purple designation): 4 varieties CV53, CV55, CV57, CV61, etc. (the same genotype as that of the variety CV3, etc. of example 11).
This example further demonstrates that the present technology system has strong compatibility and comparability, since 24 functional haplotype varieties are identified first in 55 Guangxi rice species resource populations with unknown target genes; then, in 24 functional haplotype varieties, 3 determined target genes Pi63-9311, Pi63-ZS, Pi63-MH and 1 additional novel disease-resistant allele Pi63-AZZ are identified.
Example 13: one set of the invention has the advantages of compatibility, accurate identification and comparative example of the identification capability of the technical system for identifying and digging the rice blast Pi63 disease-resistant gene family functional genes and other marking technologies (figure 14)
(1) Pi63 is one of the most important broad-spectrum durable field resistance genes (Xu et al 2008, the Theoretical and Applied Genetics,117: 997-. However, since the gene was isolated and cloned, no functional specific molecular marker was developed in the gene, and the currently used molecular markers still remained in 2Linkage marker (a)RM6669,RM17496；Yadav et al.Journal of Genetics,98:73)；
The primer sequences are as follows:
for RM6669, RM17496 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.17(RM6629233259～233342-F；5’-3’)：
TAAACGGTGTGCAGCTTCTG；
SEQ ID NO.18(RM6629233259～233342-R；5’-3’)：
TATTATGGGCGGTCGCTAAC。
SEQ ID NO.19(RM17496-97198～-97029-F；5’-3’)：
CTCCTGAGAAGTGGGGACTG；
SEQ ID NO.20(RM17496-97198～-97029-R；5’-3’)：
AGTCCTCCATGCATGTGACC。
(2) the 14 first set of reference varieties were identified and compared using the 2 linked markers as the other marker technique (FIG. 14). The results show that compared with other marking technologies, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects (the secondary marking is shown in fig. 15):
(a) functional/non-functional haplotype analysis using the primary markers marked clear functional haplotype boundaries for subsequent functional gene mining and identification (FIG. 14a 1). In this example, CK 1-9 were identified as functional haplotype varieties and CK 10-14 were non-functional haplotype varieties in the 14 first set of reference varieties tested. The method is one of incomparable beneficial effects compared with other marking technologies;
(b) on the basis, the disease-resistant allele analysis is carried out by using the secondary marker, and clear and comparable functional gene boundaries are marked for the identification of each disease-resistant allele (FIG. 14a 2-7). In this example, 6 optimal function-specific markers or marker combinations were selected for each of the 6 disease-resistant alleles (Pi63-KH, Pi63-9311, Pi63-ZS, Pi63-IR64, Pi63-MH, Pi63-TTP), and were independent of each other but aligned to form a set of stringent identification systems. This is one of the incomparable benefits of other marking technologies. Specifically, the method comprises the following steps:
the technical system of the invention is composed of a set of 8 secondary detection markers such as functional haplotype-disease resistance allele, and the like, thereby accurately identifying the 6 disease resistance alleles on the basis of clearly identifying the functional/non-functional haplotype.
The other marker technique (i)2 microsatellite linked markers which are only target genes and span from the upstream # -97198 site to the downstream #233342 site; (ii) because the target gene cluster region is subjected to strong forward selection of pathogenic bacteria to generate severe genome differentiation, the 2 microsatellite markers all generate a band deletion problem; (iii) the result of the test using marker RM6629 indicates that the genotypes of CK1, CK 8-9 are the same, and are presumed to be Pi63-KH carriers (similar to the marker of our party # 7), and other varieties are not judged (if only 1 marker and only 1 Pi63-KH carrier is used as CK); (iv) the results of the test using marker RM17496 indicate that it is still difficult for the Pi63-KH carrier to modulate PCR amplification many times, and therefore no judgment can be made.
And (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with other marking technologies.
The above examples demonstrate the remarkable ability and effect of the functional gene of Pi63 disease resistance gene family, which is included and precisely identified and mined in the technical system of the present invention.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> southern China university of agriculture
<120> a set of technical systems with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele families
<130>
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 31
<212> DNA
<213> marker Pi63-F/NG932A-F
<400> 1
gaacccaagg tgtatgggag agatgcactt a 31
<210> 2
<211> 31
<212> DNA
<213> marker Pi63-F/NG932A-R
<400> 2
tgatctcggt atacaaatct agcaagtgtt g 31
<210> 3
<211> 28
<212> DNA
<213> marker Pi63-F/NIndel (4562) -F
<400> 3
ctgagatctt gtcccgactg gaaaatct 28
<210> 4
<211> 24
<212> DNA
<213> marker Pi63-F/NIndel (4562) -R
<400> 4
tcgcaccacg cttgcttcgt ccag 24
<210> 5
<211> 20
<212> DNA
<213> marker Pi63-KHT1699C-F
<400> 5
<210> 6
<211> 20
<212> DNA
<213> marker Pi63-KHT1699C-R
<400> 6
<210> 7
<211> 24
<212> DNA
<213> marker Pi63-9311T280C-F
<400> 7
ccaatcactg ggaagtctaa gaga 24
<210> 8
<211> 26
<212> DNA
<213> marker Pi63-9311T280C-R
<400> 8
cctatgtcat ttagctgctc tcaagt 26
<210> 9
<211> 29
<212> DNA
<213> marker Pi63-ZST1260C-F
<400> 9
cttatcatat tggatgatat gtgggaatt 29
<210> 10
<211> 27
<212> DNA
<213> marker Pi63-ZST1260C-R
<400> 10
ccttgaagaa cagccaaaac tcctttt 27
<210> 11
<211> 29
<212> DNA
<213> marker Pi63-IR64A1394G-F
<400> 11
agtggatggg ataagctgtt agctccatt 29
<210> 12
<211> 27
<212> DNA
<213> marker Pi63-IR64A1394G-R
<400> 12
agccaaaact ccttttcgtc cagacaa 27
<210> 13
<211> 23
<212> DNA
<213> marker Pi63-MH/KHA2257G-F
<400> 13
gcggtatctt gaatttattg gtg 23
<210> 14
<211> 27
<212> DNA
<213> marker Pi63-MH/KHA2257G-R
<400> 14
gattattcat agaagtaggt acatcat 27
<210> 15
<211> 29
<212> DNA
<213> marker Pi63-TTP/IR64G1604C-F
<400> 15
ttggaggaca gttcaggaca aatggaatt 29
<210> 16
<211> 31
<212> DNA
<213> marker Pi63-TTP/IR64G1604C-R
<400> 16
cactgaaggt ggaaaggtag ataatcgtaa c 31
<210> 17
<211> 20
<212> DNA
<213> flags RM 6629233259-233342-F
<400> 17
<210> 18
<211> 20
<212> DNA
<213> flags RM 6629233259-233342-R
<400> 18
<210> 19
<211> 20
<212> DNA
<213> marker RM 17496-97198-97029-F
<400> 19
<210> 20
<211> 20
<212> DNA
<213> markers RM 17496-97198-97029-R
<400> 20
Claims (6)
1. A set of technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family is characterized in that the technical system consists of a functional haplotype-disease-resistant allele secondary detection marker and is advanced step by step, and whether a test variety carries a target gene or not is determined by the integrated result of the test variety;
specifically, the technical system comprises:
(1) the functional haplotype/non-functional haplotype detection process of the gene family:
defining genome regions with clearly differentiated haplotypes and SNPs by sequence comparison of functional genes/non-functional genes in families; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety; in subsequent tests, non-functional varieties can be excluded;
(2) the detection procedure of disease-resistant allele Pi63-KH of functional haplotype of the gene family:
defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 1 optimal functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi63-KH gene carrier should belong to the functional haplotype of Pi63 disease-resistant gene family and the genotype of the function-specific molecular marker is the same as that of Pi63-KH reference variety (individual); on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pi 63-KH;
(3) the detection procedure of disease-resistant allele Pi63-9311 of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi63-9311 gene carrier should belong to functional haplotype of Pi63 disease-resistant gene family, and the genotype of the function-specific molecular marker is the same as that of Pi63-9311 reference variety (individual); on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pi 63-9311;
(4) the detection procedure of disease-resistant allele Pi63-ZS of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi63-ZS gene carrier should belong to functional haplotype of Pi63 disease-resistant gene family, and the genotype of the function-specific molecular marker is the same as that of Pi63-ZS reference variety (individual); on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pi 63-ZS;
(5) detection procedure for disease resistance allele Pi63-IR64 of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pi63-IR64 gene carrier should belong to a functional haplotype of Pi63 disease-resistant gene family, and the genotype of the function-specific molecular marker is the same as that of the Pi63-IR64 reference variety (individual); on the contrary, the detection result that any detection marker does not meet the technical system is not the target gene Pi63-IR 64;
(6) the detection procedure of disease-resistant allele Pi63-MH of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 optimal specific molecular marker combinations; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi63-MH gene carrier should belong to the functional haplotype of Pi63 disease-resistant gene family, and the genotype of the functional specificity molecular marker combination is the same as that of Pi63-MH reference variety (individual); on the contrary, the detection result that any detection mark does not accord with the technical system is not the target gene Pi 63-MH;
(7) the detection procedure of disease-resistant allele Pi63-TTP of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 optimal specific molecular marker combinations; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi63-TTP gene carrier should belong to functional haplotype of Pi63 disease-resistant gene family, and the genotype of the function-specific molecular marker combination is the same as that of Pi63-TTP reference variety (individual); on the contrary, the detection result of any detection marker which does not meet the technical system is not the target gene Pi 63-TTP.
2. The technical system of claim 1, wherein:
(1) the most optimal and simplified haplotype-specific molecular marker combination is Pi63-F/NG932AAnd Pi63-F/NIndel (4562)(ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;
wherein, the mark indicates: F/N, functional (functional)/non-functional (non-functional); G932A, a marker-specific SNP; indel (4562), specific insertion/deletion starting at the #4562 genomic position, and so on;
(2) the optimal target gene-specific molecular marker is Pi63-KHT1699C(ii) a The sequence is shown in SEQ ID NO. 5-6;
(3) the optimal target gene-specific molecular marker is Pi63-9311T280C(ii) a The sequence is shown as SEQ ID NO. 7-8;
(4) the optimal target gene-specific molecular marker is Pi63-ZST1260C(ii) a The sequence is shown in SEQ ID NO. 9-10;
(5) the optimal target gene-specific molecular marker in (1) is Pi63-IR64A1394G(ii) a The sequence is shown in SEQ ID NO. 11-12;
(6) the optimal target gene specific molecular marker combination is Pi63-MH/KHA2257GAnd Pi63-KHT1699C(ii) a The sequences are respectively shown in SEQ ID NO. 13-14 and SEQ ID NO. 5-6;
(7) the optimal target gene-specific molecular marker combination is Pi63-TTP/IR64G1604CAnd Pi63-IR64A1394G(ii) a The sequences are shown in SEQ ID NO. 15-16 and SEQ ID NO. 11-12 respectively.
3. The use of the technical system of claim 1 or 2 for systematic and accurate inclusive identification and mining of functional genes in the complex family of rice blast Pi63 disease-resistant genes.
4. The use of claim 3, wherein the functional genes include but are not limited to the following 6 target genes:
the functional haplotype of rice blast Pi63 disease-resistant gene family has the sequence shown in GenBank AB872116.1 as disease-resistant allele Pi 63-KH;
disease-resistant allele Pi63-9311 of functional haplotype of rice blast Pi63 disease-resistant gene family, the sequence is shown in GenBank MZ 983626;
disease-resistant allele Pi63-ZS of functional haplotype of rice blast Pi63 disease-resistant gene family, the sequence is shown in GenBank MZ 983625;
disease-resistant allele Pi63-IR64(WT) of functional haplotype of rice blast Pi63 disease-resistant gene family, the sequence is shown in GenBank MZ 983622;
the functional haplotype of rice blast Pi63 disease-resistant gene family has the sequence shown in GenBank MZ983624 as disease-resistant allele Pi 63-MH;
the functional haplotype of rice blast Pi63 disease-resistant gene family has the sequence shown in GenBank MZ983629, i.e., the disease-resistant allele Pi63-TTP (WT).
5. The use of the technical system according to claim 1 or 2 for identifying known functional genes of a gene family in the germplasm resources of unknown target genes and for mining the genetic resources of the unknown target genes, including but not limited to 2 novel target genes: novel disease-resistant alleles Pi63-AZZ, Pi63-YLZ of functional haplotypes of the rice blast Pi63 disease-resistant gene family;
the sequence of the disease-resistant allele Pi63-AZZ is shown in GenBank MZ 983627;
the sequence of the disease-resistant allele Pi63-YLZ is shown in GenBank MZ 983628.
6. The use of the technical system according to claim 1 or 2 for the precise screening of true and false SNPs and true and false target genes that are prevalent in this gene family due to sequencing errors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111034566.2A CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111034566.2A CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981121A true CN113981121A (en) | 2022-01-28 |
| CN113981121B CN113981121B (en) | 2023-01-17 |
Family
ID=79735355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111034566.2A Active CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981121B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642803A (en) * | 2013-12-11 | 2014-03-19 | 中国农业科学院作物科学研究所 | Function specific molecular markers of rice blast resistance gene Pi63 as well as method and application of function specific molecular markers |
| CN104673917A (en) * | 2015-02-15 | 2015-06-03 | 中国农业科学院作物科学研究所 | Functional molecular marker of rice blast resistance gene Pi35, method for identifying and selecting rice blast resistance gene Pi35 and application of functional molecular marker |
| CN104774945A (en) * | 2015-04-10 | 2015-07-15 | 辽宁省农业科学院 | Molecular breeding method for new rice variety carrying gene Pi65(t) with resistance to rice blast |
| CN105961185A (en) * | 2016-05-10 | 2016-09-28 | 江苏丘陵地区镇江农业科学研究所 | Method for cultivating rice blast-resisting rice variety |
-
2021
- 2021-09-03 CN CN202111034566.2A patent/CN113981121B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642803A (en) * | 2013-12-11 | 2014-03-19 | 中国农业科学院作物科学研究所 | Function specific molecular markers of rice blast resistance gene Pi63 as well as method and application of function specific molecular markers |
| CN104673917A (en) * | 2015-02-15 | 2015-06-03 | 中国农业科学院作物科学研究所 | Functional molecular marker of rice blast resistance gene Pi35, method for identifying and selecting rice blast resistance gene Pi35 and application of functional molecular marker |
| CN104774945A (en) * | 2015-04-10 | 2015-07-15 | 辽宁省农业科学院 | Molecular breeding method for new rice variety carrying gene Pi65(t) with resistance to rice blast |
| CN105961185A (en) * | 2016-05-10 | 2016-09-28 | 江苏丘陵地区镇江农业科学研究所 | Method for cultivating rice blast-resisting rice variety |
Non-Patent Citations (4)
| Title |
|---|
| S.R.MCCOUCH等: "Development of New SSR Markers for Rice", 《DNA RESEARCH》 * |
| 刘斌等: "云南省主栽水稻品种抗稻瘟病基因型鉴定", 《分子植物育种》 * |
| 范学科等: "水稻抗稻瘟病基因研究进展", 《种子》 * |
| 马建等: "水稻抗稻瘟病基因Pi35功能性分子标记的开发及其应用", 《作物学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981121B (en) | 2023-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| She et al. | Fine mapping and candidate gene screening of the downy mildew resistance gene RPF1 in Spinach | |
| CN113789403B (en) | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems | |
| CN107227373A (en) | A kind of SNP Functional markers of japonica rice gene resistant to lodging and application | |
| Singh et al. | Allelic sequence variation in the Sub1A, Sub1B and Sub1C genes among diverse rice cultivars and its association with submergence tolerance | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN113744800B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker | |
| CN108456740A (en) | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application | |
| CN113981121B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family | |
| US20230183822A1 (en) | Molecular markers for identifying allele at rice-blast-resistant pik locus of rice and use thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113903397B (en) | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN114292937B (en) | One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families | |
| CN116064583A (en) | Highland barley spike length regulating gene and KASP molecular marker and application thereof | |
| CN113981122B (en) | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy | |
| Kang et al. | The unstable restorer-of-fertility locus in pepper (Capsicum annuum. l) is delimited to a genomic region containing PPR genes | |
| CN114622027B (en) | One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families | |
| CN115976248A (en) | Method for uniquely identifying populus diversifolia pie plants and kit used in method | |
| CN113774160B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster | |
| CN114525356A (en) | Haplotype identification marker of rice grain length control gene GS3 and screening method thereof | |
| CN113736866A (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN114703311B (en) | Haplotype identification marking method of rice grain size control gene SMG11 | |
| CN116751887B (en) | Application of GhEIF A gene associated with cotton fiber strength character | |
| CN108642204A (en) | The combination of SNP marker primer and its application of one anti-wheat yellow mosaic QTL QYm.nau-5A.1 | |
| CN116064897B (en) | Primer group for screening background of tobacco No. 13 chromosome for resisting spot wilt and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |