CN113913424B

CN113913424B - Adeno-associated virus and application thereof in preparation of medicines for treating cocaine addiction

Info

Publication number: CN113913424B
Application number: CN202010659727.6A
Authority: CN
Inventors: 岑小波; 蒋林宏
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-07-09
Filing date: 2020-07-09
Publication date: 2023-08-08
Anticipated expiration: 2040-07-09
Also published as: CN113913424A; WO2022007316A1

Abstract

The invention discloses adeno-associated virus and application thereof in preparing medicines for treating cocaine addiction, belonging to the field of drug-dropping medicines. The key points of the technical scheme of the invention are as follows: the shRNA gene for interfering the glucose ceramide synthase is designed and synthesized, and is constructed into adeno-associated virus (other viruses which can be used as gene expression vectors) which can effectively reduce cocaine addiction. The adeno-associated virus is used for preparing cocaine addiction drugs, and has good application value.

Description

Adeno-associated virus and application thereof in preparation of medicines for treating cocaine addiction

Technical Field

The present invention belongs to the field of medicine for stopping drug addiction.

Background

Cocaine (Cocaine) is a compound which is directly extracted from Cocaine leaves and is also called Cocaine, and the chemical name is benzyl ecgonine. Early in medicine, it is commonly used as a local anesthetic or vasoconstrictor, which later causes abuse due to its excitatory effect on the central nervous system.

Acute poisoning caused by cocaine abuse is manifested by extreme agitation, anxiety, mental abnormality, blurred vision, tremor of limbs, and severe cases can induce heart rhythm disorder, general convulsion and respiratory failure to cause death. The smoker often shows symptoms such as anxiety, listlessness and extreme excitation, and is similar to paranoid schizophrenia.

The cocaine medicines are used for a long time, and the human brain has plastic changes of structure and functionality in different brain areas. The intense craving for drugs caused by cocaine ingestion can bring great harm to physical and mental health, can cause listlessness and mental functional defects, can bring a series of concurrent disease infections, and even can lead a user to take out and acquire drugs to induce activities that harm society.

In view of the great harm of cocaine addiction, suitable therapeutic targets and medicaments are found to treat the urgent cocaine addiction.

The glucosylceramide synthase (glucosylceramide synthase, GCS; gene name: ugcg, UDP-glucose ceramide glucosyltransferase) belongs to the family of glycosyltransferases, which are found extensively on eukaryotic membranes and consist essentially of 394 amino acids. At present, research on UCG and inhibitors thereof mainly focuses on the occurrence of tumor multi-drug resistance mechanisms, and reports on the relation between UCG and cocaine addiction are not seen.

Disclosure of Invention

The invention aims to solve the problems that: provides a recombinant virus capable of inhibiting Ugcg expression and provides the application of the virus in the treatment of cocaine addiction drugs.

The technical scheme of the invention is as follows:

an shRNA, the target sequence of which is shown as SEQ ID NO. 1.

The term "target sequence" refers to: located in the genome, sequences targeted for recognition by siRNA formed by in vivo processing cleavage of shRNA.

The shRNA has the sequence of SEQ ID NO.3 or 4.

A double stranded oligonucleotide comprising the sequence set forth in SEQ ID No. 1.

The double-stranded oligonucleotide as described above, characterized in that: it is a double-stranded oligonucleotide formed by base complementary pairing of single-stranded oligonucleotides with sequences shown in SEQ ID No.3 and SEQ ID No. 4.

A recombinant plasmid comprising the double-stranded oligonucleotide.

The recombinant plasmid according to the above is obtained by inserting the double-stranded oligonucleotide into an RNA interference vector.

A recombinant virus carrying the aforementioned double stranded oligonucleotide or RNA form thereof;

or, the double-stranded oligonucleotide or any single strand of its RNA form.

The term "RNA form" refers to a sequence in which T bases in a DNA sequence are replaced with U bases.

The recombinant virus as described above, which is an adeno-associated virus.

Use of shRNA or recombinant virus that reduces expression of a glucosylceramide synthase gene in the manufacture of a medicament for the treatment of cocaine addiction.

The use as described above, wherein the shRNA is a shRNA as described above;

or, the recombinant virus is the recombinant virus described above.

The shRNA, double-stranded oligonucleotide, recombinant plasmid and recombinant virus can reduce the generation of GCS protein and inhibit the synthesis of downstream GlcCer (glucose ceramide) by inhibiting the Ugcg gene expression, so that the behavioral sensitization and conditional position preference caused by cocaine are weakened, a powerful tool is provided for treating cocaine addiction, and the application prospect is good.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 RNA interference vector.

Figure 2 mouse behavior sensitization assay box.

FIG. 3 conditional position preference experiment box.

Fig. 4 self-administration experimental box.

FIG. 5 cocaine-induced mouse behavioral sensitization and conditional positional bias model establishment. (A) schematic of the operation of a cocaine-induced behavioral sensitization model. (B) Cocaine significantly enhances spontaneous activity behavior in mice, t-test, × p <0.001. Cocaine group n=14, physiological saline group n=14. (C) Schematic of cocaine-induced conditional site-favored model operation. (D) Cocaine significantly reverses the rewarding effect of mice, t-test, × p <0.001. Cocaine group n=15, physiological saline group n=15.

FIG. 6 shows increased expression of GCS in nucleus accumbens. In the behavioral sensitization effect, the expression of GCS in the nucleus-isolated brain region of cocaine group mice is obviously up-regulated. t-test, p <0.05, cocaine group n=4, physiological saline group n=4. In the conditional position favoring behavior, the expression of GCS in the nucleus accumbens brain region of cocaine group mice was significantly up-regulated. t-test, p <0.05, cocaine group n=6, physiological saline group n=6.

FIG. 7 multiple cocaine injections specifically increase nuclear isolated GCS protein expression. The nucleus accumbens GCS protein levels were significantly elevated compared to the normal saline group, and the prefrontal cortex, striatum and hippocampal areas Ugcg protein levels did not show significant changes. Prefrontal cortex (PFC), nucleus accumbens (NAc), striatum (stratum), hippocampus (Hippoampus), t-test, <0.05, cocaine group n=3, normal saline group n=3.

FIG. 8 time dependent effects of cocaine-induced enhancement of nuclear GCS expression. Continuous intraperitoneal injection of cocaine, as compared to normal saline, increased expression of nucleus accumbens GCS started on day 3, was statistically different and tended to stabilize. t-test, p <0.05, p <0.01, p <0.001. Cocaine group n=4, physiological saline group n=4.

Figure 9 food-induced nuclear-accumbens GCS expression was not significantly altered. (A) Through CPP training of the food-induced mice, the food-group mice form a distinct rewarding effect compared with the control group; t-test, ×p <0.01. Cocaine group n=8, physiological saline group n=8. (B) In the food CPP model, there was no significant change in the food group mice' nucleus accumbens GCS expression compared to the control group; t-test, no significant change in n.s, cocaine group n=4, physiological saline group n=4.

Figure 10 silencing the Ugcg gene reduces cocaine-induced behavioral sensitization. Two-way ANOVA analysis followed by bonferroni post-tests, p <0.05 and p <0.01. AAV-shControl-Saline group, n=12; AAV-shControl-Cocaine group, n=12; AAV-shUgcg-Saline group, n=14; AAV-shUgcg-Cocaine group, n=14.

FIG. 11 silencing Ugcg gene reduces cocaine-induced conditional location preference effects. One-way ANOVA is followed by bonferroni post-tests, p <0.05, p <0.01, p <0.001. AAV-shControl-Saline group, n=12; AAV-shControl-Cocaine group, n=12; AAV-shUgcg-Saline group, n=14; AAV-shUgcg-Cocaine group, n=14.

FIG. 12 shows that, after silencing Ugcg gene, the addition of GlcCer can reverse the effects of silencing Ugcg-induced behavioral sensitization (A) and conditional positional preference (B). Two-way ANOVA analysis followed by bonferroni post-tests, p <0.05 and p <0.01. Saline-AAV-shControl-Vehicle (SCV) group, n=14; cocaine-AAV-shControl-Vehicle (CCV) group, n=14; cocaine-AAV-shUgcg-Vehicle (CAV) group, n=14; cocaine-AAV-shUgcg-GlcCer (CAG) group, n=14.

Detailed Description

Example 1 construction of the invention to interfere with the expression of Ugcg adeno-associated Virus

3 to 4 siRNA targets were designed according to transcripts of the mouse Ugcg gene, and primer synthesis was arranged. The single stranded primer was annealed to a double stranded oligo (oligonucleotide) sequence and ligated into a double enzyme tangential RNA interference vector (FIG. 1) to replace the original ccdB virulence gene. Transformants were screened for colony PCR and the screened positive clones were sequenced. Sequencing confirmed the correct clone and high purity plasmid extraction was performed. The method mainly comprises the following steps:

1. interference target design and primer synthesis:

siRNA targets were designed, primer synthesis was arranged, and targets shown in Table 1 were selected after screening.

TABLE 1 siRNA target sequences

The primer sequences are shown in Table 2. In the table: most of the regions of the shUgcg-F and the shUgcg-R are reversely complementary to form a double chain with a sticky end; shControl-F is reversely complementary with most of the shControl-R, so that a double chain with sticky ends can be formed. Uppercase bold fonts are Stem regions, uppercase italics are Loop regions, and lowercase parts are terminal linker sequences (including transcription termination sequences and cleavage site sequences).

TABLE 2 DNA primer fragments

2. Primer annealing to form a cohesive end double-stranded fragment:

the synthesized primers were dissolved in 20. Mu.M using oligo annealing buffer, and 30. Mu.l of each complementary strand was mixed. And then heating the mixture in a water bath at 95 ℃ for 5min, and then opening the water bath and naturally cooling the mixture to the room temperature in the room temperature to form the double-chain oligo fragment. 1 μl was used for the subsequent ligation reaction, and the rest was stored at-20deg.C.

3. Preparation of linearized expression vector:

the restriction enzyme is used for carrying out enzyme digestion on the expression vector, and the enzyme digestion reaction system is as follows: plasmid 2. Mu.g, 10 Xreaction Buffer 5. Mu.l, restriction enzymes 1. Mu.l each, deionized water make up 50. Mu.l, and incubated in a 37℃water bath for more than 2 h. And (3) detecting the enzyme digestion effect by agarose gel electrophoresis of the enzyme digestion product, cutting the target carrier band from the gel after agarose gel electrophoresis, and recycling the gel by using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0. The specific process is as follows:

3.1. agarose gels were prepared using TAE buffer or TBE buffer, and then agarose gel electrophoresis was performed on the target DNA.

3.2. Agarose gel containing target DNA was excised under UV light and the gel surface was blotted with a paper towel. At this time, care should be taken to cut off the gel containing no target DNA portion as much as possible, reduce the gel volume as much as possible, and improve the DNA recovery rate. If the gel mass exceeds 300mg, please use a plurality of columns for recovery, otherwise, the yield is seriously affected.

3.3. Cutting up the glue blocks. The gel dissolution time in the operation step 6 can be quickened after the gel is cut up, and the DNA recovery rate is improved.

3.4. And weighing the glue block, and calculating the volume of the glue block. When the slab volume was calculated, it was calculated at 1 mg=1 μl.

3.5. The block solution Buffer GM was added to the block in the amounts shown in table 3:

TABLE 3 Buffer GM addition

3.6. After uniform mixing, the gel block is dissolved at 15-25 ℃ at room temperature (the gel can be heated at 37 ℃ when the concentration of the gel is high or the gel is relatively insoluble). At this time, the mixing should be intermittently carried out to dissolve the gel mass sufficiently (about 5 to 10 minutes).

3.7. After the gel was completely dissolved, the color of the sol solution was observed, and if the sol solution color changed from yellow to orange or pink, 10. Mu.l of 3M sodium acetate solution (pH 5.2) was added to the above-mentioned sol block solution, and the mixture was uniformly mixed until the solution recovered to yellow. When DNA fragments smaller than 400bp are isolated, isopropanol with a final concentration of 20% should be added to this solution.

3.8. Spin Column in the kit was placed on a Collection Tube.

3.9. The solution from step 7 was transferred to Spin Column and centrifuged at 12,000rpm for 1 minute, and the filtrate was discarded.

3.10. Mu.l of Buffer WB was added to Spin Column and centrifuged at 12,000rpm for 30 seconds at room temperature, and the filtrate was discarded.

3.11. The operation 10 is repeated.

3.12. Spin Column was mounted on a Collection Tube and centrifuged at 12,000rpm for 1min at room temperature.

3.13. The Spin Column was placed on a new 1.5ml centrifuge tube, and 30. Mu.l of sterilized distilled water or an absorption Buffer was added to the center of the Spin Column membrane and allowed to stand at room temperature for 1 minute.

3.14. The DNA was eluted by centrifugation at 12,000rpm for 1 minute at room temperature.

4. The interference fragment is connected into an expression vector:

the ligation reaction system is shown in Table 4.

Table 4 connection system

The ligation was carried out overnight at 16 ℃.

Description: the annealed double-stranded oligo added to the positive control was a previously annealed fragment for verification, and was the same length as the annealed double-stranded oligo added to the ligation group, but the sequence was irrelevant.

5. Transformation of competent cells:

transformation of DH 5. Alpha. Competent cells. The specific operation steps are as follows:

1) 0.5-2 mu L of plasmid with antibiotic resistance is put into 100 mu L of competent cells and is placed on ice for 30min.

2) And (3) heat-shocking at 42 ℃ for 90 seconds, and immediately placing on ice for 1-2 minutes without shaking the tube.

3) 1ml of LB liquid medium is added into the tube, and the temperature is 37 ℃, the rpm is 200, 30 min-1 h, and bacteria are activated.

4) Taking 50 bacterial liquid coated plates (if the conversion efficiency is low, the bacterial liquid can be taken more or the supernatant can be removed by centrifugation; the bacteria coating rod should be left to stand after being baked on the alcohol lamp and then coated with a plate after being cooled to prevent killing cells), when the plate is coated, two bacteria are coated in competence, and the bacteria coating rod has resistance and no resistance, and after transformation, bacteria liquid is coated with one bacteria coating rod has resistance. (after the plating, the plate is placed for a while, and after the bacterial liquid is dried, the plate is placed in an incubator at 37 ℃ for cultivation in an inverted way)

6. Colony PCR identification of positive transformants:

transformants grown on plates were picked up and resuspended in 10. Mu.l LB medium, and 1. Mu.l template was used for colony PCR identification. Transformants were identified by colony PCR, forward primer pAKD-F TCATCAACCCGCTCCAAGGAAT (SEQ ID NO. 7) was located in the human H1 promoter sequence, reverse primer pAKD-R CAAGCTCGAAATTAACCCTCAC (SEQ ID NO. 8) was located downstream of the ccdB gene, and positive clones gave a 316bp fragment. The reaction system and PCR cycle conditions were as follows:

7. sequencing positive clones:

and (5) carrying out sequencing verification on positive clones obtained after colony PCR identification by a sequencing company. Sequencing results were aligned using Vector NTI software and analyzed.

shUgcg sequencing results (SEQ ID No. 9):

CGGAGTGTACTAGGCGGGACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCT GTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGA CCACAGATCCCCGCCCACCATGTATTCAGATCTCAAGAGAATCTGAATACATGGTGGGCTTTTTTCGACGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTG GCCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGAAGGCGACGTGCGTCGCCCGATCCCGGG ATTTGACTAGTGGCCCGCGGGGATCAATGGGGAAGACGAAACTTCTAAGATAACCA AATCAAAAGACATCTCCCGTTTAAGGCGATCTGGAAGAACACATAGCGACATGCAAATGTCGGAGGGCGCCGCTCCCCCGTGCCGCAGAGACTTCTTAGTGCCAGGGCGCTC GCGCGCTCTTTGTTGCCGCCTAGTGAAGCCGCGCCCGCGACTCCTTGGAGTGGGTTC ATGATGCGCGTCACGTACATTTCCCTCCTCTCTTCTTTTATTA

control sequencing results (SEQ ID NO. 10):

CGGGGGGCTCCTAGGCGGGACCCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCT GTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGA CCACAGATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGA GAATTTTTTGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA CATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCTAGAGCATGGCTACACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGA TGGAGTTGGCCACTCCCCTTTT

8. sequencing to verify correct positive clone and plasmid miniextract

AxyPrep plasmid DNA miniprep kit was used for extraction. The operation is as follows:

1) 1-4ml of the bacterial liquid (if rich medium is used, the bacterial liquid volume should be halved or less) cultured overnight in LB medium is taken, 12,000Xg is centrifuged for 1min, and the supernatant is discarded.

2) 250 μl Buffer S1 was added to suspend bacterial pellet, and the suspension was uniform without leaving small clumps.

3) Adding 250 μl Buffer S2, gently and fully turning over up and down for 4-6 times, and mixing well to make thallus fully split until transparent solution is formed. This step should not be performed for more than 5 minutes.

4) Add 350. Mu.l Buffer S3, gently and thoroughly mix up and down 6-8 times and centrifuge for 10min at 12,000Xg.

5) The supernatant from step 4 was aspirated and transferred to a preparation tube (placed in a 2ml centrifuge tube (provided in the kit)), centrifuged at 12,000Xg for 1min, and the filtrate was discarded.

6) The preparation tube was placed back into the centrifuge tube, 500. Mu.l Buffer W1 was added, and the mixture was centrifuged at 12,000Xg for 1min, and the filtrate was discarded.

7) The preparation tube was placed back into a centrifuge tube, 700. Mu.l Buffer W2 was added, and the mixture was centrifuged at 12,000Xg for 1min, and the filtrate was discarded; the washing was performed once again with 700. Mu.l Buffer W2 in the same manner. The filtrate was discarded.

8) The preparation tube was placed back into a 2ml centrifuge tube and centrifuged at 12,000Xg for 1min.

9) The preparation tube was transferred to a new 1.5ml centrifuge tube (provided in the kit), 60-80. Mu.l of Eluent or deionized water was added to the center of the preparation tube membrane, and the tube was allowed to stand at room temperature for 1min. Centrifuge at 12,000Xg for 1min.

9. Virus package

Taking 293FT cells in logarithmic growth phase with good cell status, counting cells, and 5×10 per 10cm culture dish ⁶ The number of individual cells was inoculated in a petri dish and cultured overnight in an incubator at 37 ℃,5% c 02; the old culture solution is removed before the next day of transfection, and 5mL of fresh DMEM culture solution containing 10% serum is added; preparation of DNA-Lipofectamine2000 Complex A sterile 5mL centrifuge tube was prepared using a 10cm dish as an example, 1.5mL of serum-free Opt-MEMI medium was added, followed by plV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5, and the target plasmid (41 g each) were gently inverted and mixed to prepare another sterile 5M centrifuge tube, and 1.5mL of serum-free Opti-MEM medium and 40L of Lipofectamine200 were added. Mix gently upside down and incubate for 5 minutes at room temperature. After 5 minutes, the diluted DNA was added to a serum-free Opti-MEM medium containing 1lipofectamine2000 and mixed by gently inverting. Incubating for 20 minutes at room temperature; the DNA-Lipofectamine2000 complex was added drop by drop to 293FT cells, gently back and forthThe dishes were shaken to mix the complex. Placing the mixture in a saturated humidity incubator with the temperature of 37 ℃ and the saturation humidity of 5 percent for overnight culture; one day after transfection, 10mL of DMM medium containing 10% serum was replaced. Placing in a 37 ℃ and 5% CO2 saturated humidity incubator for continuous culture; collecting culture supernatant 48 hours after transfection and concentrating; adding 10m fresh culture solution for continuous culture, and collecting and concentrating again 72 hours after transfection; the collection and concentration conditions are as follows: centrifuging at 3000pm at low speed for 5min, and filtering the supernatant with a 0.45 μm filter to thoroughly remove cell debris; each UT centrifuge tube is filled with 20mL of liquid, the virus particles are precipitated by high-speed centrifugation for 90min at 4 ℃ of 50000 Xg, the supernatant is discarded, and a small amount of HSS is used for resuspension; 10mL of precooled 20% sucrose solution (HBSS dissolution) is filled in a UT centrifuge tube, the resuspended and dissolved virus solution is carefully added on a sucrose page, and the virus particles are precipitated by high-speed centrifugation at 50000 Xg for 120min at 20 ℃; the supernatant is discarded, the virus precipitate is resuspended by HBSS, and the recombinant lentivirus LV-shPRMT1 of the invention is obtained and split charging is carried out to an AXYGEN tube with an inlet of 0.5m1, and each tube is 100u1. And (5) placing the packaged viruses at-80 ℃ for preservation.

10. Titer determination

Preparation of host cells: the day before transduction (day 1), the cells were trypsinized and counted, and plated into 6-well plates (one sample prepared with two cells) at appropriate cell densities to achieve a degree of confluence of 30% -50% on the day of transfection. Placing at 37deg.C 5% CO ₂ The culture was performed in a saturated humidity incubator overnight. Virus transfection: on the day of transduction (day 2), virus was thawed, 10-fold dilution series were prepared, and the dilution was varied from 10 ⁵ To 10 ⁹ . For each diluted sample, the virus was diluted with complete broth to a total volume lml. The addition of polybrene (1. Mu.1 polybrene in a working concentration of 6. Mu.g/ml diluted virus solution) to the virus-containing medium promotes virus infection of cells. Gently blow the full mixing spoon. The culture medium in the cells was removed and complete culture medium, which already contained different amounts of virus, was added. In addition, cells to which no virus was added in one well were kept, and the volume of the culture medium added per well was 1ml as a blank. Placing at 37deg.C 5% CO ₂ The culture was performed in a saturated humidity incubator overnight. One day after transfection (day 3), the virus-containing medium was removed and 2mL of fresh complete medium was added. Placing at 37deg.C 5% CO ₂ Culturing overnight in a saturated humidity incubator: the number of fluorescent clones was counted 2-3 days after virus inoculation and virus titer was calculated.

TABLE 5 viral titers

The beneficial effects of the invention are demonstrated below by way of experimental examples.

Experimental example 1 treatment of cocaine addiction by recombinant adeno-associated virus AAV-shUgcg of the invention

1 Experimental reagent

The reagents used in this section were as follows:

cocaine hydrochloride (China food and drug verification institute)

Normal saline (Sichuan Korea pharmaceutical Co., ltd.)

RIPA lysate (Shanghai Biyun biotechnology Co., ltd., P0013B)

BCA kit (Shanghai Biyun biotechnology Co., ltd., P0010)

5 XSDS-PAGE electrophoresis loading buffer (Shanghai Biyun biotechnology Co., ltd., P0015)

7.5% SDS-PAGE reagent (Guangzhou Baihe Biotech Co., ltd., PG 111)

10% SDS-PAGE reagent (Guangzhou Baihe Biotech Co., ltd., PG 112)

12.5% SDS-PAGE reagent (Guangzhou Baihe Biotech Co., ltd., PG 113)

Methanol (Shanghai chemical reagent Co., ltd.)

Protein pre-dye marker (Thermo science 26616)

Tris-base(Solarbio，G8200)

Glycine (Solarbio, T8060)

anti-GCS antibody (Shanghai Biotechnology Co., ltd.)

anti-Tubulin antibodies (Cell Signaling Technology, # 15115)

Horseradish peroxidase-labeled secondary antibody (Cell Signaling Technology, # 8887)

BeyoECL (Shanghai Biyun biotechnology Co., ltd., P0018)

Tween-20(Biorad，#1706531)

RNA extraction kit (Axygen, AP-MN-P-50)

Isopropyl alcohol (Shanghai chemical reagent Co., ltd.)

100% ethanol (Shanghai chemical reagent Co., ltd.)

DEPC water (Shanghai Biyun biotechnology Co., ltd.)

RNAStore sample preservation fluid (Tiangen Biochemical technology Co., ltd., DP 408)

BestarTM qPCR RT Kit(Bioscience，DBI-2220)

Stormstar SYBY Green qPCR Mastermix(Bioscience，DBI-2243)

HPLC methanol (Sigma, 34860)

HPLC ethyl acetate (Sigma, 650528)

HPLC isopropanol (Sigma, 34863)

Formic acid (Sigma, 695076)

LC-MS ammonium formate (Sigma, 516961)

LC-MS sodium formate (Sigma, 71539)

LC-MS leucine enkephalin (Waters)

PE(17:0/17:0)(Avanti，830756)

LPC(17:0)(Avanti，855676)

Glucosylceramide(C18:1/16:0)(Avanti，860539)

Glucosylceramide((C18:1/18:0)(Avanti，860548)

Glucosylceramide((C18:1/24:1)(Avanti，860549)

Eliglustat hemitartrate(MedChemExpress，HY-14885A)

DMEM high sugar culture medium (Hyclone, 41966052)

Fetal bovine serum (Hyclone 10100139)

Phosphate buffer (Hyclone, 10010049)

Dimethyl sulfoxide (Sigma, V900090)

Nerve Growth Factor(Thermo Scientfic，13257019)

2 main instrument

Electronic analytical balance (Sartorius)

Ultra-clean bench (Shanghai BoXun industry Limited medical equipment factory)

Refrigerator (Yi Lai Ke Si)

Deep low temperature refrigerator (Thermo Scientific)

Ice machine (Scotsman)

Flat table (Haimen kylin medical instrument factory)

Adjustable vortex suspension apparatus (SCILOGEX)

Ultrasonic breaker (Ningbo new Zhi biotechnology Co., ltd.)

Constant temperature water bath (Guohua electric appliance Co., ltd.)

Inverted biological microscope TS100 (Nikon)

Multi-tube rack automatic balance centrifuge (Changshaxiang instrument centrifuge instruments Co., ltd.)

Life ECO gene amplification instrument (Hangzhou Bo Ri technology Co., ltd.)

Electrophoresis apparatus (Bio-Rad company of America)

Electrophoresis tank (Bio-Rad company of America)

Western blot gel imaging system (Shanghai Xiang science instruments Co., ltd.)

Constant temperature shaking table (Shanghai Zhi city analytical instrument manufacturing Co., ltd.)

Full wavelength enzyme label instrument (Thermo Electron Corporation)

CFX96TM Real-Time System (Bio-Rad Co., U.S.A.)

Mouse brain stereotactic instrument (Shenzhen Ruiwo biotechnology Co., ltd.)

Mouse spontaneous activity detection box (Shenzhen Ruiwo biotechnology Co., ltd.)

Mouse conditional position preference detection box (Ningbo Anlai software technology Co., ltd.)

Mouse autonomous administration detection box (Ningbo Anlai software technology Co., ltd.)

Deep low temperature refrigerator (Thermo Scientific)

5 μl Flat head microinjector (Shenzhen Ruiwo biotechnology Co., ltd.)

Carbon dioxide incubator IGO150 (Jouan)

Ultra-clean bench (Shanghai BoXun industry Limited medical equipment factory)

Constant temperature water bath (Guohua electric appliance Co., ltd.)

Inverted biological microscope TS100 (Nikon)

UPLC-Qtof-MS/MS (G2-S) separation detector (Waters)

C18 chromatographic separation column (Waters)

Ultrasonic breaker (Ningbo new Zhi biotechnology Co., ltd.)

Micropipette (Eppendorf)

3 Experimental method

3.1 test animals

The wild animals used in this study were male SPF grade healthy mature (8-12 week old) C57BL/6J mice supplied by Beijing Veitz laboratory animal technologies Co., ltd., weight 20-22g, and were not mated. Feeding conditions: the temperature of a common animal house of a national (adult) new drug preclinical safety evaluation center is 20-25 ℃, the relative humidity is 55-65%, and animals eat and drink water freely in the whole experimental process, and the feeding environment accords with the standard GB 14125-2001 in experimental animal environment and facility. All animal experimental operations related to the subject meet AAALAC requirements, and experimental animals are normally kept for 3-5 days before experiments so as to familiarize and adapt to the environment.

3.2 multiple cocaine injections

Multiple cocaine injection dosing is primarily referred to literature dosing regimens. The method comprises the following steps: 20mg/kg of cocaine is administered once per day intraperitoneally for 7 consecutive days. Half an hour after cocaine administration by the last injection, taking out four brain area samples of prefrontal cortex, striatum, nucleus accumbens and Hippocampus by referring to the brain stereotactic map of the mice for Western blot detection.

The specific operations of multiple cocaine injections for detecting temporal effects are: 20mg/kg of cocaine is injected into abdominal cavity once a day, and the cocaine is continuously administered for 1 day, 2 days, 3 days, 5 days and 7 days respectively. Half an hour after cocaine administration by the last injection, the nucleus accumbens are taken out by referring to the stereotactic spectrum of the brain of the mice.

3.3 cocaine-induced behavioral sensitization model establishment

Cocaine-induced mice behavioral sensitization model dosing regimen reference literature dosing regimen and were slightly modified. The behavior sensitization experiment box is made of organic glass into four square boxes with the same size, a smooth black organic glass plate is arranged around each box, a smooth white organic glass plate is arranged at the bottom of each box, and the behavior sensitization box device is shown in figure 2. Mice were free to move in the laboratory box, adapted for three days, 10min per day. The behavioral sensitization experiment was divided into 2 stages, and cocaine and physiological saline were injected according to table 6 during the experiment. First stage (day 0): all mouse movement distances within 15min were recorded as a base value using the Ethovision XT of Noldus corporation without any treatment. Second stage (day 1-day 7): cocaine was administered to the cocaine group at the same time every day, and physiological saline was administered to the physiological saline group at the same dose for 7 consecutive days, 1 time every day. The dosing regimen is shown in table 6. Immediately after administration, the mice were placed in a behavioral sensitization box and the distance of movement of the mice was recorded over 15min. The experimental results were analyzed by SPSS statistical software, the difference was expressed as mean.+ -. Standard error, the difference between cocaine group and normal saline group was compared by two-tailed t-test analysis, and p <0.05 indicated a statistical difference.

TABLE 6 behavioral sensitization dosing regimen tables

3.4 cocaine-induced mouse conditional position preference model (Conditioned Place Preference, CPP)

The mouse cocaine CPP addiction model builds the reference methodology and modifies slightly the CPP protocol as shown in FIG. 3. The CPP experiment box consists of a black large box, a white large box and a middle gray small box, wherein the black large box is made of a plastic partition plate and is provided with black four walls and a round hole rough ground, and the white large box is provided with white four walls and a stripe-shaped rough bottom surface. The mice freely move in the experiment box and adapt to the environment for three days, 15min each time. CPP experiments were divided into 3 phases, first phase (day 1): the natural preference of mice was tested. Second stage (day 2-day 7): during the training stage, the channels between the boxes are closed by using a plastic partition board, cocaine is injected on days 2,4 and 6, the mice are immediately placed into a non-preference box, physiological saline is injected on days 3,5 and 7, the mice are immediately placed into a preference box, and the residence time of the mice in the box is 15min each time; third stage (day 8): the test phase, during which the plastic partition was removed, the mice were allowed to freely move through the box and the residence time of the mice in the black and white boxes, respectively, was recorded for 15min. The dosing regimen is shown in table 7. The mice were dissected rapidly within 30min of the end of the test, and the nucleus was removed for subsequent testing.

The results were expressed as a comparison of the time difference between the conditional position bias test period, bias bin residence time minus the non-bias bin residence time difference as a post-induction bias value, and the natural bias state time difference. The experimental results were analyzed by SPSS statistical software, the difference was expressed as mean.+ -. Standard error, the difference between cocaine group and normal saline group was compared by two-tailed t-test analysis, and p <0.05 indicated a statistical difference.

TABLE 7 conditional site favoring dosing regimen tables

3.5 autonomous cocaine administration model establishment

3.5.1 jugular vein catheterization of mice

Cervical venous cannula retention is the basis for the establishment of an autonomous dosing model and is also a key step in determining the success of establishing the model. The experimental technique is mainly reported by literature, and is properly adjusted according to the laboratory conditions and experimental purposes. Before the operation, the experimental animal is adapted to the experimental environment for 3-5 days, and is contacted with an experimenter every day, so that the experimental animal is prevented from generating stress reaction. The jugular vein cannula is prepared by adopting an inlet silica gel hard tube (with the outer diameter of 0.48mm, the inner diameter of 0.40mm and the length of about 5 mm) and a matched silica gel hose (with the length of about 3 mm), and the hose is arranged at the front end of the hard tube so as to avoid the stimulation to mice.

During operation, the mouse is anesthetized by injecting chloral hydrate (10% and 10 ml/kg) into the abdominal cavity according to the body weight of the mouse, the collarbone part on the left side of the neck is removed, the head of the mouse is fixed towards the experimenter in a supine mode, a longitudinal incision of about 1cm is formed at the upper end of the collarbone, subcutaneous tissues are separated in a blunt mode, the external vein of the neck is removed, a small amount of physiological saline can be dripped in the whole process, and skin and blood vessel dryness is prevented. An oblique opening is cut on a vein by using an ophthalmic scissors, the end of a previously prepared cannula hose is inserted into the vein, and the cannula is fixed by knotting a surgical thread. The inserted prefabricated catheter fills the whole pipeline with heparin sodium in advance to prevent coagulation. The catheter cap was then closed and the neck and back wounds were sutured. After the operation is finished, the mice are kept warm on an electric blanket until they wake up, and then the mice are placed in a clean cage, and five mice are kept in the cage. The next day of operation, a small amount of heparin sodium containing antibiotics is injected through the cannula every day, so that the smoothness of the catheter is ensured, and wound infection is prevented. Mice typically have a post-operative recovery period of 7 days. Mice that completed this procedure can be used to build models of autonomous administration of cocaine.

3.5.2 mice were dosed spontaneously (Self-administration)

The mouse autonomous administration system was manufactured by An Lai software technology limited (Ningbo, china) (FIG. 4). Each operation box is placed in a sound insulation cabinet with a ventilating fan, and equipment in the operation box mainly comprises two nose contactors, a cage lamp, an infusion connection system, a box lamp and a food groove. In addition, the drug delivery system also comprises a syringe pump, an experimental animal behavior recording system and the like.

During the training period of autonomous cocaine administration in mice, FR1 (fixed ratio-1) is the simplest, most basic training mode, i.e., the system automatically pumps a preset volume of cocaine each time the mouse touches an active nose trigger. The FR1 program is adopted for training in the study, the experimental training time is 120 min/day, the maximum injection times of each round of training are 100 times, the refractory period of each equipment is 20s, the cocaine injection is 0.75mg/kg, the left nasal contact hole is effective nasal contact, and the right nasal contact hole is ineffective nasal contact. After each effective nose touch, the cage lamp is closed, the signal lamp is on, and no reaction is generated after the ineffective nose touch. After the establishment of the model is determined to be successful, the mice are dissected within 2 hours after the last administration, and the nucleus accumbens brain area is taken out for subsequent detection.

Decision criteria for success of the autonomous dosing model: forming a conditional reflection; autonomously acquiring cocaine frequency stability; the number of three consecutive days of dosing of the animals was within 10% of its average.

3.6 food-induced conditional location preference model

The mouse food CPP model was established similarly to cocaine-induced CPP operation. A 7 day starvation adaptation period was first performed, 15min each, before modeling. During the acclimation period, mice can eat only 1h per day, and the rest of the time can only drink water freely, but no feed is provided. After the seventh day, the mice were tested for weight change. Mice with body weights no less than 70% of the initial body weight were selected at the end of day seven for food CPP training. The food CPP model was established alternately with conditioning training and testing, starting with the detection of the original preferences at day eight, followed by random grouping. During training, the mice subjected to food conditioning training are fed in a feeding cage for 1h, and then are immediately put into a preference box for training for 15min; during non-food conditioning training, firstly, false feeding is carried out for 1h (feeding cage is arranged, but no feed is fed), then, the non-preference box is immediately arranged, and training is carried out for 15min. Animals in the control group were not fed before training and fed uniformly for 1h after training.

The results were expressed as a comparison of the difference between the conditioned place preference test period, the preference bin residence time minus the non-preference bin residence time difference as a post-induction preference, and a comparison to the natural preference time difference. The experimental results were analyzed using SPSS statistical software, the differences were expressed as mean.+ -. Standard error, the differences between the food induction group and the control group were compared using a two-tailed t-test analysis, and p <0.05 indicated a statistical difference.

3.7 tissue isolation Material

After the test of each group is finished, the mice are rapidly cervical and killed within the preset anatomical time, then the brains are rapidly separated, and after the brains are washed 3 times by normal saline at the temperature of 4 ℃, the nucleus accumbens are separated and taken out according to the anatomical spectrum of the brains. The nucleus accumbens were placed directly into prepared 1.5ml EP tubes, then snap frozen in liquid nitrogen, and finally after tissue collection, stored completely at-80 ℃ for subsequent detection.

3.8 protein extraction and Western blot

3.8.1 brain tissue total protein extraction and quantification

Taking a nucleus isolated by freezing at-80 ℃, adding a proper amount of 100 mu l of RIPA lysate, adding protease inhibitors Cocktail and PMSF into the lysate system, and putting the mixture on ice for cracking for 15min. Ice bath ultrasound was performed 10 times, 5 seconds/time, 3 seconds each time with a gap, the purpose of the ultrasound was to break up tissue cells and fully release dissolved proteins. Then, the mixture was centrifuged at 13000g at 4℃for 15min, and the supernatant was aspirated. Protein concentration was quantified using BCA protein quantification kit (shanghai bi yun biotechnology limited), the main steps were: first, BSA was diluted to a concentration gradient of 0.5,0.4,0.3,0.2,0.1,0.05,0.025,0 mg/ml; the extracted protein supernatant was then diluted 30-fold and the diluted BSA and protein samples were added to respective wells of a 20 μl-96-well plate. 200 μl of working solution was then added to each well and incubated at 37deg.C for 20-25min in the absence of light. The absorbance at 562nm is then measured with a full wavelength microplate reader and used as a linear correlation R for BSA standard curve ² >And 0.99 is qualified and quantified, and then the corresponding protein concentration of each sample is calculated. And correspondingly diluting the samples according to the requirements, and adding 5X protein loading buffer solution into each sample to make the final concentration be 1X. Boiling water for 5min, packaging, and storing at-20deg.C.

3.8.2 western blotting and exposure

10% and 7.5% polyacrylamide separating gel and 5% polyacrylamide upper concentrated gel were prepared according to the gel preparation kit. And placing the prepared gel into an electrophoresis tank, adding an electrophoresis buffer solution, and then spotting. The sample loading volume was adjusted to moderate sample concentration based on the abundance of each protein in the nucleus, with a protein sample volume added to each sample well of about 10 μl. Then, the protein sample is compressed to the separation gel limit by using a voltage of 60V, and the voltage is increased to 80V after the band runs through the separation limit until the target protein is completely separated. Transferring the gel carrying the target protein from the glass plate to a transfer film clamp with a filter paper sandwich structure, covering the gel with a PVDF film activated by methanol, setting the transfer film voltage to be 100V, and setting the transfer film time according to the molecular weight of the protein. After the transfer of the membrane is completed, 5% of skim milk sealing liquid is prepared by using TBST buffer solution, and the strips are soaked in the sealing liquid and sealed for 1 hour at room temperature by a shaking table. Then the primary protein antibody is diluted according to the required proportion by using the blocking solution, the hybridization band is blocked in the primary antibody, the hybridization band is kept at 4 ℃ overnight, the next day is shaken on a shaking table at 37 ℃ for 1h, and the membrane is washed three times by using TBST for 10min each time. Selecting corresponding secondary antibodies according to the species sources of the primary antibodies, diluting the secondary antibodies according to a ratio of 1:5000, incubating for 1h at 37 ℃, washing the membrane with TBST buffer solution five times after the completion of the washing, each time for 10min, and then washing the membrane with TBS buffer solution once for 10min. When exposing, preparing a luminous solution A and a luminous solution B according to the proportion of 1:1, placing the PVDF film loaded with the target protein into the luminous mixed solution for reacting for 1min under the dark condition, taking out the PVDF film, and sucking the redundant luminous solution by using filter paper. The PVDF film was placed in a gel imaging system for exposure. And (3) data processing: and (5) reading the gray value of each strip of the exposed picture by using a Clinx Image Analysis system, and carrying out standardized comparison by using the gray value of the Tubulin strip as an internal reference.

4 experimental results

4.1 cocaine-induced behavioral sensitization and conditional site-preference modeling

This experiment detects the movement distance of mice by intraperitoneal injection of 20mg/kg cocaine (FIG. 5A, B) for seven consecutive days. The results showed that the cocaine group mice moved significantly more than the saline group from the first day of dosing and the distance moved tended to stabilize on the third day, indicating successful behavioral sensitization model establishment (fig. 5C, D).

4.2 Expression of GCS in behavioral sensitization and conditional site-favoring behavior

To further confirm the addictive behavior of GCS at cocaine induction, the present assay uses Western Blot technique to detect changes in GCS protein levels. The results showed that GCS protein levels were significantly elevated, about 1.2-fold, in the behavioral sensitization and conditional localization favoring effects compared to the saline group (fig. 6).

4.3 multiple cocaine injections to increase GCS expression in nucleus accumbens brain regions

The neurite-induced plasticity brain regions induced by multiple cocaine dosing include the prefrontal cortex (Prefrontal cortex), nucleus accumbens (Nuclear accumbens), striatum (stratum) and Hippocampus (Hippocampus). To investigate the effect of multiple cocaine administrations on GCS expression in each brain region, 20mg/kg concentration of cocaine was intraperitoneally injected at the same time point for 7 consecutive days, mice were sacrificed by cervical removal after half an hour of the last administration, and four brain regions of prefrontal cortex, nucleus accumbens, striatum and hippocampus were removed and GCS expression in the above four brain regions was detected by Western blot. The results showed that GCS expression was significantly elevated in the nucleus accumbens brain region (p < 0.05) but not significantly altered in the prefrontal cortex, striatum and hippocampal brain region (figure 7) following intraperitoneal administration of cocaine in mice compared to the normal saline group. Thus, the results indicate that multiple cocaine injections can specifically increase nuclear isolated GCS protein expression.

4.4 cocaine-induced increases in nuclear-isolated GCS expression and enhancement over time

In order to explore the change of GCS protein expression along with the prolongation of cocaine administration time, 5 time points are set in the experiment, cocaine is continuously administered for 1 day, 2 days, 3 days, 5 days and 7 days respectively, after half an hour of cocaine injection for the last time, a nucleus accumbens brain region is obtained, and nucleus accumbens GCS is detected through Western blot. The results showed that there was no significant change in cocaine on days 1 and 2 of continuous intraperitoneal administration compared to the saline group, and that cocaine-induced GCS expression in the nucleus accumbens brain region of mice was significantly increased from the third day, and was stably expressed for both 5 and 7 days of continuous administration (fig. 8). The above results indicate that cocaine-induced increases in expression of nuclear GCS increases with prolonged cocaine administration time, and that expression tends to stabilize three days after administration, exhibiting significant time dependence.

No significant change in GCS in the food-induced conditional site preference model in 4.5 volt nucleus accumbens

To investigate whether GCS was altered by cocaine drug induction, the experiment was modeled using the conditional positional preference of diet-induced mice, fed 1h to the diet group mice prior to each training, not to the control group, and after the end of training, all mice were fed 1h. As a result, it was found that the behavior preference of the mice in the food group was significantly reversed compared to the control group. However, the expression of GCS protein was detected by Western Blot, and as a result, it was found that the food group was not significantly changed compared to the control group (fig. 9).

4.6 silencing Ugcg expression significantly reduces cocaine-induced behavioral sensitization and conditional positional preference behavioural effects

The recombinant adeno-associated virus obtained in example 1 was injected at fixed points in the nucleus accumbens brain region using genetic means to interfere with the expression of Ugcg. The result shows that in the behavior sensitization model, compared with a shControl-physiological saline group, the shControl-cocaine group behavior sensitization effect is obviously enhanced; whereas the behavioral sensitization effect of mice was significantly reduced in the shUgcg-cocaine group (fig. 10).

In conditional positional preference, cocaine-induced reward effects were significantly diminished following site-directed injection of adeno-associated virus into the nucleus accumbens region interfering with the expression of Ugcg (fig. 11).

4.7 Replementing GlcCer (glucosylceramide) to reverse the behavioral effects induced by silencing Ugcg

Ugcg is a synthase of GlcCer, and inhibition of Ugcg activity results in reduced GlcCer content of its downstream synthesis product.

By using genetic means, glcCer is supplemented at a nuclear isolation fixed point every day after the adenovirus related virus is injected at the nuclear isolation brain region fixed point to interfere with Ugcg expression. The results showed that, in the behavioral sensitization model, the spontaneous locomotor distance of the mice was significantly increased by the back-supplementing GlcCer (fig. 12A); in the conditional location preference model, the attenuation of cocaine rewarding effects is significantly reversed (fig. 12B).

The above results demonstrate that behavioral sensitization and conditional positional preference by cocaine can be reduced by injection of the recombinant adeno-associated virus of the invention; this attenuation can be reversed by GlcCer complementation, and it can be seen that adeno-associated viruses of the invention act by inhibiting downstream GlcCer synthesis.

In conclusion, the adeno-associated virus can be used for preparing drugs for treating cocaine addiction, and has good application prospect.

SEQUENCE LISTING

<110> Huaxi Hospital at university of Sichuan

<120> an adeno-associated virus and its use in the manufacture of a medicament for the treatment of cocaine addiction

<130> GY159-2020P0110142CC

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> mice (Mus musculus)

<400> 1

gcccaccatg tattcagat 19

<210> 2

<211> 19

<212> DNA

<213> mice (Mus musculus)

<400> 2

ttctccgaac gtgtcacgt 19

<210> 3

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gatccccgcc caccatgtat tcagatctca agagaatctg aatacatggt gggcttttt 59

<210> 4

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

tcgaaaaaag cccaccatgt attcagattc tcttgagatc tgaatacatg gtgggcggg 59

<210> 5

<211> 60

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gatccccttc tccgaacgtg tcacgtttca agagaacgtg acacgttcgg agaatttttt 60

<210> 6

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

tcgaaaaaat tctccgaacg tgtcacgttc tcttgaaacg tgacacgttc ggagaaggg 59

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

tcatcaaccc gctccaagga at 22

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

caagctcgaa attaaccctc ac 22

<210> 9

<211> 665

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

cggagtgtac taggcgggac acccagcgcg cgtgcgccct ggcaggaaga tggctgtgag 60

ggacagggga gtggcgccct gcaatatttg catgtcgcta tgtgttctgg gaaatcacca 120

taaacgtgaa atgtctttgg atttgggaat cttataagtt ctgtatgaga ccacagatcc 180

ccgcccacca tgtattcaga tctcaagaga atctgaatac atggtgggct tttttcgacg 240

gtacccagct tttgttccct ttagtgaggg ttaatttcga gcttggccac gtgcggaccg 300

agcggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc 360

tcactgagga aggcgacgtg cgtcgcccga tcccgggatt tgactagtgg cccgcgggga 420

tcaatgggga agacgaaact tctaagataa ccaaatcaaa agacatctcc cgtttaaggc 480

gatctggaag aacacatagc gacatgcaaa tgtcggaggg cgccgctccc ccgtgccgca 540

gagacttctt agtgccaggg cgctcgcgcg ctctttgttg ccgcctagtg aagccgcgcc 600

cgcgactcct tggagtgggt tcatgatgcg cgtcacgtac atttccctcc tctcttcttt 660

tatta 665

<210> 10

<211> 589

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

cggggggctc ctaggcggga ccccagcgcg cgtgcgccct ggcaggaaga tggctgtgag 60

ggacagggga gtggcgccct gcaatatttg catgtcgcta tgtgttctgg gaaatcacca 120

taaacgtgaa atgtctttgg atttgggaat cttataagtt ctgtatgaga ccacagatcc 180

ccttctccga acgtgtcacg tttcaagaga acgtgacacg ttcggagaat tttttgtacc 240

cagcttttgt tccctttagt gagggttaat tgcgcgcttg gcgtaatcat ggtcatagct 300

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccgggagcat 360

aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc 420

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 480

cgcggggaga ggcggtttgc gtattgggcg ctcttcctag agcatggcta cacgtgcgga 540

ccgagcggcc gcaggaaccc ctagtgatgg agttggccac tcccctttt 589

Claims

1. Use of shRNA or recombinant virus that reduces expression of a glucosylceramide synthase gene in the manufacture of a medicament for treating cocaine addiction, characterized in that: the shRNA target sequence is shown as SEQ ID NO. 1; the recombinant virus-carrying sequence comprises a double-stranded oligonucleotide of the sequence set forth in SEQ ID NO.1 or an RNA form thereof.

2. The use according to claim 1, characterized in that: the sequence of the shRNA is in the form of RNA of SEQ ID NO.3 or 4.

3. The use according to claim 1, characterized in that: the double-stranded oligonucleotide is formed by base complementary pairing of single-stranded oligonucleotides with sequences shown as SEQ ID NO.3 and SEQ ID NO. 4.

4. The use according to claim 1, characterized in that: the recombinant virus is an adeno-associated virus.