CN104174031A - Gene composition-h-R3/PAMAM (poly(amidoamine)) G5/GCS (glucosylceramide synthase) siRNA for reversing multidrug resistance (MDR) of tumors and application of gene composition-h-R3/PAMAM G5/GCS siRNA - Google Patents
Gene composition-h-R3/PAMAM (poly(amidoamine)) G5/GCS (glucosylceramide synthase) siRNA for reversing multidrug resistance (MDR) of tumors and application of gene composition-h-R3/PAMAM G5/GCS siRNA Download PDFInfo
- Publication number
- CN104174031A CN104174031A CN201410373154.5A CN201410373154A CN104174031A CN 104174031 A CN104174031 A CN 104174031A CN 201410373154 A CN201410373154 A CN 201410373154A CN 104174031 A CN104174031 A CN 104174031A
- Authority
- CN
- China
- Prior art keywords
- gcs
- sirna
- pamam
- compositions
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a gene composition-h-R3/PAMAM (poly(amidoamine)) G5/GCS (glucosylceramide synthase ) siRNA for reversing multidrug resistance (MDR) of tumors, as well as a preparation method and application of the gene composition-h-R3/PAMAM G5/GCS siRNA. The anti-tumor MDR gene composition disclosed by the invention is prepared by self-assembly of an amino PAMAM dendrimer serving as a terminal, nimotuzumab h-R3 of EGFR (epidermal growth factor receptor) as a target site and siRNA against MDR gene GCS. The gene composition has the advantages that (1) the targeting performance of the PAMAM carrier on a tumor cell can be improved by using the EGFR as the target site, using the nimotuzumab h-R3 modified PAMAM carrier formed by means of the self-assembly method as a gene delivery carrier and utilizing h-R3 and tumor cell EGFR mediated endocytosis, so that the siRNA against GCS gene can be successfully delivered to the cell to realize GCS siRNA silence of the target gene, and the susceptibility of chemotherapeutic drugs can be further improved; (2) compared with chemical synthesis, the h-R3/PAMAM G5/GCS siRNA composition prepared by adopting the self-assembly method has the effects that the molecular self-assembly method is capable of modifying a system conveniently and flexibly, and the bioactivity of a ligand can be maintained.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of genome compound-h-R3/PAMAM G5/GCS siRNA and application thereof of reverse multiple drug resistance of tumor.
Background technology
Multidrug resistance (multidrug resistance, MDR) refer to when tumor cell occurs drug resistance to a kind of antitumor drug, the multiple antineoplastic agent deposits yields cross resistance different with mechanism of action to structure, thus greatly reduce the curative effect of antitumor drug.It is complicated that MDR forms mechanism, and tumor cell can cause by different approaches the generation of MDR.The generation of tumor cell multidrug resistance becomes a main cause of current chemotherapy of tumors failure, estimates according to American Cancer Society, and 90% above tumor patient is died from drug resistance in various degree.Therefore, how successful reverse multiple drug resistance of tumor has also become major issue urgently to be resolved hurrily in current therapeutic field of tumor [van Vlerken et al., 2008].
GCS gene (Glucosylceramide synthase, glucose ceramide synzyme) is recently found its high expressed and tumor MDR is closely related.GCS is a kind of glucosyl transferase, participate in the metabolism of ceramide, glycosyl transport on can catalysis UDP-glucose generates glucose ceramide (glucosylceramide, GlcCer) to ceramide, makes cell escape the apoptotic effect of ceramide mediation and produce MDR.Ceramide is the main molecules of sphingolipid metabolism, in cell death inducing, play an important role, the second message,second messenger of mediating apoptosis, it brings into play effect widely in multi-signal transduction process, its glycosylation metabolite GlcCer is the precursor substance of synthetic other glycosyl sphingolipids of cell, the biological behaviour of it and tumor cell is closely related, is not only maintaining the normal configuration function of cell, has also participated in the multidrug resistance of cell proliferation, differentiation and tumor cell.GCS is the glycosylated rate-limiting enzyme of ceramide, has substrate specificity, and the generation of MDR is played an important role.Suppress GCS and delay ceramide glycosylation, the content that increases ceramide in cell has become the available strategy of reversion MDR.
Along with deepening continuously of tumor cell MDR Study on Molecular Mechanism, the method research that overcomes MDR has also obtained greater advance, and studying at present more is chemosynthesis inhibitor and gene therapy.The inhibitor of chemosynthesis can increase the sensitivity of tumor cell to chemotherapeutics, but in clinical practice, specificity is not high, toxic and side effects is serious for these medicines, be difficult to reach the effective plasma level concentration of reversion MDR, and tumor cell also can produce drug resistance to these medicines, and its clinical practice is restricted.The gene therapy method of reverse multiple drug resistance of tumor mainly concentrates at present: 1) suppress P-gp Teat pipette function (Lin et al, 2003); 2) expression of interference MDR related gene, as the antisense DNA oligo (AOD) of MDR1 gene, the antisense RNA of MDR1 and mrp gene is combined inhibition, ribozyme (the Stuart et al 2000 of cutting MDR1 mRNA; Wang et al, 2003; Huesker et al, 2002); 3) for the gene therapy (Efferth et al, 2001) of MDR1 Gene regulation; 4) RNA of mdr1/siRNA disturbs (Hannon et al, 2002; Yague et al, 2004).Compare with antisense oligonucleotide, antisense RNA and manual transcription factor, the application prospect of siRNA is best, the problems such as other equal body internal specific is strong, transfection efficiency and stably express deficiency.
Although siRNA has good application prospect than antisense oligonucleotide, antisense RNA etc., but there is the siRNA of the double grading of nucleic acid and micromolecular compound, the hydrophilic of itself and anion characteristic are difficult to by cell membrane it, and owing to easily being caused it to there is the features such as poor stability, the half-life is short, transfection efficiency is low by nuclease (RNase) degraded.Therefore the key of applying siRNA molecule is how to make it effectively through cell membrane, enters the RNAi path in Cytoplasm.And it is more complicated that siRNA molecule is imported to organism internal therapy disease, except cell membrane obstacle, also to overcome the selectivity of target cell, the stability of the interior siRNA molecule of body, the problem such as mechanism and the toxicity to non-target cell of dynamic equilibrium.Therefore, whether siRNA can effectively send is that can it be applied to clinical key, and design and synthetic safety, siRNA delivery vector efficient, targeting have become the important directions of current siRNA drug research.
Novel dendroid macromolecule polyamide-amide (PAMAM), with its unique molecular structure and surface nature, becomes the focus of therapeutic genes study on the carrier.PAMAM dendritic macromole taking end as amido is example; it has good dissolubility under physiological pH condition; its electropositive feature can realize the delivery of greater number gene; and stable system; can protect the not destruction of various enzymes in blood plasma or histiocyte in receptor of genes of interest; thereby can realize the effective transfection [Proc.Natl.Acad.Sci.USA, 93:4897-4902] in body.But applying to remain in following problem as gene delivery vector in vivo, PAMAM needs to solve: 1) transfection efficiency is relatively low; 2), in vivo under environment, PAMAM can a large amount of negative electricity macromole and the erythrocyte of nonspecific combination, affect transfection efficiency and haemolysis occurs; 3) how to realize the targeting of PAMAM nano gene delivery system.
In order to address the above problem, research is at present many directly modifies on PAMAM molecule, as at residue [Int J Pharm such as PAMAM finishing ornithines, 2010,392:294 – 303], strengthen PAMAM molecular surface electropositive to strengthen transfection efficiency, but the method is strengthening the too much electropositive while, has also improved cytotoxicity; On the other hand, to PAMAM finishing PEG[Nanotechnology, 2009,20:105-103], to improve biocompatibility, reduce negative electricity macromole and erythrocyte in nonspecific combination blood plasma, in addition, at the end modified specific protein of PEG as lactoferrin [Biomaterials, 2008,29 (2): 238-246], to realize tissue-targeting, but the modification of PEG has increased the sterically hindered of PAMAM molecule and DNA molecular combination, has reduced transfection efficiency.
EGF-R ELISA (Epidermal Growth Factor Receptor, EGFR) be a kind of growth factor receptors with tyrosine kinase activity, low at normal cell expression rate, and there is overexpression in kinds of tumors in as kinds of tumor cells such as pulmonary carcinoma, colorectal cancer, renal carcinoma and incidence scale cancer.EGFR signal path plays an important role in the developing of cancer, the unconventionality expression of EGFR is often as relevant in cell proliferation, immune evasion, transfer and relapse, tumor vessel formation and chemotherapy resistance, poor prognosis etc. to the feature of malignant tumor, provides theoretical basis and experimental basis for the oncotherapy taking EGFR as target spot with for the signal transduction therapeutic intervention of EGFR signal transduction pathway.
In oncotherapy mode taking EGFR as target spot, monoclonal antibody is common treatment method at present, EGFR monoclonal antibody and endogenic ligand are competed in conjunction with EGFR, produce Graft Versus Tumor by the effect such as activation, promotion EGFR internalization that suppresses tyrosine kinase, also can with cancer therapy drug or the coupling of toxin phase, suppress the object of tumor growth thereby reach specificity.
For example, the appropriate pearl monoclonal antibody of Buddhist nun (Nimotuzumab, h-R3) be anti-human EGFR Humanized monoclonal antibodies (mAb), there is the feature of humanized, high selectivity and long half time, can competitive inhibition endogenic ligand and the combination of EGFR, suppress the tyrosine kinase activity of EGFR, the downstream signal Signal Transduction Pathways that blocking-up is mediated by EGFR.In vivo and in vitro shows, h-R3 has inhibition tumor cell propagation, promotes apoptosis of tumor cells, suppresses tumor-blood-vessel growth to increase effect [Expert Rev Anticancer Ther, 2003,3 (3): 367-380 of Concurrent Chemoradiotherapy Sensitivity; Lung Cancer, 2013,79 (3) 270-275].
Summary of the invention
An object of the present invention is to provide a kind of compositions for artitumor multi-medicine-resistant.
Compositions provided by the invention, by end with amino polyamide-amide dendritic, Buddhist nun's trastuzumab h-R3 with GCS siRNA is compound makes.
GCS siRNA, purchased from Santa Cruz biotechnology (Shanghai) Co., Ltd., is made up of siRNA-A, siRNA-B, tri-kinds of siRNA of siRNA-C,
SiRNA-A is made up of following two strands, positive-sense strand CAAGAAGGCAACUGACAAAtt (sequence 1); Antisense strand is UUUGUCAGUUGCCUUCUUGtt (sequence 2);
SiRNA-B is made up of following two strands, positive-sense strand GAACUUCACAUCCAAGAUAtt (sequence 3); Antisense strand is UAUCUUGGAUGUGAAGUUCtt (sequence 4);
SiRNA-C is made up of following two strands, positive-sense strand CAGUUUCAAUCCAGAAUGAtt (sequence 5); Antisense strand is UCAUUCUGGAUUGAAACUGtt (sequence 6).
In above-mentioned compositions, the number-average molecular weight of described polyamide-amide dendritic is 28824.81.
In above-mentioned compositions, described polyamide-amide dendritic is 1:1-40:1 with nitrogen/phosphorus ratio of described GCS siRNA.In above-mentioned compositions, described polyamide-amide dendritic is 20:1 with nitrogen/phosphorus ratio of described GCS siRNA.
In above-mentioned compositions, the mass ratio of described Buddhist nun's trastuzumab h-R3 and described GCS siRNA is 0.05:1-5:1.
In above-mentioned compositions, the mass ratio of described Buddhist nun's trastuzumab h-R3 and described GCS siRNA is 0.05:1,0.1:1 or 0.5:1.
Another object of the present invention is to provide a kind of method of preparing above-mentioned artitumor multi-medicine-resistant compositions.
Method provided by the invention, comprises the steps:
After the aqueous solution that is amino polyamide-amide dendritic by end mixes with GCS siRNA, under incubation conditions, self assembly forms the compositions of polyamide-amide dendritic and GCS siRNA; To in the compositions of described polyamide-amide dendritic and GCS siRNA, join in Buddhist nun's trastuzumab h-R3 again, under incubation conditions, self assembly forms the compositions of polyamide-amide dendritic, Buddhist nun's trastuzumab h-R3 and GCS siRNA, obtains described artitumor multi-medicine-resistant genome compound.
Above-mentioned compositions is also the scope of protection of the invention in the application of preparing the application in reversing multiple medicine resistance of tumor cells product or preparing in antitumor cell multidrug resistance product.
In above-mentioned application, described tumor cell is multidrug resistance tumor cells, and described multidrug resistance tumor cells is specially MCF-7/ADR; Described product is medicine.
Above-mentioned compositions is also the scope of protection of the invention at targeting transport nucleic acid or the application prepared in targeting transport nucleic acid product, and nucleic acid is in the present invention GCS siRNA.
The present invention of experiment showed, of the present invention has the following advantages:
1) taking EGFR as target spot, the PAMAM carrier that forms Buddhist nun's trastuzumab h-R3 modification by the method for self assembly is as gene delivery vector, utilize the endocytosis of h-R3 and tumor cell EGFR mediation, improve the targeting of PAMAM carrier to tumor cell, thereby the siRNA for GCS gene is successfully delivered in cell, realize the silence of genes of interest GCS siRNA, further increase the sensitivity of chemotherapeutics; 2) by the modification of monoclonal antibody h-R3 to PAMAM, can reduce the positive charge intensity that PAMAM carrier is excessively strong, be conducive to reduce the generation of cytotoxicity and haemolysis; 3) adopt self-assembling method to prepare h-R3/PAMAM G5/GCS siRNA compositions, compared with chemosynthesis, molecular self-assembling method can be more convenient, flexibly system is modified, and keep the biological activity of part.
Brief description of the drawings
Fig. 1 is the expression that Western Blot method detects GCS albumen in sensitive cells MCF-7 and mdr cell MCF-7/ADR.
Fig. 2 is the expression that PCR detects GCS albumen in sensitive cells MCF-7 and mdr cell MCF-7/ADR.
Fig. 3 is that different nitrogen/phosphorus is than the gel electrophoresis retardance figure of the PAMAM G5/GCS siRNA of (N/P ratio).
Fig. 4 is the impacts of different h-R3 modification amounts on h-R3/PAMAM G5/GCS siRNA complex gel blocking result.
Fig. 5 is the expression that PCR detects MCF-7/ADR cell GCS gene after the transfection of h-R3/PAMAM G5/GCS siRNA complex
Fig. 6 is the expression that PCR detects MCF-7/ADR cell MDR1 gene after the transfection of h-R3/PAMAM G5/GCS siRNA complex
Fig. 7 is the expression that PCR detects MCF-7/ADR cell apafl bcl-2 after the transfection of h-R3/PAMAM G5/GCS siRNA complex
Fig. 8 is the expression that PCR detects MCF-7/ADR cell apafl caspase-3 after the transfection of h-R3/PAMAM G5/GCS siRNA complex
Fig. 9 is the expression that Western Blot method detects MCF-7/ADR cell GCS albumen after h-R3/PAMAM G5/GCS siRNA complex and the transfection of EGF/PAMAM G5/GCS siRNA complex
Figure 10 is the expression that Western Blot method detects MCF-7/ADR cell P glycoprotein after h-R3/PAMAM G5/GCS siRNA complex and the transfection of EGF/PAMAM G5/GCS siRNA complex
Detailed description of the invention
The experimental technique using in following embodiment if no special instructions, is conventional method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
Polyamide-amide dendritic (PAMAM): end is with amino, taking ethylenediamine as core, 5.0 generations, (purchased from Sigma-Aldrich, article No.: 536709, specification 5g, number-average molecular weight is 28824.81); Adopt Rotary Evaporators evacuation, remove methanol solvate, obtain PAMAM G5, then use PBS buffer (pH7.4) to dissolve, be prepared into 10mg/mL storage liquid for subsequent use in 4 DEG C.
Buddhist nun's trastuzumab (Nimotuzumab, h-R3): purchased from Biotech Pharmaceutical Co., Ltd..
Multidrug resistance gene (GCS) siRNA (GCS siRNA is called again UGCG siRNA): purchased from Santa Cruz biotechnology (Shanghai) Co., Ltd., sc-45404 is made up of siRNA-A, siRNA-B, tri-kinds of siRNA of siRNA-C
SiRNA-A is made up of following two strands, positive-sense strand CAAGAAGGCAACUGACAAAtt; Antisense strand is UUUGUCAGUUGCCUUCUUGtt;
SiRNA-B is made up of following two strands, positive-sense strand GAACUUCACAUCCAAGAUAtt; Antisense strand is UAUCUUGGAUGUGAAGUUCtt;
SiRNA-C is made up of following two strands, positive-sense strand CAGUUUCAAUCCAGAAUGAtt; Antisense strand is UCAUUCUGGAUUGAAACUGtt;
Drug-resistant cell strain (MCF-7/ADR): purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre
First adopt western blotting (Western Blot, WB) to detect the expression of GCS in mdr cell MCF-7/ADR, and compare with sensitive cells MCF-7 (purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre).As shown in Figure 1,1 is that MCF-7 cell, 2 is MCF-7/ADR cell to result; Expression by the known GCS of result in drug-resistant cell strain MCF-7/ADR is apparently higher than the expression in sensitive cells strain MCF-7.Further adopt PCR to detect the difference that on transcriptional level, in sensitive cells and mdr cell, GCS expresses, result as shown in Figure 2,1:Marker; MDR1 in 2:MCF-7; MDR1 in 3:MCF-7/ADR; GCS in 4:MCF-7; GCS in 5:MCF-7/ADR; GAPDH in 6:MCF-7; GAPDH in 7:MCF-7/ADR; Show that, in MCF-7 and MCF-7/Adr cell strain, not only the expression of GCS there are differences, the expression of Mdr-p MDR1 also there are differences.
Embodiment 1, preparation h-R3/PAMAM G5/GCS siRNA complex and sign thereof
One, PAMAM G5/GCS siRNA complex
First the above-mentioned PAMAM G5 making (number-average molecular weight is 28824.81) 10mg/mL storage liquid is dissolved in sterilized distilled water, vibration mixes, and is mixed with the working solution of 1mg/mL, and 4 DEG C store for future use.Before transfection, get 1.0 μ g GCS siRNA and be placed in EP pipe, add respectively the PAMAM G5 working solution that 0.7 μ L, 1.4 μ L, 3.5 μ L, 7 μ L, 14 μ L, 21 μ L, 28 μ L concentration are 1mg/mL, add again opti-MEM culture medium (purchased from invitrogen, catalog number is 11058-021) 500uL, mix rearmounted incubated at room 30 min and form PAMAM G5/GCS siRNA complex.In the PAMAM G5/GCS siRNA complex forming, PAMAM is respectively 1:1,2:1,5:1,10:1,20:1,30:1,40:1 with nitrogen/phosphorus ratio of GCS siRNA.
Adopt agarose gel electrophoresis retardance to experimental results show that combining case and the stability of PAMAM and GCS siRNA the PAMAM G5/GCS siRNA complex of above-mentioned preparation.In the PAMAM G5/GCS siRNA complex detecting, PAMAM is respectively 1:1,2:1,5:1,10:1,20:1,30:1,40:1 with nitrogen/phosphorus ratio of GCS siRNA.
Concrete grammar is as follows:
Take appropriate agarose, add 1 × TAE solution, heating for dissolving, prepare 1% agarose gel solution, room temperature is cooled to approximately 50 DEG C, adds 1 μ L ethidium bromide solution (500 μ g/ml) to insert DNA dyeing, encapsulating, application of sample, 120V electrophoresis 30min left and right, ultraviolet transilluminator is observed and is taken pictures.The required transfection composite of fresh preparation, effect is sealed in 1% agarose gel electrophoresis qualification.
As shown in Figure 3, swimming lane 1 is naked GCS siRNA to result; Swimming lane 2-8 is that nitrogen/phosphorus ratio is respectively 1,2,5,10,20,30,40; Swimming lane 9 is RNA Marker, and result shows that siRNA, not in the time that PAMAM is combined completely (swimming lane 2-5), can occur normal electrophoretic band; In the time that N/P ratio is 20 (swimming lane 6), PAMAM-siRNA can block the electrophoresis of the siRNA of its parcel completely, and it is trapped near point sample hole, cannot go out normal electrophoretic band by electrophoresis, show that N/P reaches at 20 o'clock, can form stable PAMAM-siRNA.
Two, h-R3/PAMAM G5/GCS siRNA complex
By PBS buffer (pH7.4, NaCl8.0g, KCl0.2g, NaH for Buddhist nun's trastuzumab (Nimotuzumab, h-R3)
2pO
4h
2o1.56g, KH
2pO
40.20g, distilled water is settled to 1000ml), being mixed with concentration is the monoclonal antibody solution of 1mg/mL, add than the PAMAM G5/GCS siRNA complex that is 20 the monoclonal antibody solution that the concentration of different volumes is 1mg/mL to 100 μ L nitrogen/phosphorus, mix rearmounted incubated at room 30min and form h-R3/PAMAM G5/GCS siRNA complex.Form in h-R3/PAMAM G5/GCS siRNA complex, the mass ratio of h-R3 and GCS siRNA is respectively 0.05:1,0.1:1,0.5:1,1:1,2:1,5:1, and PAMAM G5 is 20:1 with nitrogen/phosphorus ratio of GCS siRNA.
Adopt agarose gel electrophoresis retardance to experimental results show that combining case and the stability of PAMAM and GCS siRNA the h-R3/PAMAM G5/GCS siRNA complex of above-mentioned preparation, in the h-R3/PAMAM G5/GCS siRNA complex detecting, PAMAM is 20:1 with nitrogen/phosphorus ratio of GCS siRNA; The mass ratio of h-R3 and GCS siRNA is respectively 0.05,0.1, and 0.5,1,2,5.Method is the same.
As shown in Figure 4, swimming lane 1 is naked GCS siRNA to the agarose gel electrophoresis retardance experimental result of h-R3/PAMAM G5/GCS siRNA ternary complex; Swimming lane 2-7 is that PAMAM G5 is respectively 0.05,0.1,0.5,1,2,5 h-R3/PAMAM G5/GCS siRNA complex than the mass ratio that is 20:1 and h-R3 and GCS siRNA with GCS siRNA nitrogen/phosphorus; Swimming lane 8 is Marker), as seen from the figure, in the time that the mass ratio of h-R3 and GCS siRNA is 0.05,0.1,0.5, without naked siRNA band, the h-R3/PAMAM G5/GCS siRNA complex now forming is stable, can effectively wrap up GCS siRNA.
Therefore, in conjunction with above-mentioned conclusion, h-R3/PAMAM G5/GCS siRNA complex, nitrogen/phosphorus of PAMAM and DNA is than being 20:1, and the mass ratio of h-R3 and GCS siRNA is 0.05,0.1,0.5, is optimum response compositions.
Embodiment 2, the application of h-R3/PAMAM G5/GCS siRNA composite body in the many drug resistances of inhibition tumor cell
One, on transcriptional level, detect the expression of drug resistant gene after the transfection of h-R3/PAMAM G5/GCS siRNA complex and related apoptosis gene
1, after the transfection of h-R3/PAMAM G5/GCS siRNA composite body, expression of drug resistance genes amount detects
1) GCS gene
By h-R3/PAMAM G5/GCS siRNA complex, (PAMAM is 20:1 with nitrogen/phosphorus ratio of DNA, and the mass ratio of h-R3 and GCS siRNA is 0.5) transfection enters mdr cell MCF-7/ADR, utilizes RT-PCR method to detect the variation of GCS gene expression amount in cell after transfection.
Primer sequence is: GCS for CCTTTCCTCTCCCCACCTTCCTCT
GCS?re?GGTTTCAGAAGAGAGACACCTGGG
Using GAPDH as reference gene.
Result as shown in Figure 5,1:Marker; 2: the GCS in untransfected MCF-7/ADR; 3: the GCS after transfection in MCF-7/Adr; 4: the GAPDH in untransfected MCF-7/ADR; 5: the GAPDH after transfection in MCF-7/Adr, to find out, after this complex transfection, in mdr cell MCF-7/ADR, the expression of GCS gene obviously reduces.
2) Multidrug resistance gene MDR1
Multidrug resistance gene MDR1 is detected simultaneously,
Primer sequence is: MDR1 for ATATCAGCAGCCCACATCAT
MDR1?re?GAAGCACTGGGATGTCCGGT
Using GAPDH as reference gene.
Result as shown in Figure 6,1: the GAPDH in untransfected MCF-7/Adr; 2: the GAPDH after transfection in MCF-7/Adr; 3: the MDR1 in untransfected MCF-7/Adr; 4: the MDR1 after transfection in MCF-7/Adr; 5:Marker, from the brightness of band 3 and 4, can find out, the brightness of band 4 (MDR1 after transfection in MCF-7/Adr) is obviously weaker than band 3 (MDR1 in untransfected MCF-7/Adr), illustrates that the expression of mdr cell MDR1 after the transfection of h-R3/PAMAM G5/GCSsiRNA complex reduces.
After the transfection of h-R3/PAMAM G5/GCS siRNA complex, in mdr cell, the expression of MDR1 also has certain downward.
These presentation of results h-R3/PAMAM can mediate GCS siRNA and enter in mdr cell, GCS gene is carried out to silence and disturb, and the expression of Multidrug resistance gene MDR1 is also had to certain inhibitory action simultaneously.
2, the detection to apoptosis-related genes bcl-2 and caspase-3
Detection to apoptosis-related genes bcl-2 and caspase-3 simultaneously
The primer sequence of bcl-2 is: bcl-2for TGCTGAAGATTGATGGGATC
bcl-2re?TGCATTCTTGGACGAGGG
The primer sequence of caspase-3 is: caspase-3for TGTGGCATTGAGACAGAC
caspase-3re?GAGGGAAATACAGTACCAAATA
Fig. 7 is the expression that PCR detects MCF-7/ADR cell apafl bcl-2 after the transfection of h-R3/PAMAM/GCS siRNA complex, wherein, and 1:Marker; 2: the bcl-2 in untransfected MCF-7/Adr; 3: the bcl-2 after transfection in MCF-7/Adr; 4: the GAPDH in untransfected MCF-7/Adr; 5: the GAPDH after transfection in MCF-7/Adr; Fig. 8 is the expression that PCR detects MCF-7/ADR cell apafl caspase-3 after the transfection of h-R3/PAMAM/GCS siRNA complex, wherein 1:Marker; 2: the caspase-3 in untransfected MCF-7/Adr; 3: the caspase-3 after transfection in MCF-7/Adr; 4: the GAPDH in untreated MCF-7/Adr; 5: the GAPDH after processing in MCF-7/Adr;
Can find out, after the transfection of h-R3/PAMAM G5/GCS siRNA complex, in mdr cell, the expression of bcl-2 and caspase-3 also has downward to a certain degree, thereby further verifies that the silence of GCS gene can promote the apoptosis of tumor cell.
Two, in translation skill, detect expression drug resistance-associated proteins and related apoptosis gene after the transfection of h-R3/PAMAM G5/GCS siRNA complex
For the PAMAM G5 complex that further checking h-R3 modifies can be delivered to GCS siRNA mdr cell and performance effect effectively, increased in the following embodiments control experiment, the PAMAM G5 complex that adopts EGF to modify carries GCS siRNA and tests.
1) GCS albumen
By h-R3/PAMAM G5/GCS siRNA complex, (PAMAM is 20:1 with nitrogen/phosphorus ratio of DNA, and h-R3 is 0.5 with the mass ratio of GCS siRNA) and (preparation method is similar to contrast complex EGF/PAMAM G5/GCS siRNA complex, PAMAM is 20:1 with nitrogen/phosphorus ratio of DNA, and the mass ratio of EGF and GCS siRNA is 2) respectively transfection enter mdr cell MCF-7/ADR, utilize Western Blot method to detect the variation of GCS expressing quantity in cell after transfection, set internal reference GAPDH simultaneously.
Concrete grammar is as follows:
The good MCF-7/ADR cell of collection status (cell counting, general 107 left and right), make it to keep cell number identical, carry out centrifugal (the centrifugal 7min of 1100rpm), obtain cell precipitation, carry out protein extraction according to protein extraction test kit afterwards.First by PBS washed cell precipitation 2-3 time, according to cell precipitation number add cell pyrolysis liquid, add the protease inhibitor that will add 5% before in cell pyrolysis liquid, leave standstill 30min on ice, measure protein concentration, add Loading Buffer, boiling water bath boils 10min, and-20 DEG C save backup.Carry out afterwards Western Blotting detection.
Result as shown in Figure 9, A:h-R3/PAMAM G5/GCS siRNA group; B:EGF/PAMAM G5/GCS siRNA group; Band 1: without the MCF-7/ADR cell of complex processing; Band 2: through the MCF-7/ADR of complex processing cell.From figure, the brightness of band can be found out, the GCS expressing quantity after two groups of complex transfections in MCF-7/ADR cell all declines to some extent, and it is more obvious that h-R3/PAMAM G5/GCS siRNA group GCS albumen is lowered.This result shows the PAMAM G5/GCS siRNA complex of modifying than EGF, and after Buddhist nun's trastuzumab h-R3 modifies, the transfection efficiency of complex is higher, enters reticent better effects if after drug-resistant tumor cell.
2) P glycoprotein
Drug resistance-associated proteins P glycoprotein is detected, concrete grammar is with 1 simultaneously).Result as shown in figure 10, A:h-R3/PAMAM G5/GCS siRNA group; B:EGF/PAMAM G5/GCS siRNA group; Band 1: without the MCF-7/ADR cell of complex processing; Band 2: through the MCF-7/ADR of complex processing cell.From figure, the brightness of band can be found out, the P expressing quantity after two groups of complex transfections in MCF-7/ADR cell all declines to some extent, and it is more obvious that h-R3/PAMAM G5/GCS siRNA group P albumen is lowered.This result further shows the PAMAM G5/GCS siRNA complex of modifying than EGF, and after Buddhist nun's trastuzumab h-R3 modifies, the transfection efficiency of complex is higher, enters reticent better effects if after drug-resistant tumor cell.
Claims (10)
1. for the compositions of artitumor multi-medicine-resistant, by end with amino polyamide-amide dendritic, Buddhist nun's trastuzumab h-R3 with GCS siRNA is compound makes.
2. compositions according to claim 1, is characterized in that: the number-average molecular weight of described polyamide-amide dendritic is 28824.81.
3. compositions according to claim 1 and 2, is characterized in that: described polyamide-amide dendritic is 1:1-40:1 with nitrogen/phosphorus ratio of described GCS siRNA.
4. compositions according to claim 3, is characterized in that: described polyamide-amide dendritic is 20:1 with nitrogen/phosphorus ratio of described GCS siRNA.
5. according to arbitrary described compositions in claim 1-4, it is characterized in that: the mass ratio of described Buddhist nun's trastuzumab h-R3 and described GCS siRNA is 0.05:1-5:1.
6. according to arbitrary described compositions in claim 1-5, it is characterized in that: the mass ratio of described Buddhist nun's trastuzumab h-R3 and described GCS siRNA is 0.05:1,0.1:1 or 0.5:1.
7. a method of preparing arbitrary described artitumor multi-medicine-resistant compositions in claim 1-6, comprises the steps:
After the aqueous solution that is amino polyamide-amide dendritic by end mixes with GCS siRNA, under incubation conditions, self assembly forms the compositions of polyamide-amide dendritic and GCS siRNA; To in the compositions of described polyamide-amide dendritic and GCS siRNA, join in Buddhist nun's trastuzumab h-R3 again, under incubation conditions, self assembly forms the compositions of polyamide-amide dendritic, Buddhist nun's trastuzumab h-R3 and GCS siRNA, obtains described artitumor multi-medicine-resistant genome compound.
In claim 1-7 arbitrary described compositions preparing the application in reversing multiple medicine resistance of tumor cells product or preparing the application in antitumor cell multidrug resistance product.
9. application according to claim 8, is characterized in that: described tumor cell is multidrug resistance tumor cells; Described product is medicine.
10. in claim 1-7, arbitrary described compositions is transported nucleic acid or is prepared the application in targeting transport nucleic acid product at targeting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410373154.5A CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410373154.5A CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104174031A true CN104174031A (en) | 2014-12-03 |
| CN104174031B CN104174031B (en) | 2017-06-13 |
Family
ID=51955558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410373154.5A Active CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104174031B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113913424A (en) * | 2020-07-09 | 2022-01-11 | 四川大学华西医院 | Adeno-associated virus and application thereof in preparing cocaine addiction treatment drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517332A (en) * | 2011-11-24 | 2012-06-27 | 清华大学 | EGF (epidermal growth factor)-modified PAMAM (polyamidoamine) self-assembled composite for transgenosis as well as preparation method and applications thereof |
| CN103533961A (en) * | 2011-05-17 | 2014-01-22 | 勃林格殷格翰国际有限公司 | Method for egfr directed combination treatment of cancer |
-
2014
- 2014-07-31 CN CN201410373154.5A patent/CN104174031B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103533961A (en) * | 2011-05-17 | 2014-01-22 | 勃林格殷格翰国际有限公司 | Method for egfr directed combination treatment of cancer |
| CN102517332A (en) * | 2011-11-24 | 2012-06-27 | 清华大学 | EGF (epidermal growth factor)-modified PAMAM (polyamidoamine) self-assembled composite for transgenosis as well as preparation method and applications thereof |
Non-Patent Citations (4)
| Title |
|---|
| ADANG H.G.等: "PREPARASI, BIODISTRIBUSI DAN CLEARANCE SENYAWA PENGKONTRAS MRI Gd-DTPA-PAMAM G4-NIMOTUZUMAB MELALUI SIMULASI MENGGUNAKAN 153Gd-DTPA-PAMAM G4-NIMOTUZUMAB", 《SEMINAR NASIONAL VI SDM TFKNOLOCRI NUKLTR》 * |
| JUN LI ET AL.: "Enhanced transfection efficiency and targeted delivery of self-assembling h-R3-dendriplexes in EGFR-overexpressing tumor cells", 《ONCOTARGET》 * |
| LARA S. JABR-MILANE等: "MULTI-FUNCTIONAL NANOCARRIERS TO OVERCOME TUMOR DRUG RESISTANCE", 《CANCER TREAT REV.》 * |
| 殷哲 等: "自组装修饰在不同细胞系中对聚酰胺-胺介导的基因递送的影响", 《中国新药杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113913424A (en) * | 2020-07-09 | 2022-01-11 | 四川大学华西医院 | Adeno-associated virus and application thereof in preparing cocaine addiction treatment drug |
| WO2022007316A1 (en) * | 2020-07-09 | 2022-01-13 | 四川大学华西医院 | Adeno-associated virus and the use thereof in preparing medications for treating cocaine addiction |
| CN113913424B (en) * | 2020-07-09 | 2023-08-08 | 四川大学华西医院 | Adeno-associated virus and application thereof in preparation of medicines for treating cocaine addiction |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104174031B (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fitts et al. | Exploiting exosomes in cancer liquid biopsies and drug delivery | |
| Yoshizawa et al. | Folate-linked lipid-based nanoparticles for synthetic siRNA delivery in KB tumor xenografts | |
| Ramchandani et al. | Nanoparticle delivery of miR-708 mimetic impairs breast cancer metastasis | |
| Hayes et al. | Targeting the RNA splicing machinery as a novel treatment strategy for pancreatic carcinoma | |
| Yan et al. | Nanosized functional miRNA liposomes and application in the treatment of TNBC by silencing Slug gene | |
| Dai et al. | Aptamer-guided DNA tetrahedron as a novel targeted drug delivery system for MUC1-expressing breast cancer cells in vitro | |
| Lu et al. | Development of small interfering RNA delivery system using PEI-PEG-APRPG polymer for antiangiogenic vascular endothelial growth factor tumor-targeted therapy | |
| Şalva et al. | Local delivery of chitosan/VEGF siRNA nanoplexes reduces angiogenesis and growth of breast cancer in vivo | |
| Ohyama et al. | In vitro and in vivo tumor-targeting siRNA delivery using folate-PEG-appended dendrimer (G4)/α-cyclodextrin conjugates | |
| Fujita et al. | A novel platform to enable inhaled naked RNAi medicine for lung cancer | |
| Hattori et al. | siRNA delivery to lung-metastasized tumor by systemic injection with cationic liposomes | |
| US20240139228A1 (en) | Pharmaceutical composition and applications thereof | |
| Okamoto et al. | Antibody-modified lipid nanoparticles for selective delivery of siRNA to tumors expressing membrane-anchored form of HB-EGF | |
| Polyak et al. | Systemic delivery of siRNA by aminated poly (α) glutamate for the treatment of solid tumors | |
| You et al. | m6A Reader YTHDF1‐Targeting Engineered Small Extracellular Vesicles for Gastric Cancer Therapy via Epigenetic and Immune Regulation | |
| Hong et al. | Follicle-stimulating hormone peptide-conjugated nanoparticles for targeted shRNA delivery lead to effective gro-α silencing and antitumor activity against ovarian cancer | |
| Zuo et al. | Exosomes-coated miR-34a displays potent antitumor activity in pancreatic cancer both in vitro and in vivo | |
| Zhang et al. | Exosomal circRNA: emerging insights into cancer progression and clinical application potential | |
| Kim et al. | Tumor-specific delivery of therapeutic siRNAs by anti-EGFR immunonanoparticles | |
| Magalhaes et al. | RNAi-based therapeutics for lung cancer: biomarkers, microRNAs, and nanocarriers | |
| Liang et al. | Antitumor effect of a new nano-vector with miRNA-135a on malignant glioma | |
| Raguraman et al. | Drug delivery approaches for HuR-targeted therapy for lung cancer | |
| US20220282250A1 (en) | Long non-coding rna in cancer | |
| Liu et al. | Efficient delivery of PKN3 shRNA for the treatment of breast cancer via lipid nanoparticles | |
| Iizuka et al. | Anticancer activity of the intraperitoneal-delivered DFP-10825, the cationic liposome-conjugated RNAi molecule targeting thymidylate synthase, on peritoneal disseminated ovarian cancer xenograft model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |