CN104174031B - The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application - Google Patents
The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application Download PDFInfo
- Publication number
- CN104174031B CN104174031B CN201410373154.5A CN201410373154A CN104174031B CN 104174031 B CN104174031 B CN 104174031B CN 201410373154 A CN201410373154 A CN 201410373154A CN 104174031 B CN104174031 B CN 104174031B
- Authority
- CN
- China
- Prior art keywords
- gcs
- sirna
- pamam
- polyamide
- mcf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
It is capable of genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and preparation method and application the invention discloses a kind of.Artitumor multi-medicine-resistant genome compound provided by the present invention, by end by the polyamidoamine dendrimers of amino, Buddhist nun trastuzumab h R3 of the target spot by EGFR and the siRNA self assembly for MDRG GCS are made.The present invention has advantages below：1) with EGFR as target spot, the PAMAM carriers for forming Buddhist nun trastuzumab h R3 modifications by the method for self assembly are used as gene delivery vector, the endocytosis mediated using h R3 and tumour cell EGFR, improve targeting of the PAMAM carriers to tumour cell, so as to the siRNA Successful delivery will be directed to GCS genes is to intracellular, the silence of genes of interest GCS siRNA is realized, further increases the sensitiveness of chemotherapeutics.2) h R3/PAMAM G5/GCS siRNA compositions are prepared using self-assembling method, compared with chemical synthesis, molecular self-assembling method can be more convenient, flexibly system is modified, and keep the bioactivity of part.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of reverse multiple drug resistance of tumor genome compound-h-R3/
PAMAM G5/GCS siRNA and its application.
Background technology
MDR (multidrug resistance, MDR) refers to tumour cell resistance to a kind of appearance of antineoplastic
While the property of medicine, the various antineoplastics different to structurally and functionally mechanism produce cross resistance, so as to greatly reduce
The curative effect of antineoplastic.MDR Forming Mechanisms are complicated, and tumour cell can cause the generation of MDR by different approaches.Tumour is thin
Born of the same parents' MDR generation as current chemotherapy of tumors failure a main cause, according to American Cancer Society estimate, 90% with
Upper tumor patient dies from different degrees of resistance.Therefore, the reverse multiple drug resistance of tumor that how to succeed also has turned into current tumour and has controlled
Major issue urgently to be resolved hurrily in treatment field [van Vlerken et al., 2008].
It is high that GCS genes (Glucosylceramide synthase, Glucosylceramide synthase) are found it recently
Expression is closely related with tumour MDR.GCS is a kind of glucosyl transferase, participates in the metabolism of ceramide, can be catalyzed UDP-
Glycosyl transport on glucose generates glucose ceramide (glucosylceramide, GlcCer) to ceramide, makes thin
Born of the same parents escape the apoptotic effect of ceramide mediation and produce MDR.Ceramide is the main molecules of sphingolipid metabolism, thin in induction
Played an important role in born of the same parents' apoptosis, be the second messenger of mediating apoptosis, it is played extensively in multi-signal transductive process
Effect, its glycosylation metabolite GlcCer is precursor substance that cell synthesizes other glycosyl sphingolipids, its life with tumour cell
Thing scholarship and moral conduct is closely related, not only maintains the normal configuration function of cell, also take part in cell propagation, differentiation and tumour cell
MDR.GCS is the glycosylated rate-limiting enzyme of ceramide, and with substrate specificity, the generation to MDR plays an important role.
Suppressing GCS delays ceramide to glycosylate, and increasing the content of intracellular ceramide has turned into the available strategy of reversion MDR.
With deepening continuously for tumour cell MDR Study on Molecular Mechanism, overcome MDR technique study also achieve it is larger enter
Exhibition, it is chemical synthesis inhibitor and gene therapy to study at present more.The inhibitor of chemical synthesis can increase tumour cell
To the sensitiveness of chemotherapeutics, but these medicines specific not high, toxic and side effect in clinical practice is serious, it is difficult to reach reverse
The effective plasma level concentration of MDR, and tumour cell can also be to these drug resistants, and its clinical practice is restricted.
The gene therapy method of current reverse multiple drug resistance of tumor is concentrated mainly on：1) suppress P-gp Teat pipettes functions (Lin et al,
2003)；2) expression of MDR related genes, such as the antisense oligonucleotide DNA (AOD) of MDR1 genes, MDR1 and MRP are disturbed
The antisense RNA joint of gene suppresses, ribozyme (the Stuart et al 2000 of cutting MDR1 mRNA；Wang et al,2003；
Huesker et al,2002)；3) for the gene therapy (Efferth et al, 2001) of MDR1 Gene regulations；4)mdr1/
RNA interference (the Hannon et al, 2002 of siRNA；Yague et al,2004).With ASON, antisense RNA and people
Work transcription factor is compared, the application prospect of siRNA preferably, other equal body internal specifics not strong, transfection efficiency and stabilization table
The problems such as up to deficiency.
Although siRNA has preferable application prospect compared to ASON, antisense RNA etc., with nucleic acid and
The siRNA of the double grading of micromolecular compound, the hydrophily and anion characteristic of itself is made it difficult to by cell membrane, and
And due to easily causing it there is the low feature of poor stability, half-life short, transfection efficiency by nuclease (RNase) degraded.Therefore
It is it is effectively passed through cell membrane using the key of siRNA molecule, into the RNAi paths in cytoplasm.And will
The biological interior therapeutic disease of siRNA molecule importing is increasingly complex, in addition to cell membrane barriers, also to overcome the selection of target cell
The problems such as property, the stability of internal siRNA molecule, the mechanism of dynamic equilibrium and toxicity to non-target cell.Therefore, siRNA
Whether be can it be applied to clinical key, design and synthesize safe efficient, targeting siRNA deliverings if can effectively deliver
Carrier has become the important directions of current siRNA drug researches.
Novel dendroid macromolecule polyamide-amide (PAMAM), with its unique molecular structure and surface nature, becomes
The focus of therapeutic gene carrier research.As a example by PAMAM dendritic macromoles with end as amido, it is under physiological ph conditions
With good dissolubility, its electropositive feature can realize the delivery of greater number gene, and stable system, Neng Goubao
Shield genes of interest is not destroyed by various enzymes in internal blood plasma or histocyte, thus can realize internal effective transfection
[Proc.Natl.Acad.Sci.USA,93:4897-4902].But as gene delivery vector, application is remained PAMAM in vivo
Following problem needs to solve：1) transfection efficiency is relatively low；2) in vivo under environment, PAMAM can be with nonspecific knot
Substantial amounts of negative electricity macromolecular and red blood cell are closed, transfection efficiency is influenceed and haemolysis is occurred；3) PAMAM nanometers of base how is realized
Because of the targeting of delivery system.
In order to solve the above problems, research at present is more directly to be modified on PAMAM molecules, is such as repaiied on PAMAM surfaces
Decorations ornithine etc. residue [Int J Pharm, 2010,392:294-303], enhancing PAMAM molecular surfaces electropositive is turned with strengthening
Dye efficiency, but the method enhancing it is excessive it is electropositive simultaneously, also improve cytotoxicity；On the other hand, PAMAM surfaces are repaiied
Decorations PEG [Nanotechnology, 2009,20:105-103], to improve biocompatibility, reduce nonspecific combination blood plasma
In negative electricity macromolecular and red blood cell, in addition, the end modified specific proteins of PEG such as lactoferrin [Biomaterials,
2008,29(2):238-246], to realize tissue-targeting, but the modification of PEG increased PAMAM molecules and DNA molecular combination
Steric hindrance, reduce transfection efficiency.
EGF-R ELISA (Epidermal Growth Factor Receptor, EGFR) is a kind of with junket ammonia
The growth factor receptors of kinase activity, it is low in normal cell expression rate, and kinds of tumors for example lung cancer, colorectal cancer, kidney and
There is overexpression in the kinds of tumor cells such as G. cephalantha.EGFR signal paths play important in cancer develops
Effect, the unconventionality expression of EGFR often with feature such as cell propagation, immune evasion, transfer and relapse, the tumor vessel shape of malignant tumour
Into and the correlation such as chemotherapy resistance, poor prognosis, be oncotherapy with EGFR as target spot and for EGFR signal transduction pathways
Signal transduction therapeutic intervention provide theoretical foundation and experimental basis.
Monoclonal antibody is common treatment method in the oncotherapy mode with EGFR as target spot at present, and EGFR monoclonals resist
Body and endogenic ligand competition binding EGFR, are resisted by suppressing the activation of EGFR-TK, promoting the effect such as EGFR internalizations to produce
Tumor effect, also can mutually be coupled with cancer therapy drug or toxin, so as to reach the purpose that specificity suppresses tumour growth.
For example, the appropriate pearl monoclonal antibody (Nimotuzumab, h-R3) of Buddhist nun is anti-human EGFR Humanized monoclonal antibodies
(mAb), with humanized, high selectivity and long half time the characteristics of, it is capable of the knot of Reverse transcriptase endogenic ligand and EGFR
Close, suppress the tyrosine kinase activity of EGFR, the downstream signal transduction path that blocking is mediated by EGFR.In vivo and in vitro shows,
H-R3 has suppression tumor cell proliferation, promotes apoptosis of tumor cells, suppresses Tumor Angiongesis to increase Concurrent Chemoradiotherapy Sensitivity
Effect [Expert Rev Anticancer Ther, 2003,3 (3):367-380；Lung Cancer,2013,79(3)270-
275]。
The content of the invention
It is an object of the present invention to provide a kind of composition for artitumor multi-medicine-resistant.
The composition that the present invention is provided, by polyamide-amide dendritic, Buddhist nun trastuzumab h- of the end with amino
R3 and GCS siRNA are compound to be made.
GCS siRNA, purchased from Santa Cruz biotechnology (Shanghai) Co., Ltd., by siRNA-A, siRNA-B, siRNA-
Tri- kinds of siRNA compositions of C,
SiRNA-A by following two it is single-stranded constitute, positive-sense strand CAAGAAGGCAACUGACAAAtt (sequence 1)；Antisense strand is
UUUGUCAGUUGCCUUCUUGtt (sequence 2)；
SiRNA-B by following two it is single-stranded constitute, positive-sense strand GAACUUCACAUCCAAGAUAtt (sequence 3)；Antisense strand is
UAUCUUGGAUGUGAAGUUCtt (sequence 4)；
SiRNA-C by following two it is single-stranded constitute, positive-sense strand CAGUUUCAAUCCAGAAUGAtt (sequence 5)；Antisense strand is
UCAUUCUGGAUUGAAACUGtt (sequence 6).
In combinations of the above thing, the number-average molecular weight of the polyamide-amide dendritic is 28824.81.
In combinations of the above thing, the polyamide-amide dendritic is 1 with the nitrogen/phosphorus ratio of the GCS siRNA:
1-40:1.In combinations of the above thing, the polyamide-amide dendritic is 20 with the nitrogen/phosphorus ratio of the GCS siRNA:
1。
In combinations of the above thing, the mass ratio of the Buddhist nun's trastuzumab h-R3 and GCS siRNA is 0.05:1-5:1.
In combinations of the above thing, the mass ratio of the Buddhist nun's trastuzumab h-R3 and GCS siRNA is 0.05:1、0.1:
1 or 0.5:1.
It is a further object to provide a kind of method for preparing above-mentioned artitumor multi-medicine-resistant composition.
The method that the present invention is provided, comprises the following steps：
After end is mixed for the aqueous solution of the polyamide-amide dendritic of amino with GCS siRNA, incubation conditions
Under be self-assembly of the composition of polyamide-amide dendritic and GCS siRNA；Again by the polyamide-amide dendroid
Be added in Buddhist nun's trastuzumab h-R3 in the composition of polymer and GCS siRNA, be self-assembly of under incubation conditions polyamide-
The composition of amine dendritic, Buddhist nun trastuzumab h-R3 and GCS siRNA, that is, obtain described artitumor multi-medicine-resistant base
Because of composition.
Application of the combinations of the above thing in reversing multiple medicine resistance of tumor cells product is prepared is preparing antitumor cell
Application in MDR product is also the scope of protection of the invention.
In above-mentioned application, the tumour cell is multidrug resistance tumor cells, and the multidrug resistance tumor cells are specially
MCF-7/ADR；The product is medicine.
Application of the combinations of the above thing in targeting transport nucleic acid or preparation targeting transport nucleic acid product is also guarantor of the present invention
The scope of shield, nucleic acid in the present invention is GCS siRNA.
The experiment proves that, the present invention has advantages below：
1) with EGFR as target spot, the PAMAM carriers for forming Buddhist nun's trastuzumab h-R3 modifications by the method for self assembly are used as
Gene delivery vector, the endocytosis mediated using h-R3 and tumour cell EGFR improves target of the PAMAM carriers to tumour cell
Tropism, so as to, to intracellular, realize that genes of interest GCS siRNA's is heavy by for the siRNA Successful delivery of GCS genes
It is silent, further increase the sensitiveness of chemotherapeutics；2) modification by monoclonal antibody h-R3 to PAMAM, it is possible to decrease PAMAM is carried
The too strong positive charge intensity of body, advantageously reduces the generation of cytotoxicity and haemolysis；3) h- is prepared using self-assembling method
R3/PAMAM G5/GCS siRNA compositions, compared with chemical synthesis, molecular self-assembling method can be more convenient, flexible to body
System is modified, and keeps the bioactivity of part.
Brief description of the drawings
Fig. 1 is the table of GCS albumen in Western Blot methods detection sensitive cells MCF-7 and mdr cell MCF-7/ADR
Reach.
Fig. 2 is the expression of GCS albumen in PCR detection sensitive cells MCF-7 and mdr cell MCF-7/ADR.
Fig. 3 is the gel electrophoresis retardance figure of the PAMAM G5/GCS siRNA of different nitrogen/phosphorus ratio (N/P ratios).
Fig. 4 is influence of the different h-R3 modifications amounts to h-R3/PAMAM G5/GCS siRNA compound gel blocking results.
Fig. 5 is that PCR detects MCF-7/ADR cells GCS genes after the transfection of h-R3/PAMAM G5/GCS siRNA compounds
Expression
Fig. 6 is that PCR detects MCF-7/ADR cells MDR1 bases after the transfection of h-R3/PAMAM G5/GCS siRNA compounds
The expression of cause
Fig. 7 is that PCR detection MCF-7/ADR cells wither through h-R3/PAMAM G5/GCS siRNA compound Transfected cells
The expression of correlation factor of dying bcl-2
Fig. 8 is that PCR detection MCF-7/ADR cells wither through h-R3/PAMAM G5/GCS siRNA compound Transfected cells
The expression of correlation factor of dying caspase-3
Fig. 9 be Western Blot methods detect MCF-7/ADR cells through h-R3/PAMAM G5/GCS siRNA compounds and
The expression of GCS albumen after the transfection of EGF/PAMAM G5/GCS siRNA compounds
Figure 10 is that Western Blot methods detect MCF-7/ADR cells through h-R3/PAMAM G5/GCS siRNA compounds
With the expression of P glycoprotein after the transfection of EGF/PAMAM G5/GCS siRNA compounds
Specific embodiment
Experimental technique used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
Polyamide-amide dendritic (PAMAM)：End carries amino, with ethylenediamine as core, in 5.0 generations, (is purchased from
Sigma-Aldrich, article No.：536709,28824.81) specification 5g, number-average molecular weight is；Vacuumized using Rotary Evaporators,
Remove methanol solvate, obtain PAMAM G5, then dissolved with PBS (pH7.4), be prepared into 10mg/mL storing liquids standby in 4 DEG C
With.
Buddhist nun's trastuzumab (Nimotuzumab, h-R3)：Purchased from Biotech Pharmaceutical Co., Ltd..
MDRG (GCS) siRNA (GCS siRNA are also called UGCG siRNA)：Given birth to purchased from Santa Cruz
Thing technology (Shanghai) Co., Ltd., sc-45404 is made up of tri- kinds of siRNA of siRNA-A, siRNA-B, siRNA-C,
SiRNA-A by following two it is single-stranded constitute, positive-sense strand CAAGAAGGCAACUGACAAAtt；Antisense strand is
UUUGUCAGUUGCCUUCUUGtt；
SiRNA-B by following two it is single-stranded constitute, positive-sense strand GAACUUCACAUCCAAGAUAtt；Antisense strand is
UAUCUUGGAUGUGAAGUUCtt；
SiRNA-C by following two it is single-stranded constitute, positive-sense strand CAGUUUCAAUCCAGAAUGAtt；Antisense strand is
UCAUUCUGGAUUGAAACUGtt；
Drug-resistant cell strain (MCF-7/ADR)：Purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre
First using the table of GCS in immunoblotting (Western Blot, WB) detection mdr cell MCF-7/ADR
Reach, and be compared with sensitive cells MCF-7 (being purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre).Result is such as
Shown in Fig. 1,1 is MCF-7 cells, 2 is MCF-7/ADR cells；Understand GCS in drug-resistant cell strain MCF-7/ADR by result
Express apparently higher than the expression in sensitive cells strain MCF-7.Further using sensitive cells and resistance on PCR detection transcriptional levels
The difference of GCS expression in medicine cell, as a result as shown in Fig. 21：Marker；2：MDR1 in MCF-7；3：In MCF-7/ADR
MDR1；4：GCS in MCF-7；5：GCS in MCF-7/ADR；6：GAPDH in MCF-7；7：GAPDH in MCF-7/ADR；
Show in MCF-7 and MCF-7/Adr cell lines, the not only expression of GCS has differences, the expression of Mdr-p MDR1
Have differences.
Embodiment 1, preparation h-R3/PAMAM G5/GCS siRNA compounds and its sign
First, PAMAM G5/GCS siRNA compounds
Above-mentioned PAMAM G5 (number-average molecular weight is 28824.81) 10mg/mL storing liquids being made are dissolved in sterilization first
In distilled water, vibration is mixed, and is configured to the working solution of 1mg/mL, and 4 DEG C store for future use.1.0 μ g GCS siRNA are taken before transfection
It is placed in EP pipes, is separately added into the PAMAM G5 that 0.7 μ L, 1.4 μ L, 3.5 μ L, 7 μ L, 14 μ L, 21 μ L, 28 μ L concentration are 1mg/mL
Working solution, adds opti-MEM culture mediums (purchased from invitrogen, catalog number is 11058-021) 500uL, mixes
30 min of rearmounted incubation at room temperature form PAMAM G5/GCS siRNA compounds.The PAMAM G5/GCS siRNA compounds of formation
In, the nitrogen/phosphorus ratio respectively 1 of PAMAM and GCS siRNA:1、2:1、5:1、10:1、20:1、30:1、40:1.
The PAMAM G5/GCS siRNA compounds of above-mentioned preparation are proved using agarose gel electrophoresis retardation experiment
The combining case and stability of PAMAM and GCS siRNA.In the PAMAM G5/GCS siRNA compounds for being detected, PAMAM
With the nitrogen/phosphorus ratio respectively 1 of GCS siRNA:1、2:1、5:1、10:1、20:1、30:1、40:1.
Specific method is as follows：
Appropriate agarose is weighed, 1 × TAE solution is added, heating for dissolving prepares 1% Ago-Gel solution, room temperature cooling
To about 50 DEG C, 1 μ L ethidium bromide solutions (500 μ g/ml) insertion DNA dyeing is added, encapsulating, sample-adding, 120V electrophoresis 30min is left
The right side, ultraviolet transilluminator is observed and taken pictures.Transfection composite needed for Fresh, 1% agarose gel electrophoresis identification encapsulating effect.
Result is as shown in figure 3, swimming lane 1 is naked GCS siRNA；Swimming lane 2-8 be nitrogen/phosphorus ratio respectively 1,2,5,10,20,
30,40；Swimming lane 9 is RNA Marker, as a result shows siRNA (swimming lane 2-5) when not being completely combined with PAMAM, can be gone out
Existing normal electrophoretic band；When N/P ratios are 20 (swimming lane 6), PAMAM-siRNA can completely block the electricity of the siRNA of its parcel
Swimming, makes it be trapped near loading wells, it is impossible to which electrophoresis goes out normal electrophoretic band, when showing that N/P reaches 20, can form stabilization
PAMAM-siRNA。
2nd, h-R3/PAMAM G5/GCS siRNA compounds
By Buddhist nun's trastuzumab (Nimotuzumab, h-R3) with PBS (pH7.4, NaCl8.0g, KCl0.2g,
NaH2PO4·H2O1.56g,KH2PO40.20g, distilled water is settled to 1000ml), the monoclonal antibody solution that concentration is 1mg/mL is configured to,
The concentration of different volumes is added for the monoclonal antibody of 1mg/mL than the PAMAM G5/GCS siRNA compounds for 20 to 100 μ L nitrogen/phosphorus
Solution, mixes rearmounted incubation at room temperature 30min and forms h-R3/PAMAM G5/GCS siRNA compounds.Form h-R3/PAMAM
In G5/GCS siRNA compounds, the mass ratio of h-R3 and GCS siRNA is respectively 0.05:1、0.1:1、0.5:1、1:1、2:1、
5:Nitrogen/phosphorus the ratio of 1, PAMAM G5 and GCS siRNA is 20:1.
The h-R3/PAMAM G5/GCS siRNA compounds of above-mentioned preparation are demonstrate,proved using agarose gel electrophoresis retardation experiment
The combining case and stability of bright PAMAM and GCS siRNA, the h-R3/PAMAM G5/GCS siRNA compounds for being detected
In, the nitrogen/phosphorus ratio of PAMAM and GCS siRNA is 20:1；The mass ratio of h-R3 and GCS siRNA is respectively 0.05,0.1,0.5,
1,2,5.Method is ibid.
Agarose gel electrophoresis retardation experiment result such as Fig. 4 institutes of h-R3/PAMAM G5/GCS siRNA ternary complexs
Show, swimming lane 1 is naked GCS siRNA；Swimming lane 2-7 is PAMAM G5 and GCS siRNA nitrogen/phosphorus ratio is 20:1 and h-R3 and GCS
The mass ratio of siRNA is respectively 0.05,0.1,0.5,1,2,5 h-R3/PAMAM G5/GCS siRNA compounds；Swimming lane 8 is
Marker), it can be seen that when the mass ratio of h-R3 and GCS siRNA is 0.05,0.1,0.5, without naked siRNA bands, this
When the h-R3/PAMAM G5/GCS siRNA compounds that are formed be stable, can effectively wrap up GCS siRNA.
Therefore, with reference to above-mentioned conclusion, h-R3/PAMAM G5/GCS siRNA compounds, the nitrogen/phosphorus ratio of PAMAM and DNA is
20:1, and the mass ratio of h-R3 and GCS siRNA is 0.05,0.1,0.5, is optimum response composition.
The application of embodiment 2, h-R3/PAMAM G5/GCS siRNA composite bodies in many resistances of tumour cell are suppressed
First, drug resistant gene and correlation after the transfection of h-R3/PAMAM G5/GCS siRNA compounds are detected on transcriptional level
The expression of apoptogene
1st, expression of drug resistance genes amount detection after the transfection of h-R3/PAMAM G5/GCS siRNA composite bodies
1) GCS genes
By h-R3/PAMAM G5/GCS siRNA compounds, (nitrogen/phosphorus ratio of PAMAM and DNA is 20:1, and h-R3 and GCS
The mass ratio of siRNA enters mdr cell MCF-7/ADR 0.5) to transfect, using GCS in RT-PCR methods detection Transfected cells
The change of gene expression amount.
Primer sequence is：GCS for CCTTTCCTCTCCCCACCTTCCTCT
GCS re GGTTTCAGAAGAGAGACACCTGGG
Using GAPDH as reference gene.
Result is as shown in figure 5,1:Marker；2:GCS in untransfected MCF-7/ADR；3:After transfection in MCF-7/Adr
GCS；4:GAPDH in untransfected MCF-7/ADR；5:GAPDH after transfection in MCF-7/Adr, it will be seen that, after compound transfection
The expression of GCS genes is substantially reduced in mdr cell MCF-7/ADR.
2) Multidrug resistance gene MDR1
Multidrug resistance gene MDR1 is detected simultaneously,
Primer sequence is：MDR1 for ATATCAGCAGCCCACATCAT
MDR1 re GAAGCACTGGGATGTCCGGT
Using GAPDH as reference gene.
Result is as shown in fig. 6,1:GAPDH in untransfected MCF-7/Adr；2:GAPDH after transfection in MCF-7/Adr；
3：MDR1 in untransfected MCF-7/Adr；4:MDR1 after transfection in MCF-7/Adr；5:Marker, from the brightness of band 3 and 4
The upper brightness that can be seen that band 4 (MDR1 after transfection in MCF-7/Adr) is markedly less than (the untransfected MCF-7/Adr of band 3
In MDR1), illustrate mdr cell through h-R3/PAMAM G5/GCSsiRNA compounds transfect after MDR1 expression reduction.
After the transfection of h-R3/PAMAM G5/GCS siRNA compounds, the expression of MDR1 also has certain downward in mdr cell.
These results explanation h-R3/PAMAM can mediate GCS siRNA to enter in mdr cell, and GCS genes are sunk
Silent interference, while the expression to Multidrug resistance gene MDR1 also has certain inhibitory action.
2nd, to the detection of apoptosis-related genes bcl-2 and caspase-3
Detection to apoptosis-related genes bcl-2 and caspase-3 simultaneously
The primer sequence of bcl-2 is：bcl-2for TGCTGAAGATTGATGGGATC
bcl-2re TGCATTCTTGGACGAGGG
The primer sequence of caspase-3 is：caspase-3for TGTGGCATTGAGACAGAC
caspase-3re GAGGGAAATACAGTACCAAATA
Fig. 7 is that PCR detects MCF-7/ADR cells through h-R3/PAMAM/GCS siRNA compound Transfected cells apoptosis phases
The expression of factor bcl-2 is closed, wherein, 1:Marker；2:Bcl-2 in untransfected MCF-7/Adr；3:MCF-7/Adr after transfection
In bcl-2；4:GAPDH in untransfected MCF-7/Adr；5:GAPDH after transfection in MCF-7/Adr；Fig. 8 is detected for PCR
MCF-7/ADR cells through h-R3/PAMAM/GCS siRNA compound Transfected cells Apoptosis-Related Factors caspase-3 table
Reach, wherein 1:Marker；2:Caspase-3 in untransfected MCF-7/Adr；3:Caspase- after transfection in MCF-7/Adr
3；4:GAPDH in untreated MCF-7/Adr；5:GAPDH after treatment in MCF-7/Adr；
As can be seen that h-R3/PAMAM G5/GCS siRNA compounds transfection after, in mdr cell bcl-2 and
The expression of caspase-3 also has a certain degree of downward, so that further the silence of checking GCS genes can promote tumour cell
Apoptosis.
2nd, detected in translation skill drug resistance-associated proteins after the transfection of h-R3/PAMAM G5/GCS siRNA compounds with
And the expression of related apoptosis gene
In order to GCS siRNA effectively can be delivered to resistance by the PAMAM G5 compounds for further verifying h-R3 modifications
Cell and effect is played, control experiment is increased in the following embodiments, i.e., using the PAMAM G5 compounds of EGF modifications
GCS siRNA are carried to be tested.
1) GCS albumen
By h-R3/PAMAM G5/GCS siRNA compounds, (nitrogen/phosphorus ratio of PAMAM and DNA is 20:1, and h-R3 and GCS
The mass ratio of siRNA for 0.5) and control compound EGF/PAMAM G5/GCS siRNA compounds (preparation method is similar to,
Nitrogen/phosphorus the ratio of PAMAM and DNA is 20:1, and the mass ratio of EGF and GCS siRNA enters mdr cell 2) to transfect respectively
MCF-7/ADR, using the change of GCS expressing quantities in Western Blot methods detection Transfected cells, concurrently sets internal reference
GAPDH。
Specific method is as follows：
The preferable MCF-7/ADR cells of collection status (cell count, general 107 or so), are allowed to keep cell number
It is identical, (1100rpm is centrifuged 7min) is centrifuged, cell precipitation is obtained, carrying out albumen according to Protein Extraction Reagent kit afterwards carries
Take.Precipitated 2-3 times with PBS washed cells first, according to how much addition cell pyrolysis liquids of cell precipitation, in addition before will be in cell
5% protease inhibitors is added in lysate, 30min is stood on ice, determine protein concentration, add Loading Buffer,
Boiling water bath boils 10min, and -20 DEG C save backup.Western Blotting detections are carried out afterwards.
Result is as shown in figure 9, A:H-R3/PAMAM G5/GCS siRNA groups；B:EGF/PAMAM G5/GCS siRNA groups；
Band 1:MCF-7/ADR cells without compound treatment；Band 2:Through the MCF-7/ADR cells that compound is processed.From figure
The brightness of band can be seen that GCS expressing quantities after being transfected through two groups of compounds in MCF-7/ADR cells under
Drop, what h-R3/PAMAM G5/GCS siRNA group GCS albumen was lowered becomes apparent.This result shows what is modified compared to EGF
PAMAM G5/GCS siRNA compounds, the transfection efficiency of compound is higher after Buddhist nun's trastuzumab h-R3 modifications, swollen into resistance
Silencing efficiency is more preferable after oncocyte.
2) P glycoprotein
Drug resistance-associated proteins P glycoprotein is detected simultaneously, specific method is with 1).Result is as shown in Figure 10, A:h-R3/
PAMAM G5/GCS siRNA groups；B:EGF/PAMAM G5/GCS siRNA groups；Band 1:MCF-7/ without compound treatment
ADR cells；Band 2:Through the MCF-7/ADR cells that compound is processed.The brightness of band can be seen that compound through two groups from figure
P expressing quantities after thing transfection in MCF-7/ADR cells have declined, h-R3/PAMAM G5/GCS siRNA group P albumen
That lowers becomes apparent.This result further demonstrates that the PAMAM G5/GCS siRNA compounds modified compared to EGF, and Buddhist nun is appropriate
Pearl monoclonal antibody h-R3 modification after compound transfection efficiency it is higher, into cells of resistant tumors after silencing efficiency it is more preferable.
Claims (5)
1. a kind of composition for artitumor multi-medicine-resistant, polyamide-amide dendritic, the Buddhist nun of amino are carried by end
Trastuzumab h-R3 and GCS siRNA are compound to be made；
The polyamide-amide dendritic is 20 with the nitrogen/phosphorus ratio of the GCS siRNA:1；
The mass ratio of the Buddhist nun's trastuzumab h-R3 and GCS siRNA is 0.05:1、0.1:1 or 0.5:1；
The number-average molecular weight of the polyamide-amide dendritic is 28824.81.
2. a kind of method of the artitumor multi-medicine-resistant composition prepared described in claim 1, comprises the following steps：
After end is mixed for the aqueous solution of the polyamide-amide dendritic of amino with GCS siRNA, under incubation conditions certainly
Assembling forms the composition of polyamide-amide dendritic and GCS siRNA；The polyamide-amide dendroid is polymerized again
It is added in Buddhist nun's trastuzumab h-R3 in thing and the composition of GCS siRNA, polyamide-amide tree is self-assembly of under incubation conditions
The composition of dendritic polymer, Buddhist nun trastuzumab h-R3 and GCS siRNA, that is, obtain described artitumor multi-medicine-resistant genome
Compound.
3. application or prepare anti-swollen of the composition described in claim 1 in reversing multiple medicine resistance of tumor cells product is prepared
Application in oncocyte MDR product.
4. application according to claim 3, it is characterised in that：The tumour cell is multidrug resistance tumor cells；It is described
Product is medicine.
5. the composition described in claim 1 is in targeting transport nucleic acid or prepares the application targetted in transporting nucleic acid product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410373154.5A CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410373154.5A CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104174031A CN104174031A (en) | 2014-12-03 |
| CN104174031B true CN104174031B (en) | 2017-06-13 |
Family
ID=51955558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410373154.5A Active CN104174031B (en) | 2014-07-31 | 2014-07-31 | The genome compound h R3/PAMAM G5/GCS siRNA of reverse multiple drug resistance of tumor and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104174031B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113913424B (en) * | 2020-07-09 | 2023-08-08 | 四川大学华西医院 | Adeno-associated virus and application thereof in preparation of medicines for treating cocaine addiction |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517332A (en) * | 2011-11-24 | 2012-06-27 | 清华大学 | EGF (epidermal growth factor)-modified PAMAM (polyamidoamine) self-assembled composite for transgenosis as well as preparation method and applications thereof |
| CN103533961A (en) * | 2011-05-17 | 2014-01-22 | 勃林格殷格翰国际有限公司 | Method for egfr directed combination treatment of cancer |
-
2014
- 2014-07-31 CN CN201410373154.5A patent/CN104174031B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103533961A (en) * | 2011-05-17 | 2014-01-22 | 勃林格殷格翰国际有限公司 | Method for egfr directed combination treatment of cancer |
| CN102517332A (en) * | 2011-11-24 | 2012-06-27 | 清华大学 | EGF (epidermal growth factor)-modified PAMAM (polyamidoamine) self-assembled composite for transgenosis as well as preparation method and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| Enhanced transfection efficiency and targeted delivery of self-assembling h-R3-dendriplexes in EGFR-overexpressing tumor cells;Jun Li et al.;《Oncotarget》;20150720;第6卷(第28期);26177-26191 * |
| 自组装修饰在不同细胞系中对聚酰胺-胺介导的基因递送的影响;殷哲 等;《中国新药杂志》;20121231;第21卷(第23期);2740-2743,2752 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104174031A (en) | 2014-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Costa et al. | Tumor-targeted chlorotoxin-coupled nanoparticles for nucleic acid delivery to glioblastoma cells: a promising system for glioblastoma treatment | |
| JP6818889B2 (en) | Peptide nucleic acid complex with improved cell permeability and pharmaceutical composition containing it | |
| Chen et al. | Tumor-targeted delivery of siRNA by non-viral vector: safe and effective cancer therapy | |
| Xu et al. | A novel peptide-equipped exosomes platform for delivery of antisense oligonucleotides | |
| Shen et al. | An MRI-visible non-viral vector for targeted Bcl-2 siRNA delivery to neuroblastoma | |
| Ohyama et al. | In vitro and in vivo tumor-targeting siRNA delivery using folate-PEG-appended dendrimer (G4)/α-cyclodextrin conjugates | |
| Boado | RNA interference and nonviral targeted gene therapy of experimental brain cancer | |
| Chen et al. | Insights into the therapeutic potential of hypoxia-inducible factor-1α small interfering RNA in malignant melanoma delivered via folate-decorated cationic liposomes | |
| Li et al. | Captopril-polyethyleneimine conjugate modified gold nanoparticles for co-delivery of drug and gene in anti-angiogenesis breast cancer therapy | |
| Zhang et al. | Co-delivery of EGFR and BRD4 siRNA by cell-penetrating peptides-modified redox-responsive complex in triple negative breast cancer cells | |
| Fan et al. | Thioaptamer-conjugated CD44-targeted delivery system for the treatment of breast cancer in vitro and in vivo | |
| US20070287677A1 (en) | Rad51 Expression Inhibitors, Pharmaceutical Agents Containing The Inhibitors As Active Ingredients, And Uses Thereof | |
| Wu et al. | A gold nanoparticle platform for the delivery of functional TGF-β1 siRNA into cancer cells | |
| Cui et al. | Liposomal delivery of MicroRNA-7 targeting EGFR to inhibit the growth, invasion, and migration of ovarian cancer | |
| Liu et al. | Self-assembled nanoparticles based on the c (RGDfk) peptide for the delivery of siRNA targeting the VEGFR2 gene for tumor therapy | |
| Jia et al. | Self-assembled fluorescent hybrid nanoparticles-mediated collaborative lncRNA CCAT1 silencing and curcumin delivery for synchronous colorectal cancer theranostics | |
| CN107530439B (en) | SiRNA inhibition of human antigen R expression for treatment of cancer | |
| Liang et al. | Antitumor effect of a new nano-vector with miRNA-135a on malignant glioma | |
| Fan et al. | Application of aptamer-drug delivery system in the therapy of breast cancer | |
| Raguraman et al. | Drug delivery approaches for HuR-targeted therapy for lung cancer | |
| Kwak et al. | A trojan-horse strategy by in situ piggybacking onto endogenous albumin for tumor-specific neutralization of oncogenic microRNA | |
| JP6899201B2 (en) | Cell death inducer, cell proliferation inhibitor and therapeutic pharmaceutical composition for diseases caused by abnormal cell proliferation | |
| Liu et al. | CL4-modified exosomes deliver lncRNA DARS-AS1 siRNA to suppress triple-negative breast cancer progression and attenuate doxorubicin resistance by inhibiting autophagy | |
| WO2017162185A1 (en) | Ribonucleic acid aptamer having inhibitory effect on non-small cell lung cancer, and pharmaceutical composition comprising same | |
| Rotoli et al. | Advances in oligonucleotide aptamers for NSCLC targeting |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |