CN113913424A

CN113913424A - Adeno-associated virus and application thereof in preparing cocaine addiction treatment drug

Info

Publication number: CN113913424A
Application number: CN202010659727.6A
Authority: CN
Inventors: 岑小波; 蒋林宏
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-07-09
Filing date: 2020-07-09
Publication date: 2022-01-11
Anticipated expiration: 2040-07-09
Also published as: WO2022007316A1; CN113913424B

Abstract

The invention discloses an adeno-associated virus and application thereof in preparing a medicament for treating cocaine addiction, belonging to the field of drug rehabilitation medicaments. The key points of the technical scheme of the invention are as follows: shRNA gene for synthesizing the interfering glucose ceramide synthetase is designed and constructed into adeno-associated virus (also can be other viruses capable of being used as gene expression vectors), and the adeno-associated virus can effectively reduce cocaine addiction. The adeno-associated virus is used for preparing cocaine addiction drugs, and has good application value.

Description

Adeno-associated virus and application thereof in preparing cocaine addiction treatment drug

Technical Field

The present invention belongs to the field of drug-dropping medicine.

Background

Cocaine (Cocaine) is extracted directly from coca leaves, and is also called Cocaine with chemical name benzyl ecgonine. Early on, they were commonly used medically as local anesthetics or vasoconstrictors, and later lead to abuse due to their excitatory action on the central nervous system.

Acute toxicity caused by cocaine abuse is manifested by extreme agitation, uneasiness, mental disorder, blurred vision, tremor of limbs, and serious cases can induce cardiac rhythm disorder, general convulsion, respiratory failure and death. The food addicts often show symptoms such as anxiety, lassitude and extreme excitement, which closely resemble paranoid schizophrenia.

With long-term use of the cocaine-like drugs, the human brain undergoes structural and functional plastic changes in different brain regions. The strong craving of cocaine for medicine caused by smoking brings great harm to physical and mental health, causes exuberant spirit, mental functional deficiency and brings a series of concurrent disease infections, and even smokers can not always seek and obtain drugs to induce social activities.

Due to the fact that the cocaine addiction hazard is large, a proper treatment target and a proper medicine are found, and cocaine addiction treatment is imminent.

Glucose ceramide synthase (GCS; gene name: Ugcg, UDP-glucose ceramide glucosyltransferase) belongs to the family of glycosyltransferases, widely exists on the membrane of eukaryotes, and consists essentially of 394 amino acids. The current research on UGCG and the inhibitor thereof mainly focuses on the occurrence of the multidrug resistance mechanism of tumors, and no report on the relationship between the UGCG and the inhibitor and cocaine addiction is found.

Disclosure of Invention

The invention aims to solve the problems that: provides a recombinant virus capable of inhibiting the expression of Ugcg and provides the application of the virus in the drugs for treating cocaine addiction.

The technical scheme of the invention is as follows:

the target sequence of the shRNA is shown in SEQ ID NO. 1.

The term "target sequence" refers to: and the sequence is positioned in a genome and is targeted and recognized by siRNA formed by processing and shearing in vivo by shRNA.

The shRNA has the sequence of the RNA form of SEQ ID NO.3 or 4.

A double-stranded oligonucleotide, the sequence of which comprises the sequence of SEQ ID NO. 1.

The double-stranded oligonucleotide as described above, characterized in that: it is a double-stranded oligonucleotide formed by base complementary pairing of single-stranded oligonucleotides with sequences shown as SEQ ID NO.3 and SEQ ID NO. 4.

A recombinant plasmid comprising the double-stranded oligonucleotide.

The recombinant plasmid is obtained by inserting the double-stranded oligonucleotide into an RNA interference vector.

A recombinant virus carrying the aforementioned double-stranded oligonucleotide or an RNA form thereof;

or, any single strand of the double-stranded oligonucleotide or its RNA form.

The term "RNA form" refers to a sequence obtained by replacing T bases in a DNA sequence with U bases.

The recombinant virus as described above, which is an adeno-associated virus.

The shRNA or the recombinant virus for reducing the expression of the glucose ceramide synthase gene is used for preparing the medicine for treating cocaine addiction.

The use as described above, the shRNA is the shRNA described above;

or, the recombinant virus is the recombinant virus.

The shRNA, the double-stranded oligonucleotide, the recombinant plasmid and the recombinant virus can reduce the generation of GCS protein and inhibit the synthesis of downstream GlcCer (glucose ceramide) by inhibiting the expression of the Ugcg gene, thereby weakening behavior sensitization and conditional position preference caused by cocaine, providing a powerful tool for treating cocaine addiction and having good application prospect.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 RNA interference vector.

Figure 2 mouse behaviour sensitization experimental box.

FIG. 3 conditional position preference experimental box.

Figure 4 self-administration experimental box.

FIG. 5 cocaine-induced behavioral sensitization and conditioned place preference model establishment in mice. (A) Schematic representation of the cocaine-induced behavioral sensitization model operation. (B) Cocaine significantly enhanced spontaneous locomotor activity in mice, t-test,. p < 0.001. Cocaine group n is 14, saline group n is 14. (C) Schematic representation of cocaine-induced conditional location preference model operation. (D) Cocaine significantly reversed the reward effect in mice, t-test,. p < 0.001. Cocaine group n 15, saline group n 15.

FIG. 6 increased expression of GCS in nucleus accumbens. In the behavior sensitization effect, the expression of GCS in nucleus accumbens brain area of cocaine mice is obviously up-regulated. t test, p <0.05, cocaine group n-4, saline group n-4. In the conditioned place preference behavior, the expression of GCS in the nucleus accumbens brain region of cocaine mice was significantly up-regulated. t test, p <0.05, cocaine group n-6, saline group n-6.

Figure 7 multiple cocaine injections specifically increased nuclear vodka GCS protein expression. The nucleus accumbens GCS protein level was significantly elevated compared to the saline group, and the prefrontal cortex, striatum and hippocampal brain Ugcg protein levels showed no significant change. Prefrontal cortex (PFC), nucleus accumbens (NAc), Striatum (Striatum), hippocampus (Hippoampus), t-test, # p <0.05, cocaine group n-3, saline group n-3.

Figure 8 time-dependent effect of cocaine-induced increased GCS expression from nucleus accumbens. The expression of nucleus accumbens GCS increased statistically and steadily at day 3 with continuous intraperitoneal injection of cocaine compared to normal saline. t-test, p <0.05, p <0.01, p < 0.001. Cocaine group n is 4, saline group n is 4.

Figure 9 food-induced juxtaglomerular GCS expression did not change significantly. (A) Through food-induced mouse CPP training, compared with a control group, a food group mouse forms an obvious reward effect; t-test,. p < 0.01. Cocaine group n-8, saline group n-8. (B) In the food CPP model, compared with a control group, the food group mice have no significant change in the expression of nucleus accumbens GCS; t test, n.s has no significant change, cocaine group n is 4, and normal saline group n is 4.

Figure 10 silencing the Ugcg gene attenuated cocaine-induced behavioral sensitization effects. Two-way ANOVA analysis closed by bonferroni post-tests, p <0.05 and p < 0.01. AAV-shControl-saine group, n is 12; AAV-shControl-Cocaine group, n is 12; AAV-shUgcg-saine group, n ═ 14; AAV-shUgcg-Cocaine group, n is 14.

FIG. 11 silencing the Ugcg gene attenuated cocaine-induced conditional locus bias effects. One-way ANOVA is closed by bonferroni post-tests, # p <0.05, # p <0.01, # p < 0.001. AAV-shControl-saine group, n is 12; AAV-shControl-Cocaine group, n is 12; AAV-shUgcg-saine group, n ═ 14; AAV-shUgcg-Cocaine group, n is 14.

Figure 12 silencing Ugcg gene, retroplement of GlcCer, reversible silencing of Ugcg-induced behavioral sensitization (a) and conditional site-preference effects (B). Two-way ANOVA analysis closed by bonferroni post-tests, p <0.05 and p < 0.01. Saline-AAV-shControl-vehicle (SCV) group, n is 14; Cocaine-AAV-shControl-vehicle (ccv) group, n is 14; Cocaine-AAV-shUgcg-vessel (cav) group, n-14; Cocaine-AAV-shUgcg-glccer (cag) group, n-14.

Detailed Description

Example 1 construction of adeno-associated virus interfering with Ugcg expression according to the invention

3 to 4 siRNA targets are designed according to the transcript of the mouse Ugcg gene, and primer synthesis is arranged. Annealing the single-stranded primer into a double-stranded oligo (oligonucleotide) sequence, connecting the double-stranded oligo sequence with a double-enzyme digestion linearized RNA interference vector (figure 1), and replacing the original ccdB toxic gene. Transformants are screened by colony PCR, and sequencing verification is carried out on the screened positive clones. And (5) sequencing to verify correct clone, and performing high-purity plasmid extraction. The method mainly comprises the following steps:

1. interfering target design and primer synthesis:

designing siRNA target spots, arranging primer synthesis, and selecting the target spots shown in Table 1 after screening.

TABLE 1 siRNA target sequences

The primer sequences are shown in Table 2. In the table: most regions of the shUgcg-F and shUgcg-R are reversely complementary, and a double chain with a sticky end can be formed; shControl-F is complementary to most regions of shControl-R in the reverse direction, and can form a double strand with a sticky end. The capital bold font is the Stem region, the capital italic font is the Loop region, and the lowercase portion is the terminal linker sequence (including the transcription termination sequence and the enzyme restriction site sequence).

TABLE 2 DNA primer fragments

2. Primer annealing to form double-stranded fragments with sticky ends:

the synthesized primers were dissolved in an oligo annealing buffer to 20. mu.M, and 30. mu.l of each complementary single strand was mixed. Then the mixture is heated in a water bath kettle at 95 ℃ for 5min, and then the water bath kettle is uncovered and placed in the room temperature for natural cooling to the room temperature, and double-stranded oligo fragments are formed. Mu.l of the suspension was used for the subsequent ligation reaction and the remainder was stored at-20 ℃.

3. Preparation of linearized expression vector:

carrying out enzyme digestion on the expression vector by using restriction enzyme, wherein the enzyme digestion reaction system is as follows: plasmid 2. mu.g, 10 × reaction Buffer 5. mu.l, restriction enzyme 1. mu.l each, make up 50. mu.l of deionized water, incubate in 37 ℃ water bath for more than 2 h. The enzyme digestion product is subjected to Agarose Gel electrophoresis to detect the enzyme digestion effect, a target carrier band is cut from the Gel after the Agarose Gel electrophoresis, and the Gel is recovered by using TaKaRa miniBEST Agarose Gel DNA Extraction Kit Ver.3.0. The specific process is as follows:

3.1. an agarose gel is prepared using a TAE buffer or a TBE buffer, and then the target DNA is subjected to agarose gel electrophoresis.

3.2. The agarose gel containing the desired DNA was cut under an ultraviolet lamp and the liquid on the gel surface was blotted off with a paper towel. At this time, attention should be paid to cutting out the gel containing no target DNA portion as much as possible, minimizing the volume of the gel, and improving the DNA recovery rate. If the mass of the gel exceeds 300mg, a plurality of columns are required to be recycled, otherwise, the yield is seriously influenced.

3.3. And cutting the rubber blocks. The time for dissolving the gel block in the operation step 6 can be shortened after the gel block is cut up, and the recovery rate of DNA is improved.

3.4. And weighing the weight of the rubber block, and calculating the volume of the rubber block. When the volume of the gel mass was calculated, the volume was calculated from 1mg to 1 μ l.

3.5. Adding a gum block dissolving solution Buffer GM into the gum block, wherein the adding amount of the Buffer GM is shown in the table 3:

TABLE 3 Buffer GM addition

3.6. Mixing, and dissolving the gel block at room temperature of 15-25 deg.C (or heating at 37 deg.C when the gel concentration is high or relatively insoluble). At this time, the mixture should be shaken and mixed intermittently to dissolve the gum pieces sufficiently (about 5 to 10 minutes).

3.7. When the gel is completely dissolved, observing the color of the sol solution, if the color of the sol solution is changed from yellow to orange or pink, adding 10 μ l of 3M sodium acetate solution (pH5.2) into the above sol solution, and mixing until the solution is yellow. When DNA fragments smaller than 400bp are to be isolated, isopropanol should be added to this solution to a final concentration of 20%.

3.8. Spin Column in the kit was mounted on the Collection Tube.

3.9. The solution of the above operation step 7 was transferred to a Spin Column, centrifuged at 12,000rpm for 1 minute, and the filtrate was discarded.

3.10. Mu.l of Buffer WB was added to Spin Column, centrifuged at 12,000rpm at room temperature for 30 seconds, and the filtrate was discarded.

3.11. Operation step 10 is repeated.

3.12. Spin columns were mounted on a Collection Tube and centrifuged at 12,000rpm for 1 minute at room temperature.

3.13. Spin Column was placed on a new 1.5ml centrifuge tube, and 30. mu.l of sterile distilled water or Elution Buffer was added to the center of the Spin Column membrane, and allowed to stand at room temperature for 1 minute.

3.14. DNA was eluted by centrifugation at 12,000rpm for 1 minute at room temperature.

4. The interference fragment is connected into an expression vector:

the ligation reaction system is shown in Table 4.

TABLE 4 connection System

Ligation was carried out overnight at 16 ℃.

Description of the drawings: the annealed double-stranded oligo added for the positive control is a previously annealed verified fragment, which is the same length as the annealed double-stranded oligo added for the ligation group, but is not sequence-related.

5. Transformation of competent cells:

transformation of DH5 α competent cells. The specific operation steps are as follows:

1) 0.5-2. mu.L of the antibiotic-resistant plasmid was placed in 100. mu.L of competent cells on ice for 30 min.

2) The heat is applied for 90s at 42 ℃ and the tube is immediately placed on ice for 1-2 minutes without shaking.

3) Adding 1ml LB liquid culture medium into the tube, activating the bacteria at 37 deg.C, 200rpm,30 min-1 h.

4) Taking 50 bacteria liquid to coat a flat plate (if the conversion efficiency is low, more bacteria liquid can be taken or the supernatant is centrifugally discarded to take a lower-layer coated plate; the bacterium coating rod is baked on an alcohol lamp, then the plate is coated after the bacterium coating rod is placed to be slightly cool so as to prevent the cells from being killed), when the plate is coated, two bacterium coating rods are competent, resistance exists, no resistance exists, and one bacterium coating rod after transformation has resistance. (after coating, the plate was placed for a while, and after drying the bacterial solution, the plate was placed upside down in a 37 ℃ incubator for culture)

6. Colony PCR to identify positive transformants:

transformants grown on the plate were picked and resuspended in 10. mu.l of LB medium, and 1. mu.l was used as a template for colony PCR identification. Transformants were identified by colony PCR with forward primer pAKD-F TCATCAACCCGCTCCAAGGAAT (SEQ ID NO.7) located in the human H1 promoter sequence and reverse primer pAKD-R CAAGCTCGAAATTAACCCTCAC (SEQ ID NO.8) located downstream of the ccdB gene, and a 316bp fragment was obtained by positive cloning. The reaction system and PCR cycling conditions were as follows:

7. sequencing the positive clone:

and (4) sending the positive clone obtained after colony PCR identification to a sequencing company for sequencing verification. And (5) comparing the sequencing results by using Vector NTI software, and analyzing the sequencing results.

shUgcg sequencing result (SEQ ID NO. 9):

CGGAGTGTACTAGGCGGGACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCT GTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGA AATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGA CCACAGATCCCCGCCCACCATGTATTCAGATCTCAAGAGAATCTGAATACATGGTGG GCTTTTTTCGACGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTG GCCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCC TCTCTGCGCGCTCGCTCGCTCACTGAGGAAGGCGACGTGCGTCGCCCGATCCCGGG ATTTGACTAGTGGCCCGCGGGGATCAATGGGGAAGACGAAACTTCTAAGATAACCA AATCAAAAGACATCTCCCGTTTAAGGCGATCTGGAAGAACACATAGCGACATGCAA ATGTCGGAGGGCGCCGCTCCCCCGTGCCGCAGAGACTTCTTAGTGCCAGGGCGCTC GCGCGCTCTTTGTTGCCGCCTAGTGAAGCCGCGCCCGCGACTCCTTGGAGTGGGTTC ATGATGCGCGTCACGTACATTTCCCTCCTCTCTTCTTTTATTA

control sequencing result (SEQ ID NO. 10):

CGGGGGGCTCCTAGGCGGGACCCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCT GTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGA AATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGA CCACAGATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGA GAATTTTTTGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGT AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA CATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAAC TCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC TCTTCCTAGAGCATGGCTACACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGA TGGAGTTGGCCACTCCCCTTTT

8. the positive clone is verified by sequencing, and the plasmid is extracted

Extracted using AxyPrep plasmid DNA minikit. The operation is as follows:

1) 1-4ml of overnight-cultured broth in LB medium (if rich medium is used, the volume of broth should be reduced by half or less), centrifuged at 12,000 Xg for 1min, and the supernatant discarded.

2) 250 μ l of Buffer S1 was added to suspend the bacterial pellet evenly without leaving small clumps.

3) Add 250. mu.l Buffer S2, gently and thoroughly turn over 4-6 times and mix well to fully lyse the thallus until a clear solution is formed. This step should not be carried out for more than 5 min.

4) Add 350. mu.l Buffer S3, mix gently and thoroughly by tumbling 6-8 times, centrifuge at 12,000 Xg for 10 min.

5) The centrifuged supernatant from step 4 was aspirated and transferred to a preparation tube (placed in a 2ml centrifuge tube (provided in the kit)), centrifuged at 12,000 Xg for 1min, and the filtrate was discarded.

6) The tube was placed back into the centrifuge tube, 500. mu.l of Buffer W1 was added, and the mixture was centrifuged at 12,000 Xg for 1min, and the filtrate was discarded.

7) Placing the prepared tube back into the centrifuge tube, adding 700 μ l Buffer W2, centrifuging for 1min at 12,000 Xg, and discarding the filtrate; in the same manner, 700. mu.l of Buffer W2 was washed once more. The filtrate was discarded.

8) The prepared tube was placed back into a 2ml centrifuge tube and centrifuged at 12,000 Xg for 1 min.

9) The preparation tube was transferred to a new 1.5ml centrifuge tube (provided in the kit) and 60-80. mu.l of Eluent or deionized water was added to the center of the preparation tube membrane and allowed to stand at room temperature for 1 min. Centrifuge at 12,000 Xg for 1 min.

9. Virus package

293FT cells in good cell state and logarithmic growth phase were collected, and after counting, the cells were plated on 10cm dishes at 5X 10⁶The number of the cells is inoculated in a culture dish and cultured overnight in an incubator with 5% C02 at 37 ℃; the old culture solution is removed before the transfection in the next day, and 5mL of fresh DMEM culture solution containing 10% serum is added; preparation of DNA-Lipofectamine2000 complexes, a 10cm dish was used as an example to prepare a sterile 5mL centrifuge tube, add 1.5mL serum-free Opt-MEMI medium, then plV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5, and the desired plasmid (41 g each), mix gently by inversion to prepare another sterile 5m centrifuge tube, add 1.5mL blood-free Opti-MEM medium and 40L Lipofectamine 200. Mix by gentle inversion and incubate for 5 minutes at room temperature. After 5min, the diluted DNA was added to serum-free Opti-MEM medium containing 1lipofectamine2000 and mixed by gentle inversion. Incubation at room temperature for 20 minutes; the DNA-Lipofectamine2000 complex was added drop by drop to 293FT cells and the dishes were gently shaken back and forth to mix the complex. Placing in an incubator with 37 ℃ and 5% C0 saturated humidity for overnight culture; one day after transfection, 10mL of DMM medium containing 10% serum was replaced. Placing in an incubator at 37 ℃ and 5% CO2 saturated humidity for continuous culture; collecting culture supernatant 48 hours after transfection and concentrating; adding 10m of fresh culture solution for continuous culture, and collecting and concentrating again 72 hours after transfection; the collection and concentration conditions are as follows: centrifuging at 3000pm low speed for 5min, and filtering the supernatant with 0.45 μm filter to completely remove cell debris; each UT centrifugal tube is filled with 20mL of liquid, and is centrifuged at 50000 Xg at high speed for 90min at 4 ℃ to precipitate virus particles, supernatant is discarded, and a small amount of HSS is used for heavy suspension; 10mL of precooled 20% sucrose solution (HBSS dissolved) is filled in an UT centrifugal tube, the virus solution after being suspended and dissolved is carefully added on a sucrose page, and the virus particles are precipitated by high-speed centrifugation at 50000 Xg for 120min at the temperature of 20 ℃; discarding the centrifugal supernatant, and resuspending the virus precipitate with HBSS to obtain the recombinant lentivirus LV-shPRMT1 of the invention, and subpackaging into 0.5m1 inlet AXYGEN tubes with 100u1 per tube. The packaged virus is stored at-80 ℃.

10. Titre determination

Preparation of host cells: one day before transduction (day1), cells were trypsinized and cell densities were counted and plated at the appropriate cell density into 6-well plates (two cells were prepared for one sample) to achieve 30% confluency on the day of transfection-50%. Standing at 37 deg.C and 5% CO₂The culture was carried out overnight in a saturated humidity incubator. Virus transfection: on the day of transduction (day 2), the virus was thawed and serial samples were prepared at 10-fold dilutions from 10⁵To 10⁹. For each diluted sample, the virus is diluted to a total volume lml with complete medium. Polybrene was added to the virus-containing medium (working concentration was 6. mu.g/ml diluted virus to 1. mu.1 polybrene) to facilitate viral infection of the cells. Lightly blow and beat the mixture spoon. The culture medium was removed from the cells and complete culture medium containing already different amounts of virus was added. In addition, a well was reserved for cells without virus addition, and as a blank control, the volume of the culture solution added per well should be 1 ml. Standing at 37 deg.C and 5% CO₂The culture was carried out overnight in a saturated humidity incubator. One day after transfection (day 3), virus-containing medium was removed and 2mL of fresh complete medium was added. Standing at 37 deg.C and 5% CO₂And (3) overnight culture in a saturated humidity incubator: and counting the number of fluorescent clones 2-3 days after virus inoculation, and calculating the virus titer.

TABLE 5 Virus Titers

The following experimental examples demonstrate the advantageous effects of the present invention.

Experimental example 1 recombinant adeno-associated virus AAV-shUgcg of the present invention for treating cocaine addiction

1 test reagent

The reagents used in this section were as follows:

cocaine hydrochloride (Chinese food and drug testing institute)

Physiological saline (Sichuan Kelun pharmaceutical Co., Ltd.)

RIPA lysate (Shanghai Biyuntian biotechnology limited, P0013B)

BCA kit (Shanghai Bin Yuntian biotechnology limited, P0010)

5 xSDS-PAGE electrophoresis sample buffer (Shanghai Biyuntian biotechnology, Inc., P0015)

7.5% SDS-PAGE reagent (Guangzhou Baihe Biotechnology Co., Ltd., PG111)

10% SDS-PAGE reagent (Guangzhou Baihe Biotechnology Co., Ltd., PG112)

12.5% SDS-PAGE reagent (Guangzhou Baihe Biotechnology Ltd, PG113)

Methanol (Shanghai chemical reagent Co., Ltd.)

Protein Prestaining marker (Thermo Scientfic, 26616)

Tris-base(Solarbio，G8200)

Glycine (Solarbio, T8060)

anti-GCS antibody (Shanghai biological engineering Co., Ltd.)

anti-Tubulin antibody (Cell Signaling Technology, #15115)

Horseradish peroxidase-labeled secondary antibody (Cell Signaling Technology, #8887)

BeyoECL (Shanghai Biyuntian biotechnology limited, P0018)

Tween-20(Biorad，#1706531)

RNA extraction kit (Axygen, AP-MN-P-50)

Isopropanol (Shanghai chemical reagent Co., Ltd.)

100% ethanol (Shanghai chemical reagent Co., Ltd.)

DEPC water (Shanghai Biyuntian biotechnology limited company)

RNAstore sample preservation solution (Tiangen Biochemical technology Co., Ltd., DP408)

BestarTM qPCR RT Kit(

Bioscience，DBI-2220)

Stormstar SYBY Green qPCR Mastermix(

Bioscience，DBI-2243)

HPLC methanol (Sigma, 34860)

HPLC ethyl acetate (Sigma, 650528)

HPLC isopropanol (Sigma, 34863)

Formic acid (Sigma, 695076)

LC-MS ammonium formate (Sigma, 516961)

LC-MS sodium formate (Sigma, 71539)

LC-MS leucine enkephalin (Waters)

PE(17:0/17:0)(Avanti，830756)

LPC(17:0)(Avanti，855676)

Glucosylceramide(C18:1/16:0)(Avanti，860539)

Glucosylceramide((C18:1/18:0)(Avanti，860548)

Glucosylceramide((C18:1/24:1)(Avanti，860549)

Eliglustat hemitartrate(MedChemExpress，HY-14885A)

DMEM high-sugar medium (Hyclone, 41966052)

Fetal bovine serum (Hyclone, 10100139)

Phosphate buffer (Hyclone, 10010049)

Dimethyl sulfoxide (Sigma, V900090)

Nerve Growth Factor(Thermo Scientfic，13257019)

2 Main Instrument

Electronic analytical balance (Sartorius)

Super clean bench (Shanghai Boxun industry Co., Ltd medical equipment factory)

Refrigerator (Elex)

Deep low temperature refrigerator (Thermo Scientific)

Ice machine (Scotsman)

Flat shaking table (Kaimen kylin medical instrument factory)

Adjustable vortex suspension instrument (SCILOGEX)

Ultrasonic crusher (Ningbo Xinzhi biological science and technology Co., Ltd.)

Constant temperature water bath (Guohua electric appliance Co., Ltd.)

Inverted biological microscope TS100(Nikon)

Multi-tube rack automatic balance centrifuge (Changshan Xiang instrument centrifuge Co., Ltd.)

LifeECO Gene amplification apparatus (Hangzhou Bori science and technology Co., Ltd.)

Electrophoresis apparatus (American Bio-Rad company)

Electrophoresis tank (American Bio-Rad company)

Western blot gel imaging system (Shanghai Qixiang scientific instruments Co., Ltd.)

Constant temperature shaking table (Shanghai Zhicheng analytical instrument manufacturing Co., Ltd.)

Full wavelength plate reader (Thermo Electron Corporation)

CFX96TM Real-Time System (Bio-Rad, USA)

Mouse brain stereotaxic instrument (Shenzhen Riwode Biotech Co., Ltd.)

Mouse spontaneous activity detection box (Shenzhen Riwode Biotech Co., Ltd.)

Mouse conditional position preference detection box (Ningbo' anlai software science and technology limited)

Mouse self-administration detection box (Ningbo' anlai software science and technology Co., Ltd.)

Deep low temperature refrigerator (Thermo Scientific)

5 mul flat head microsyringe (Shenzhen Riwode Biotech Co., Ltd.)

Carbon dioxide incubator IGO150(Jouan)

Super clean bench (Shanghai Boxun industry Co., Ltd medical equipment factory)

Constant temperature water bath (Guohua electric appliance Co., Ltd.)

Inverted biological microscope TS100(Nikon)

UPLC-Qtof-MS/MS (G2-S) separation detector (Waters)

C18 chromatographic separation column (Waters)

Ultrasonic crusher (Ningbo Xinzhi biological science and technology Co., Ltd.)

Mini pipet (Eppendorf)

3 Experimental methods

3.1 test animals

The wild type animals used in this study were male SPF grade healthy mature (8-12 weeks old) C57BL/6J mice, supplied by Beijing Wintolite laboratory animal technology, Inc., weighing 20-22g, and not mated. Feeding conditions are as follows: the temperature of a common animal house of the national (Chengdu) new drug preclinical safety evaluation center is 20-25 ℃, the relative humidity is 55-65%, in the whole experiment process, animals freely eat and drink water, and the feeding environment meets the standard GB14925-2001 in Experimental animal environment and facilities. All animal experimental operations related to the subject meet AAALAC requirements, and experimental animals need to be normally raised for 3-5 days before experiments so as to enable mice to be familiar with and adapt to the environment.

3.2 multiple cocaine injections

Multiple cocaine injections are mainly given according to the literature dosing scheme. The method specifically comprises the following steps: the injection is made by injecting cocaine 20mg/kg once per day for 7 days. And after the cocaine is injected for the last time for half an hour, taking out four brain area samples of prefrontal cortex, striatum, nucleus accumbens and hippocampus according to the stereotaxis of the mouse brain for Western blot detection.

The specific procedures for multiple cocaine injections to detect the time effect were: injecting cocaine 20mg/kg intraperitoneally once a day for 1, 2, 3, 5 and 7 days. And taking out nucleus accumbens by referring to the stereotaxic atlas of the mouse brain half an hour after the cocaine is injected for the last time.

3.3 cocaine-induced behavioral sensitization model establishment

Cocaine-induced mouse behavioral sensitization model dosing regimens were referenced to literature dosing regimens and slightly modified. The behavior sensitization experiment box is made of organic glass into four square boxes with the same size, a smooth black organic glass plate is arranged around each box, a smooth white organic glass plate is arranged at the bottom of each box, and the behavior sensitization experiment box device is shown in figure 2. The mice were allowed to move freely in the experimental box, acclimatized for three days, 10min a day. The behavioral sensitization experiment was divided into 2 stages, during which cocaine and saline were injected according to table 6. First stage (day 0): without any treatment, the distance traveled by all mice within 15min was recorded as a base value using Ethovision XT from Noldus corporation. Second stage (day1-day 7): cocaine was given to the cocaine group at the same time per day, and the saline group was given an equivalent dose of saline for 7 consecutive days, 1 time per day. The dosing regimen is shown in table 6. Immediately after administration, the mice were placed in a behavior sensitization box and the distance traveled by the mice was recorded for 15 min. The experimental results were analyzed using SPSS statistical software, the differences were expressed as mean. + -. standard error, the difference between cocaine and saline groups was compared using two-tailed t-test analysis, and p <0.05 indicated a statistical difference.

Table 6 behaviour-sensitizing dosing regimens

3.4 cocaine induces the mouse conditional Place Preference model (Conditioned Place Preference, CPP)

Mouse cocaine CPP addiction model reference methodologies were established and slightly modified, with the CPP control box shown in fig. 3. The CPP experiment box consists of a black box and a white box which are made of plastic clapboards and a middle gray box, wherein the black box is provided with black four walls and a round hole rough ground, and the white box is provided with white four walls and a stripe type rough bottom surface. The mice freely move in the experimental box, adapt to the environment for three days, 15min each time. The CPP experiment was divided into 3 stages, the first stage (day 1): mice were tested for natural preference. Second stage (day2-day 7): a training stage, during which, a channel between the boxes is sealed by a plastic partition board, cocaine is injected on 2, 4 and 6 days, the mouse is immediately placed in a non-preference box, physiological saline is injected on 3, 5 and 7 days, the mouse is immediately placed in a preference box, and the residence time of the mouse in the box is 15min each time; third stage (day 8): and a testing stage, wherein the plastic partition plate is removed, the mouse is allowed to freely move in the box, and the residence time of the mouse in the black box and the white box is recorded for 15 min. The dosing regimen is shown in table 7. The mice were dissected rapidly within 30min after the test was completed and the nucleus accumbens were removed for subsequent testing.

The results are expressed as a comparison of the time difference between the natural preference state and the preference state, using the time difference between the conditional place preference test period as the preference value after induction, minus the non-preference box dwell time difference. The experimental results were analyzed using SPSS statistical software, the differences were expressed as mean. + -. standard error, the difference between cocaine and saline groups was compared using two-tailed t-test analysis, and p <0.05 indicated a statistical difference.

TABLE 7 conditional site preference dosage regimen

3.5 cocaine model establishment

3.5.1 mouse jugular vein cannulation Retention

The jugular vein intubation retention is the basis for establishing an autonomous administration model and is a key step for determining the success of establishing the model. The experimental technique is mainly adjusted according to the laboratory conditions and the experimental purpose by referring to the literature reports. Before operation, the experimental animal adapts to the experimental environment for 3-5 days, and contacts with the experimenters every day, so that the experimental animal is prevented from generating stress reaction. The jugular vein cannula is prepared from an inlet silica gel hard tube (the outer diameter is 0.48mm, the inner diameter is 0.40mm, and the length is about 5mm) and a matched silica gel soft tube (the length is about 3mm), and the soft tube is arranged at the front end of the hard tube so as to avoid stimulation to a mouse.

During operation, according to the mouse weight, the mouse is subjected to intraperitoneal injection of chloral hydrate (10 percent, 10ml/kg) to anaesthetize the mouse, the mouse hair at the clavicle part on the left side of the neck is removed, the head of the mouse is fixed in an supine position towards an experimenter, a longitudinal 1cm incision is formed in the upper end of the clavicle, subcutaneous tissues are separated in a blunt mode, the head of the mouse is pulled away from the external vein of the neck, and a small amount of physiological saline can be dripped in the whole process to prevent the skin and blood vessels from being dry. An oblique opening is cut on the vein by an ophthalmic scissors, the hose end of the previously prepared cannula is inserted into the vein, and the cannula is fixed by knotting a surgical thread. The inserted pre-fabricated catheter pre-fills the entire tubing with heparin sodium to prevent clotting. The catheter cap was then closed and the neck and back wounds were sutured closed. After the operation is finished, the mice are kept warm on an electric blanket until the mice are awakened, and then the mice are placed in clean cages and are bred in five cages. From the next day of operation, small amount of heparin sodium containing antibiotics is injected by intubation every day, so that the catheter is ensured to be unblocked, and wound infection is prevented. The post-operative recovery period for mice is typically 7 days. Mice that have completed this procedure can be used to establish a model for cocaine self-administration.

3.5.2 mice Self-administration (Self-administration)

The mouse self-administration system was manufactured by anlai software technologies ltd (nibo, china) and shown in fig. 4. Every control box all places in the sound insulation cabinet that has the ventilating fan, and equipment mainly includes two nose touch wares in the control box, a cage lamp, infusion connected system, a box lamp and food groove. In addition, the drug delivery system also comprises a syringe pump, an experimental animal behavior recording system and the like.

During the training period of cocaine self-administration in mice, FR1(fixed ratio-1) is the simplest and most basic training mode, i.e. the system automatically pumps out a preset volume of cocaine every time the mouse touches an effective nasal trigger. In the study, FR1 program was used for training, the experimental training time was 120 min/day, the maximum number of injections per round of training was 100, the refractory period of the device was 20s each time, cocaine was injected at 0.75mg/kg, the left nasal palpation was effective nasal palpation, and the right nasal palpation was ineffective nasal palpation. After the nose is effective each time, the cage lamp is turned off, the signal lamp is on, and after the nose is ineffective, no reaction is caused. After the model is successfully established, the mice are dissected within 2h after the last administration, and the nucleus accumbens brain area is taken out for subsequent detection.

The success judgment standard of the self-administration model is as follows: forming a conditional reflection; the frequency stability of cocaine is obtained autonomously; the number of injections for three consecutive days of the animal is within 10% of its mean value.

3.6 food-induced conditional place preference model

Mouse food CPP model establishment is similar to cocaine-induced CPP operation. Prior to modeling, a 7 day starvation acclimation period was first performed, each acclimation for 15 min. During the adaptation period, the mice were allowed to eat only 1h per day, and only water was allowed to drink freely, but no feed was provided for the rest of the time. After the seventh day, the mice were tested for weight change. Mice with a weight not less than 70% of the initial weight were selected at the end of the seventh day for food CPP training. Starting on the eighth day, the original preferences are detected, then randomly grouped, and conditioned training and testing are carried out to alternately establish a food CPP model. During training, the mice subjected to food conditioning training eat food for 1 hour in a feeding cage, and then are immediately placed in a preference box for training for 15 min; the non-food conditioning training is carried out by performing 1h of false feeding (placing in a feeding cage, but not giving feed), immediately placing in a non-preference box, and training for 15 min. The animals in the control group were not fed before training and were fed for 1h after training.

The results are expressed as a comparison of the difference between the conditional place preference test period, the preference box dwell time minus the non-preference box dwell time difference as the post-induction preference, and the natural preference time difference. The experimental results were analyzed using SPSS statistical software, the differences were expressed as mean. + -. standard error, the differences between the food-induced and control groups were compared using two-tailed t-test analysis, with p <0.05 indicating a statistical difference.

3.7 tissue isolation and extraction

After the experimental detection of each group is finished, the neck is rapidly removed within the preset dissection time to kill the mouse, then the brain is rapidly separated, and after the brain is washed for 3 times by physiological saline at 4 ℃, the nucleus accumbens is separated and taken out according to the brain dissection map. Directly placing the nucleus into a prepared 1.5ml EP tube, quickly freezing and storing in liquid nitrogen, and finally completely storing at-80 ℃ until the tissue is collected for subsequent detection.

3.8 protein extraction and protein immunoblotting (Western blot)

3.8.1 extraction and quantification of total protein in brain tissue

Taking nucleus accumbens frozen at-80 ℃, adding a proper amount of 100 mu l RIPA lysate, adding protease inhibitors Cocktail and PMSF into the lysate system, and placing on ice for cracking for 15 min. The ultrasonic treatment is carried out in ice bath for 10 times, 5 seconds/time and 3 seconds in each interval, and the ultrasonic treatment aims to break tissue cells and fully release dissolved protein. Then, the mixture was centrifuged at 13000g for 15min at 4 ℃ and the supernatant was aspirated. Use of BCA protein quantification kit (Shanghai Biyuntian biotechnology)Limited) to quantify the protein concentration, the main steps are: first, BSA was diluted to a concentration gradient of 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, 0.025, 0 mg/ml; the extracted protein supernatant was then diluted 30-fold and 20. mu.l of each of the diluted BSA and protein samples were added to the corresponding well of a 96-well plate. Then 200. mu.l of the working solution was added to each well, and incubated at 37 ℃ for 20-25min in the absence of light. Subsequently, the absorbance value at 562nm is measured by a full-wavelength microplate reader, and when the BSA standard curve is linearly related to R²>And 0.99 is qualified quantification, and then the corresponding protein concentration of each sample is calculated. Samples were diluted accordingly as required and 5X protein loading buffer was added to each sample to give a final concentration of 1X. Boiling in water bath for 5min, packaging, and storing at-20 deg.C.

3.8.2 Western immunoblotting and Exposure

10% and 7.5% polyacrylamide gel isolates and 5% polyacrylamide gel supernatant concentrates were prepared according to the gel formulation kit. And (3) putting the prepared gel into an electrophoresis tank, adding an electrophoresis buffer solution, and then carrying out spotting. The sample loading volume was adjusted to moderate the sample concentration based on the abundance of each protein in the nucleus accumbens, and approximately 10. mu.l of protein sample was added per sample well. The protein sample was then compressed to the gel separation limit using 60V, and the voltage was increased to 80V after the band ran across the separation limit until the protein of interest was completely separated. Then, the gel loaded with the target protein is transferred from the glass plate to a transfer membrane holder with a filter paper "sandwich" structure, and the PVDF membrane activated by methanol is covered on the gel, the transfer membrane voltage is set as 100V, and the transfer membrane time is set according to the molecular weight of the protein. After the membrane transfer is completed, 5% skimmed milk blocking solution is prepared by TBST buffer solution, and the strips are soaked in the blocking solution and sealed for 1 hour by a shaking table at room temperature. The protein primary antibody was then diluted with the above blocking solution in the required proportions, the hybridizing bands were blocked in the primary antibody, overnight at 4 ℃, shaken on a shaker at 37 ℃ the next day for 1h, and the membrane was washed three times with TBST for 10min each. Selecting corresponding secondary antibody according to the species source of the primary antibody, diluting the secondary antibody according to the ratio of 1:5000, incubating for 1h at 37 ℃, washing the membrane for five times for 10min each time by TBST buffer after finishing, and then washing the membrane for 10min once by TBS buffer. And during exposure, preparing luminescence solution A and luminescence solution B according to the ratio of 1:1, placing the PVDF membrane loaded with the target protein in a luminescence mixed solution for reaction for 1min under the condition of keeping out of the sun, taking out the PVDF membrane, and sucking the redundant luminescence solution by using filter paper. The PVDF film was exposed to a gel imaging system. Data processing: the gray value of each strip of the exposed picture is read by a Clinx Image Analysis system, and the gray value of the Tubulin strip is used as an internal reference for standardized comparison.

4 results of the experiment

4.1 cocaine-induced behavioral sensitization and conditional place preference modeling

The distance of movement of the mice was measured in this experiment by intraperitoneal injection of 20mg/kg cocaine (FIG. 5A, B) for seven consecutive days. The results showed that the cocaine group mice had significantly higher movement distance than the saline group from the first day of administration and the movement distance tended to stabilize on the third day, indicating successful establishment of the behavioral sensitization model (fig. 5C, D).

4.2 expression of GCS in behavior sensitization and conditional location-preference behavior

To further confirm the effect of GCS on cocaine-induced addictive behaviors, Western Blot was used to detect changes in GCS protein levels in this assay. The results showed a significant increase in GCS protein levels, about 1.2 fold or so, in the behavioral sensitization and conditional site-preferred reward effects compared to the saline group (figure 6).

4.3 multiple injections of cocaine increased GCS expression in nucleus accumbens brain region

Neurosynaptic plastic brain regions induced by multiple cocaine administrations include the Prefrontal cortex (Prefrontal core), nucleus accumbens (Nuclear accumbens), Striatum (Striatum) and Hippocampus (Hippocampus). In order to study the influence of cocaine administration on GCS expression in each brain region, cocaine with a concentration of 20mg/kg is intraperitoneally injected at the same time point for 7 consecutive days, the neck of the mouse is removed and the mouse is sacrificed half an hour after the last administration, four brain regions of prefrontal cortex, nucleus accumbens, striatum and hippocampus are taken out, and the expression of GCS in the four brain regions is detected by Western blot. The results showed that upon intraperitoneal cocaine administration to mice, there was a significant increase in GCS expression in the nucleus accumbens brain region (p <0.05), but there was no significant change in the levels of GCS protein in the prefrontal cortex, striatum, and hippocampal brain regions (fig. 7) compared to the saline group. Thus, the results indicate that multiple cocaine injections can specifically increase the nucleus accumbens GCS protein expression.

4.4 cocaine-induced increase in nucleus accumbens GCS expression over time

In order to explore the change of GCS protein expression along with the prolonging of cocaine administration time, 5 time points are set in the experiment, cocaine is continuously administered for 1 day, 2 days, 3 days, 5 days and 7 days respectively, materials are taken half an hour after the last cocaine injection to obtain nucleus accumbens brain areas, and the nucleus accumbens GCS is detected through Western blot. The results showed that there was no significant change on

days

1 and 2 of continuous intraperitoneal administration of cocaine, and that the expression of GCS in mouse nucleus accumbens brain region induced by cocaine was significantly increased from day three and was stably expressed for 5 and 7 days after continuous administration, compared with the saline group (fig. 8). The above results indicate that cocaine-induced increase in GCS expression in nucleus accumbens increases with the time of cocaine administration, and that the expression tends to be stable after three days of administration, exhibiting a significant time dependence.

No significant change in GCS in the food-induced conditioned place preference model in the 4.5 volt nucleus septa

To study whether GCS was induced by cocaine drugs, the experiment was modeled using conditional positional preference of food-induced mice, which were fed for 1h before each training, and not fed for the control group, and all mice were fed 1h after training. As a result, it was found that the preference of the behavior of the mice in the food group was significantly reversed compared to that in the control group. However, the expression of GCS protein was detected by Western Blot, and as a result, it was found that the food group was not significantly changed compared to the control group (fig. 9).

4.6 silencing Ugcg expression significantly attenuated cocaine-induced behavioral sensitization, conditioned place preference behavioral effects

Using genetic means, site-directed injection of the recombinant adeno-associated virus obtained in example 1 into the nucleus accumbens brain region interfered with Ugcg expression. The results show that in the behavior sensitization model, the behavior sensitization effect of the shControl-cocaine group is obviously enhanced compared with that of the shControl-normal saline group; in the shUgcg-cocaine group, the behavioral sensitization effect of the mice was significantly reduced (fig. 10).

In conditioned place preference, cocaine-induced reward effects were significantly reduced following targeted injection of adeno-associated virus in the nucleus accumbens brain region to interfere with Ugcg expression (figure 11).

4.7 anaplerotic GlcCer (glucose ceramide) can reverse the behavioral effects induced by silencing Ugcg

The Ugcg is a synthetase of GlcCer, and the inhibition of the activity of the Ugcg can result in the reduction of the content of GlcCer which is a downstream synthetic product.

Using genetic means, site-directed injection of adeno-associated virus in the nucleus accumbens brain region interfered with Ugcg expression, and daily nucleus accumbens site-directed supplementation with GlcCer. The results show that in the behavioral sensitization model, GlcCer was replenished and the spontaneous locomotor distance of the mice increased significantly (fig. 12A); the attenuation of cocaine reward effects was clearly reversed in the conditional place preference model (fig. 12B).

The above results demonstrate that behavioral sensitization and conditioned place preference by cocaine can be attenuated by injecting the recombinant adeno-associated virus of the present invention; this attenuated effect can be reversed by GlcCer complementation, and it can be seen that the adeno-associated virus of the present invention acts by inhibiting the synthesis of downstream GlcCer.

In conclusion, the adeno-associated virus can be used for preparing medicaments for treating cocaine addiction, and has a good application prospect.

SEQUENCE LISTING

<110> Sichuan university Hospital in western China

<120> an adeno-associated virus and its use in preparing cocaine addiction treatment medicine

<130> GY159-2020P0110142CC

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> mouse (Mus musculus)

<400> 1

gcccaccatg tattcagat 19

<210> 2

<211> 19

<212> DNA

<213> mouse (Mus musculus)

<400> 2

ttctccgaac gtgtcacgt 19

<210> 3

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gatccccgcc caccatgtat tcagatctca agagaatctg aatacatggt gggcttttt 59

<210> 4

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

tcgaaaaaag cccaccatgt attcagattc tcttgagatc tgaatacatg gtgggcggg 59

<210> 5

<211> 60

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gatccccttc tccgaacgtg tcacgtttca agagaacgtg acacgttcgg agaatttttt 60

<210> 6

<211> 59

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

tcgaaaaaat tctccgaacg tgtcacgttc tcttgaaacg tgacacgttc ggagaaggg 59

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

tcatcaaccc gctccaagga at 22

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

caagctcgaa attaaccctc ac 22

<210> 9

<211> 665

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

cggagtgtac taggcgggac acccagcgcg cgtgcgccct ggcaggaaga tggctgtgag 60

ggacagggga gtggcgccct gcaatatttg catgtcgcta tgtgttctgg gaaatcacca 120

taaacgtgaa atgtctttgg atttgggaat cttataagtt ctgtatgaga ccacagatcc 180

ccgcccacca tgtattcaga tctcaagaga atctgaatac atggtgggct tttttcgacg 240

gtacccagct tttgttccct ttagtgaggg ttaatttcga gcttggccac gtgcggaccg 300

agcggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc 360

tcactgagga aggcgacgtg cgtcgcccga tcccgggatt tgactagtgg cccgcgggga 420

tcaatgggga agacgaaact tctaagataa ccaaatcaaa agacatctcc cgtttaaggc 480

gatctggaag aacacatagc gacatgcaaa tgtcggaggg cgccgctccc ccgtgccgca 540

gagacttctt agtgccaggg cgctcgcgcg ctctttgttg ccgcctagtg aagccgcgcc 600

cgcgactcct tggagtgggt tcatgatgcg cgtcacgtac atttccctcc tctcttcttt 660

tatta 665

<210> 10

<211> 589

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

cggggggctc ctaggcggga ccccagcgcg cgtgcgccct ggcaggaaga tggctgtgag 60

ggacagggga gtggcgccct gcaatatttg catgtcgcta tgtgttctgg gaaatcacca 120

taaacgtgaa atgtctttgg atttgggaat cttataagtt ctgtatgaga ccacagatcc 180

ccttctccga acgtgtcacg tttcaagaga acgtgacacg ttcggagaat tttttgtacc 240

cagcttttgt tccctttagt gagggttaat tgcgcgcttg gcgtaatcat ggtcatagct 300

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccgggagcat 360

aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc 420

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 480

cgcggggaga ggcggtttgc gtattgggcg ctcttcctag agcatggcta cacgtgcgga 540

ccgagcggcc gcaggaaccc ctagtgatgg agttggccac tcccctttt 589

Claims

1. An shRNA, which is characterized in that: the target sequence is shown in SEQ ID NO. 1.

2. An shRNA according to claim 1, wherein: the sequence is in the form of RNA of SEQ ID NO.3 or 4.

3. A double-stranded oligonucleotide, characterized in that: the sequence of the polypeptide comprises the sequence of SEQ ID NO. 1.

4. The double-stranded oligonucleotide of claim 3, wherein: it is a double-stranded oligonucleotide formed by base complementary pairing of single-stranded oligonucleotides with sequences shown as SEQ ID NO.3 and SEQ ID NO. 4.

5. A recombinant plasmid, characterized in that: which comprises the double-stranded oligonucleotide of claim 3 or 4.

6. The recombinant plasmid of claim 5, wherein: it is a recombinant plasmid obtained by inserting the double-stranded oligonucleotide according to claim 3 or 4 into an RNA interference vector.

7. A recombinant virus, characterized in that: said recombinant virus carrying the double-stranded oligonucleotide of any one of claims 3 or 4 or an RNA form thereof;

or, any single strand of the double-stranded oligonucleotide or its RNA form.

8. The recombinant virus of claim 7, wherein: the recombinant virus is an adeno-associated virus.

9. The shRNA or the recombinant virus for reducing the expression of the glucose ceramide synthase gene is used for preparing the medicine for treating cocaine addiction.

10. Use according to claim 9, characterized in that: the shRNA is the shRNA according to claim 1 or 2;

or, the recombinant virus is the recombinant virus of claim 7 or 8.