CN105087609A

CN105087609A - Recombinant lentivirus and application of recombinant lentivirus to preparation of drug for treating cocainism

Info

Publication number: CN105087609A
Application number: CN201510510973.4A
Authority: CN
Inventors: 岑小波; 邵雪
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2015-08-19
Filing date: 2015-08-19
Publication date: 2015-11-25
Anticipated expiration: 2035-08-19
Also published as: CN105087609B

Abstract

The invention discloses a nucleotide sequence as shown in SEQ ID NO.1 and 2 and also discloses a recombinant plasmid containing the nucleotide sequence and a recombinant lentivirus containing the recombinant plasmid. An shRNA primer as shown in SEQ ID NO.1 and 2, the recombinant plasmid containing the shRNA primer and the recombinant lentivirus containing the recombinant plasmid can be used for silencing an HMGCS2 gene, reducing the expression of HMGCS2, effectively weakening the cocaine rewarding behavior, reducing behavioral sensitization and conditioned place preference degrees and treating cocainism, and has a favorable clinical application prospect.

Description

A kind of recombinant slow virus and the purposes in the medicine of preparation treatment cocaine habituation thereof

Technical field

The present invention relates to a kind of recombinant slow virus and the purposes in the medicine of preparation treatment cocaine habituation thereof.

Background technology

Cocaine (Cocaine) is also known as cocaine, chemistry benzoyl-methyl-ecgonine (methylbenzoylecgonine) by name, general in white crystalline, odorless, bitter and numb, it for toponarcosis and treatment asthma, is the strongest natural central stimulant the earliest, because it causes abuse to the excitation of central nervous system, within 1985, rise and become one of worldwide main drugs.

Cocaine habituation, it is a kind of chronic recurrent encephalopathy, belong to pharmacological dependence (drugdependence) class disease, cocaine habituation can cause the Changes of Plasticity of brain structure and function, related brain areas comprises nucleus accumbens septi, striatum, prefrontal cortex, hippocampus and ventral tegmental area, health is also subject to many-sided harm, comprises mental deterioration, personality defect, intelligence dysfunction, concurrent corresponding infection complication and drug addict and seeks at all adventures and use drugs and bring out various illegal activity.

Even if the principal feature of cocaine habituation shows as patient after knowing the serious consequence of medication, still mandatory ask for and use to meet desire, to medicine seek and ask for out of hand, things is lost interest, Drug addiction is very deep, even if after the withdrawal and treatment several years, contact the stimulation relevant with habituation (as poison friend, the environment etc. relevant with medication in the past) and all may bring out and relapse.

In view of cocaine habituation harm is very large, find suitable therapy target and medicine, treatment cocaine habituation is extremely urgent.

Summary of the invention

In order to solve the problem, the invention provides the medicine of a class treatment cocaine habituation.

HMGCS2:3 hydroxyl 3 first glutaryl coenzyme A synthetic enzyme 2.

HMGCS2 inhibitor: suppress the activity of 3 hydroxyl 3 first glutaryl coenzyme A synthetic enzyme or the material of expression.

First, the invention provides a kind of nucleotide sequence, its nucleotide sequence is following (shown in SEQIDNO.1.

Present invention also offers a kind of nucleotide sequence, its nucleotide sequence is as shown in SEQIDNO.2.

Present invention also offers a kind of recombinant plasmid, it comprises the recombinant plasmid of nucleotide sequence described in SEQIDNO.1 and SEQIDNO.2.

Preferably, described recombinant plasmid is restructuring PLLU2G plasmid.Further preferably, the nucleotide sequence of described recombinant plasmid is as shown in SEQIDNO.3.

Present invention also offers a kind of recombinant slow virus, it comprises the recombinant plasmid of aforementioned any one.

Present invention also offers aforesaid nucleotide sequence, recombinant plasmid or the recombinant slow virus purposes in preparation HMGCS2 inhibitor.

Present invention also offers aforesaid nucleotide sequence, recombinant plasmid or the recombinant slow virus purposes in the medicine preparing cocaine habituation.

Present invention also offers a kind of medicine for the treatment of cocaine habituation, it be with aforesaid nucleotide sequence, recombinant plasmid or recombinant slow virus for activeconstituents, add the preparation that pharmaceutically acceptable auxiliary material is prepared from.

Preferably, described preparation is injection formulations.

ShRNA primer shown in SEQIDNO.1 and SEQIDNO.2 of the present invention, comprise the recombinant plasmid of aforementioned shRNA primer and comprise the recombinant slow virus of this recombinant plasmid, can reticent HMGCS2 gene, lower the expression of HMGCS2, effectively weaken Cocaine award behavior, alleviate locomotor sensitivity and Conditioned place preference, treatment cocaine habituation, potential applicability in clinical practice is good.

The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.

Accompanying drawing explanation

Fig. 1 mouse Conditioned place preference case

Fig. 2 Conditioned place preference experimental design schematic diagram.Group I: physiological saline group; Group II: Cocaine group.S: intraperitoneal injection of saline; C: abdominal injection Cocaine.

Fig. 3 spontaneous activity in mice case

The expression of Fig. 4 Cocaine process inducing mouse nucleus accumbens septi HMGCS2 and activity.(A) expression level of Cocaine Conditioned place preference mouse nucleus accumbens septi HMGCS2.(B) 30min (Single-30min) and 24h (Single-24h) after Cocaine single-dose, the expression level of successive administration 7 days (Repeated-7days) nucleus accumbens septi HMGCS2 afterwards.(C) enzymic activity of Cocaine Conditioned place preference mouse nucleus accumbens septi HMGCS2.Saline, SA: intraperitoneal injection of saline group; Cocaine, CO: abdominal injection Cocaine group.N=6/ group.* p<0.05,30min and 24h, successive administration 7 days after Cocaine Conditioned place preference habituation, single-dose, respectively organizing to compare with physiological saline group has significant difference.

Fig. 5 nucleus accumbens septi injection HMGCS2 micromolecular inhibitor is on the impact of the locomotor sensitivity that Cocaine is induced.(A) nucleus accumbens septi injection Hymeglusin disturbs Cocaine spontaneous activity locomotor sensitivity model establishment model figure.(B) nucleus accumbens septi injection Hymeglusin is on the impact of the spontaneous activity that Cocaine is induced, n=15/ group.(C) Hymeglusin pre-treatment is on the impact of the enzymic activity of Cocaine locomotor sensitivity mouse nucleus accumbens septi HMGCS2, n=6/ group.Saline-Saline: nucleus accumbens septi injecting normal saline-intraperitoneal injection of saline group; Hymeglusin-Saline: nucleus accumbens septi injection Hymeglusin-intraperitoneal injection of saline group; Saline-Cocaine: nucleus accumbens septi injecting normal saline-abdominal injection Cocaine group; Hymeglusin-Cocaine: nucleus accumbens septi injection Hymeglusin-abdominal injection Cocaine group.* p<0.05, Hymeglusin-Saline group, Saline-Cocaine group, volt Hymeglusin-Cocaine group compares with Saline-Saline group respectively significant difference.#p<0.05, Hymeglusin-Cocaine group compares with Saline-Cocaine group significant difference.

Fig. 6 nucleus accumbens septi injection HMGCS2 micromolecular inhibitor is on the impact of Cocaine Conditioned place preference.(A) nucleus accumbens septi injection Hymeglusin disturbs Cocaine Conditioned place preference pattern establishment model figure.(B) nucleus accumbens septi injection Hymeglusin is on the impact of Cocaine Conditioned place preference, n=15/ group.(C) mRNA of Hymeglusin pre-treatment on the Cocaine Conditioned place preference mouse nucleus accumbens septi HMGCS2 impact of transcribing, n=15/ group.(D) Hymeglusin pre-treatment is on the impact of the protein expression of Cocaine Conditioned place preference mouse nucleus accumbens septi HMGCS2, n=15/ group.Saline-Saline: nucleus accumbens septi injecting normal saline-intraperitoneal injection of saline group; Hymeglusin-Saline: nucleus accumbens septi injection Hymeglusin-intraperitoneal injection of saline group; Saline-Cocaine: nucleus accumbens septi injecting normal saline-abdominal injection Cocaine group; Hymeglusin-Cocaine: nucleus accumbens septi injection Hymeglusin-abdominal injection Cocaine group.* p<0.05, Hymeglusin-Saline group, Saline-Cocaine group, Hymeglusin-Cocaine group compare with Saline-Saline group respectively significant difference.#p<0.05, Hymeglusin-Cocaine group compares with Saline-Cocaine group significant difference.

Fig. 7 HMGCS2 micromolecular inhibitor is on the impact of Cocaine Conditioned place preference mouse nucleus accumbens septi form of energy.(A) Hymeglusin disturbs the content of nucleus accumbens septi ATP under Cocaine Conditioned place preference pattern.(B) Hymeglusin disturbs the content of nucleus accumbens septi acetyl-CoA (Acetyl-CoA) under Cocaine Conditioned place preference pattern.(C) Hymeglusin disturbs the change of nucleus accumbens septi Oxalacetic transacetase activity under Cocaine Conditioned place preference pattern.(D) Hymeglusin disturbs the change of nucleus accumbens septi NAD+/NADH ratio under Cocaine Conditioned place preference pattern.Saline-Saline: nucleus accumbens septi injecting normal saline-intraperitoneal injection of saline group; Hymeglusin-Saline: nucleus accumbens septi injection Hymeglusin-intraperitoneal injection of saline group; Saline-Cocaine: nucleus accumbens septi injecting normal saline-abdominal injection Cocaine group; Hymeglusin-Cocaine: nucleus accumbens septi injection Hymeglusin-abdominal injection Cocaine group.N=6/ group.* p<0.05, Hymeglusin-Saline group, Saline-Cocaine group, Hymeglusin-Cocaine group compare with Saline-Saline group respectively significant difference.#p<0.05, Hymeglusin-Cocaine group compares with Saline-Cocaine group significant difference.

The reticent nucleus accumbens septi Hmgcs2 of Fig. 8 is on the impact of Cocaine locomotor sensitivity.(A) slow virus shHmgcs2 injects schematic diagram at nucleus accumbens septi.(B) nucleus accumbens septi injection shHmgcs2 slow virus is on the impact of the spontaneous activity that Cocaine is induced, n=15/ group.(C), under Cocaine locomotor sensitivity model, nucleus accumbens septi injects shHmgcs2 slow virus to the impact of HMGCS2mRNA transcriptional level, n=6/ group.(D), under Cocaine locomotor sensitivity model, nucleus accumbens septi injects shHmgcs2 slow virus to the impact of HMGCS2 protein expression level, n=6/ group.* p<0.05, shHmgcs2-Saline group, shControl-Cocaine group, shHmgcs2-Cocaine group compare with shControl-Saline group respectively significant difference.#p<0.05, shHmgcs2-Cocaine group compares with shControl-Cocaine group significant difference.

The impact of Fig. 9 reticent nucleus accumbens septi Hmgcs2 gene pairs Cocaine Conditioned place preference.(A) nucleus accumbens septi injection shHmgcs2 slow virus is on the impact of the Conditioned place preference that Cocaine is induced, n=15/ group.(B), under Cocaine locomotor sensitivity model, nucleus accumbens septi injects shHmgcs2 slow virus to the impact of HMGCS2 enzymic activity, n=6/ group.* p<0.05, shHmgcs2-Saline group, shControl-Cocaine group, shHmgcs2-Cocaine group compare with shControl-Saline group respectively significant difference.#p<0.05, shHmgcs2-Cocaine group compares with shControl-Cocaine group significant difference.

The impact of Figure 10 reticent nucleus accumbens septi Hmgcs2 gene pairs Cocaine Conditioned place preference mouse nucleus accumbens septi form of energy.(A) content of nucleus accumbens septi ATP under nucleus accumbens septi injection shHmgcs2 slow virus interference Cocaine Conditioned place preference pattern.(B) content of nucleus accumbens septi acetyl-CoA (Acetyl-CoA) under nucleus accumbens septi injection shHmgcs2 slow virus interference Cocaine Conditioned place preference pattern.(C) change of nucleus accumbens septi Oxalacetic transacetase activity under nucleus accumbens septi injection shHmgcs2 slow virus interference Cocaine Conditioned place preference pattern.(D) change of nucleus accumbens septi NAD+/NADH ratio under nucleus accumbens septi injection shHmgcs2 slow virus interference Cocaine Conditioned place preference pattern.N=6/ group.* p<0.05, shHmgcs2-Saline group, shControl-Cocaine group, shHmgcs2-Cocaine group compare with shControl-Saline group respectively significant difference.#p<0.05, shHmgcs2-Cocaine group compares with shControl-Cocaine group significant difference.

Figure 11 swimming lane 1: blank; Swimming lane 2: positive control; Swimming lane 3 ~ swimming lane 9:PLLU2G-shHmgcs2 1. ~ 8. number clone; M:100bpDNALadder.

Figure 12 recombinant vectors structural representation.

Figure 13 PLLU2G-shHmgcs2-1 plasmid transfection 293T cell 48h pathology situation.

Figure 14 PLLU2G-shcontrol plasmid transfection 293T cell 48h pathology situation.

Embodiment

The structure of embodiment 1 shRNA-Hmgcs2 slow virus of the present invention (interference HMGCS2 expresses slow virus)

I, the preparation of recombinant vectors

One, carrier information:

Plasmid designations: PLLU2G-shHmgcs2

Gene Name: Hmgcs2

Gene kind: Musmusculus

Mrna length: 1527bp

Cloning vector: PLLU2G

Carrier resistance: Amp

General planning: connection is cut in annealing, enzyme

Two, materials and methods

(1) material

1. plant and instrument

1) PCR instrument, U.S. BIO-RAD, model PTC-220/ALS-1296G/ALD1244G;

2) electrophoresis apparatus, Beijing Liuyi Instrument Factory, model DYY-12;

3) Horizontal electrophoresis tank, Beijing Liuyi Instrument Factory, model DYCP-31DN;

4) UVtransilluminator, U.S. UVP, model M-26;

5) compact centrifuge, U.S. Eppendorf, model 5418;

6) microwave oven, middle Guomei, model MW721AAU-PW;

7) air-heating type Constant Temp. Oven, east, Guangzhou electrothermal drying instrument factory, model east-B;

8) thermostat water bath, HENGAO, model HWT-6B;

9) full warm air shaking table, Shanghai Fuma Experiment Equipment Co., Ltd., model QYC-200;

2. reagent

1) QIAquickGelExtractionKit, QIAGEN, article No. 28704;

2) the little extraction reagent kit of plasmid, TIANGEN, article No. DP103-02;

3) dNTPMix, Fermentas, article No. #R0192;

4) GeneRuler ^tM100bpDNALadder, Fermentas, article No. #SM0241;

5) Hpa I, TAKARA, article No. D1064A;

6) Xho I, TAKARA, article No. D1094A;

7) T4DNALigase, TAKARA, article No. D2011A;

8) 5 × AnnealingBufferforDNAOligos, Beyotime, article No. D0251;

9) TaqDNAPolymerase, Fermentas, article No. EP0404;

(2) method

1. design and synthesize 1 pair of shRNAoligo, oligo sequence according to target gene Hmgcs2 as follows:

Oligo title	Oligo sequence 5 ' to 3 '
		shHmgcs2-F(SEQ ID NO.1)	TCGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGTTTTTC
shHmgcs2-R(SEQ ID NO.2)	TCGAGAAAAACGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGA
		Negative-F	TGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTTC
Negative-R	TCGAGAAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGCA

2. vector construction

The annealing of 2.1OligoDNA

1) water of DNAoligo DEPC to be annealed process is configured to 50 μMs, dissolves AnnealingBufferforDNAOligos (5 ×), mix for subsequent use.

2) it is as follows that reaction system is set:

DEPC-water	40μl
		Annealing Buffer for DNA Oligos(5×)	20μl
DNA oligo-F(50μM)	20μl
		DNA oligo-R(50μM)	20μl
Total volume	100μl

All ingredients is added successively, mixing according to above-mentioned reaction system.

3) arranging PCR instrument, to carry out annealing reaction as follows:

95℃	2min
		Every 8s declines 0.1 DEG C, is down to 25 DEG C	About 90min
4℃	Long-time preservation

4)-20 DEG C of Refrigerator stores.

2.2 enzymes cut carrier PLLU2G

1) the enzyme system of cutting arranges as follows:

2) 37 DEG C of enzymes cut 3 hours

3) 10 × loadingbuffer termination reaction, the sepharose with 1% carries out electrophoresis and cuts glue reclaiming.

The 2.3DNA agarose gel electrophoresis DNA agarose gel electrophoresis reclaimed with reference to sky root reclaims test kit and reclaims, electrophoresis again after recovery, and surveys concentration..

2.4 connect PLLU2G and shRNA fragment

1) linked system arranges as follows:

PLLU2G enzyme cuts back to close product (200 ~ 300ng)	3μl
		The Oligo DNA (1/10dilute) of annealing	1μl
10×T4DNA ligase buffer	2.5μl
		T4DNA ligase	1μl
H2O	17.5μl
		Total system	25μl

2) 4 DEG C of connections are spent the night.

2.5 transform stb13 bacterium

1) 10 μ L ligation reactions are joined in 100 μ LSTBL3ChemicallyCompetentE.coli, hatch 30 minutes on ice;

2) 42 DEG C of thermal shock cells 30 seconds;

3) transfer to immediately and hatch 2 minutes on ice;

4) add 250 μ LS.O.C.medium, 37 DEG C, hatch 1 hour in the shaking table of 225RPM.;

5) 100 μ L conversion products are coated onto on the LB flat board containing 100 μ g/mLAmp, 37 DEG C of overnight incubation.

2.6PCR screens positive recombinant.

1) PCR primers designed:

F：AGGCTTAATGTGCGATAAAAGAC

R：GAGCTTATCGATACCGTCGAC

2) PCR reaction system:

3) pcr amplification program:

2.7 picking positive colony plasmids.

2.8 deliver positive colony order-checking qualification.

Order-checking forward primer PLLU2G-CX-F:TGATAGGCTTGGATTTCT

Three, experimental result

1.PCR qualification result

As shown in figure 11, this PCR primer size is 279bp to PLLU2G-shHmgcs2PCR qualification figure, is positive colony with positive control band the clone of same position.

TTTCCCCGAAAAGTGCCACCTGAC。

2. check order qualification result

As shown in figure 12, its sequence is as shown in SEQIDNO.3 for the structure iron collection of illustrative plates of recombinant vectors PLLU2G-shHmgcs2.

PLLU2G-shcontrol complete sequence is as shown in SEQIDNO.4.

II, virus packaging and titer determination

One, plasmid information

Object plasmid designations: PLLU2G-shHmgcs2, PLLU2G-shcontrol

Gene Name: shHmgcs2

Helper plasmid title: pLV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5

Resistance: nothing

Two, related equipment is tested

Three, related reagent material is tested

Transfection reagent: Lipofectamine2000

Transfectional cell: 293T

Nutrient solution: H-DMEM+10%FBS

Transfection cocktail: serum-free nutrient solution

Other consumptive materials: 10cm culture dish, 5mL centrifuge tube, 0.45 μm of filter, 0.25% pancreatin

Four, experimentation

1. virus packaging

1.1 get cell state well, are in the 293T cell of logarithmic phase, after cell counting, according to the culture dish 5 × 10 of each 10cm ⁶individual cell count is inoculated in culture dish, 37 DEG C, overnight incubation in the incubator of 5%CO2;

1.2 remove old nutrient solution before transfection in second day, add 5mL fresh containing 10% serum DMEM nutrient solution; Preparation DNA-Lipofectamine2000 mixture, with the consumption of a 10cm culture dish for demonstration:

A. the 5mL centrifuge tube that preparation one is aseptic, first adds 1.5mL serum-free nutrient solution, then add pLV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5, object plasmid (each 4ug), put upside down mixing gently;

B. prepare, in an other aseptic 5mL centrifuge tube, to add 1.5mL serum-free the Lipofectamine2000 of nutrient solution and 40 μ L, puts upside down mixing gently.Incubated at room 5 minutes;

Minute C.5, after, dilution DNA is joined the serum-free containing Lipofectamine2000 nutrient solution, puts upside down mixing gently.Incubated at room 20 minutes;

DNA-Lipofectamine2000 mixture drop by drop adds in 293T cell by 1.3, and the culture dish that rocks back and forth lightly is to mix mixture.Place 37 DEG C, 5%CO ₂incubated overnight in saturated humidity incubator;

1.4 transfections one day after, change 10mL containing 10% serum DMEM nutrient solution.Place 37 DEG C, 5%CO ₂continue in saturated humidity incubator to cultivate;

After 1.5 transfections, 48 hr collections culture supernatant concentrate; Add the fresh nutrient solution of 10mL to continue to cultivate, within after transfection 72 hours, again collect concentrated;

A.3000rpm low-speed centrifugal 15min, supernatant 0.45 μm of filter filters, thoroughly to remove cell debris;

B. each UT centrifuge tube dress 20mL filtrate, 50000 × g high speed centrifugation 90min precipitate virus particle, supernatant discarded;

C. the resuspended viral pellet of HBSS of 2mL is got;

D. get UT centrifuge tube dress 15mL20% sucrose solution, then add 2mL viral suspension lentamente at superjacent, 50000 × g high speed centrifugation 120min purified virus, supernatant discarded;

E. the resuspended viral pellet of appropriate nutrient solution is got, in point threading 0.5mL import AXYGEN pipe, often pipe 100 μ l.

1.6 points of viruses installed place-80 DEG C of preservations.

2. titer determination

2.1 titres detect the day before yesterday, with every hole 5x10 ³individual cell (volume is 100 μ l) inoculates 293T cell in 96 orifice plates, and often kind of virus needs to use 10 holes, parallel dilution twice;

2.2 titres detect the day before yesterday, with every hole 5x10 ³individual cell (volume is 100 μ l) inoculates 293T cell in 96 orifice plates, and often kind of virus needs to use 20 holes, parallel dilution twice;

2.3 infect before, often kind of virus need prepare 10 aseptic Ep pipes, adds the fresh culture (DMEM+10%FBS, high sugar) of 90 μ l in each pipe; Getting virus stock solution used 11 μ l to be determined joins in first pipe, after mixing, gets 11 μ l and join in second pipe from first pipe.Continue an identical operation to the last pipe; Get virus stock solution used parallel dilution to be determined more once.

2.4 choose required cell hole and cover at culture plate and mark, and suck 90 μ l substratum.As the 90 μ l viral solution diluted in each pipe, in first pipe, virus is actual is 9.9 μ l, takes 10 μ l as, is denoted as 1E1, and the second pipe is denoted as 1E-0.... the 10th and manages as 1E-8;

2.537 DEG C, after 5%CO2 cultivates 48 hours, add fresh culture 100 μ l, then after 24 hours, change fresh culture 150 μ l; (careful operation avoids cell to be blown afloat)

After 2.696 hours, observe luciferase expression situation.Fluorocyte number is resistance to few with the increase of extension rate.Count in last 1 hole containing the fluorocyte number in the hole of fluorocyte.To numerical value be obtained just obtain divided by corresponding extension rate separately the titre value of virus stock solution used.(it is generally acknowledged that the reading in penultimate hole is more accurate)

As: 1E-5 gradient reads 5 fluorocytes, and so the virus titer of this virus stock solution used is: 5/1E-5=5*10 ⁵tU/ μ l, i.e. 5*10 ⁸tU/mL.

1E1

1E-0

1E-1

1E-2

1E-3

1E-4

1E-5

1E-6

1E-7

1E-8

Negative control

1E1

1E-0

1E-1

1E-2

1E-3

1E-4

1E-5

1E-6

1E-7

1E-8

Negative control

Five, experimental result

1. virus packaging result

PLLU2G-shHmgcs2 plasmid transfection 293T cell 48h pathology situation as shown in figure 13 (200 × visual field, 20mm fluorescence exposure rate).

PLLU2G-shcontrol plasmid transfection 293T cell 48h pathology situation is as shown in figure 14 (200 × visual field, 20mm fluorescence exposure rate):

2. titer determination result

PLLU2G-shHmgcs2 titre results:

PLLU2G-shcontrol titre results:

Below verify beneficial effect of the present invention by the mode of experimental example:

Experimental example 1HMGCS2 inhibitor for treating cocaine habituation

1 foreword

In this research, adopt pharmacology and genetic approach, to the mouse nucleus accumbens septi inner position injection micromolecular inhibitor of key enzyme or the slow virus of reticent key gene, in conjunction with ¹h-NMR metabonomic analysis confirms that HMGCS2 inhibitor effectively can treat cocaine habituation.

2 materials and methods

2.1 experiment material

2.1.1 experiment reagent

(1) cocaine hydrochloride, purchased from Chinese pharmaceutical biological product qualification institute.

(2) physiological saline, purchased from Kelun Pharm Ind Co., Ltd., Sichuan.

(3) Hymeglusin (1233A; F244; L-659-699), purchased from American Sigma-Aldrich company, its structural formula chemical formula is C ₁₈h ₂₈o ₅, molecular weight is 324.41.

(4) HMG-CoA synthase activity test kit, purchased from American GenmedScientifics company.

(5) glucokinase test kit, purchased from Australian ProteinOne company.

(6) RIPA lysate, purchased from the green skies Bioisystech Co., Ltd in Shanghai.

(7) BCA method determination of protein concentration test kit, purchased from American Pierce company.

(8) 5 × SDS-PAGE electrophoretic buffers, purchased from the green skies Bioisystech Co., Ltd in Shanghai.

(9) SDS-PAGE reagent (30% polyacrylamide, Tris-base, SDS, ammonium persulphate, TEMED, glycine), 0.22 μM of aperture pvdf membrane, purchased from American Bio-Rad company.

(10) pre-dsred protein marker, purchased from American ThermoScientfic (Fermentas) company.

(11) chemoluminescence development kit, purchased from American Pierce.

(12) Kodak Kodak film, purchased from American Kodak.

(13) antibody: rabbit anti-mouse HMGCS2 monoclonal antibody (ab137043), rabbit anti-mouse GCK polyclonal antibody (ab37796), purchased from Abcam company; Rabbit anti-mouse β-actin antibody (4697), purchased from CellSignalingTechnology company; The goat-anti rabbit two anti-(AS014) of horseradish peroxidase-labeled, purchased from Abclonal company.

(14) reticent Hmgcs2 slow virus and contrast slow virus, built by Sai Ye bio tech ltd, Guangzhou.

(15) liquid nitrogen, purchased from Chengdu Qiao Yuan gas company limited.

(16) nitrogen, purchased from Chengdu Qiao Yuan gas company limited.

(17) hplc grade methanol, purchased from American Fisherscientific company.

(18) chromatographic grade chloroform, purchased from Scharlau company of Spain.

(19) deuterated heavy water, purchased from American CIL (CambridgeIsotopeLaboratories) company.

(20) TSP, purchased from American Sigma-Aldrich company.

(21) Trizol, purchased from American Invitrogenlifetechnologies company.

(22) dehydrated alcohol, purchased from Solution on Chemical Reagents in Shanghai company limited.

(23) without DNA enzymatic/RNA enzyme deionized water, purchased from Beijing Tian Gen biochemical technology company limited.

(24) GoldView dyestuff, purchased from Shanghai match Bai Sheng gene engineering company limited.

(25) agarose, purchased from American Amerosco company.

(26) PrimeScriptRTreagentkit (Reverse Transcriptase kit), purchased from American Bio-Rad company.

(27) SYBRGreenSupermixkit, purchased from American Bio-Rad company.

(28) acetyl-CoA detection kit, purchased from American Sigma-Aldrich company.

(29) ATP detection kit, NAD ⁺/ NADH detection kit and Oxalacetic transacetase activity detection kit, purchased from American Abcam company.

mAcat2-F	CCCGTGGTCATCGTCTCAG
		mAcat2-R	GGACAGGGCACCATTGAAGG
mOxct1-F	CATAAGGGGTGTGTCTGCTACT
		mOxct1-R	GCAAGGTTGCACCATTAGGAAT
mOxct2b-F	GGGAGTGTCCATTTCTACACG
		mOxct2b-R	CCCAGGTAGGAGCACACCA
mAacs-F	ATACCACTGGTCTGTCCGGTC
		mAacs-R	CGTGAGTAGACGATTCCACTGA
β-actin-F	GAGACCTTCAACACCCCAGC
		β-actin-R	ATGTCACGCACGATTTCCC

(30) other reagent are domestic or Import Analysis is pure.

2.1.2 the preparation of main agents

(1) SDS-PAGE electrophoretic buffer: to 15.1gTris-base, 94g glycine and 5gSDS, in add 800mL distilled water, be settled to 1000mL after stirring and dissolving, room temperature preservation.

(2) transferring film damping fluid: add 600mL distilled water in 2.9g glycine, 5.8gTris-base and 0.37gSDS, be settled to 800mL after stirring and dissolving, finally add 200mL methyl alcohol, room temperature preservation.

(3) 10 × TBS damping fluids: add 800mL distilled water in 60.5gTris-base, 87.5gNaCl, drip concentrated hydrochloric acid and regulate pH to be 7.4, be finally settled to 1000mL, room temperature preservation after stirring and dissolving.

(4) TBST damping fluid: with 10 × TBS buffer 1000mL1 × TBS damping fluid, then add 1mLTween20 and fully mix, room temperature preservation.

(5) Block buffer: add 100mLTBST damping fluid in 5g skim-milk, stirring and dissolving uses or 4 DEG C of preservations (matching while using) immediately.

(6) antibodies buffer: join 100mLTBST damping fluid to 5g bovine serum albumin, stirring and dissolving uses or 4 DEG C of preservations (matching while using) immediately.

2.1.3 apparatus is tested

(1) stereotaxic apparatus, sleeve pipe, flat mouth microsyringe (1 μ L, 5 μ L), purchased from Shenzhen Rui Wode company.

(2) Ultrasonic Cell Disruptor, purchased from Ningbo Xin Zhike device institute.

(3) x-ray film automatic processor: purchased from German ProtecGmbH company.

(4) ice-making machine, purchased from American Scotsman company.

(5) high speed low temperature centrifugal machine, purchased from German Eppendorff company.

(6) protein electrophorese groove and electrophoresis power, purchased from American Bio-Rad company.

(7) gel imaging instrument, purchased from American Bio-Rad company.

(8) mouse position preference case, purchased from Huaibei Zhenghua Biological Instrument Co., Ltd..

(9) spontaneous activity in mice case, purchased from Huaibei Zhenghua Biological Instrument Co., Ltd..

(10) microplate reader, purchased from American Thermoscientific company.

(11) multiple labeling detector, purchased from American PerkinElmer company.

(1) pan paper, purchased from Chengdu Rong Hai Science and Technology Ltd..

(2) spoon, purchased from Chengdu Bao Xin biotechnology company limited.

(3) anticoagulant tube, purchased from Jiangsu Kangjian Medical Apparators Co., Ltd..

(4) 1.5mL centrifuge tube, purchased from American Axygen company.

(5) 15mL and 50mL centrifuge tube, purchased from American Corning company.

(6) suction nozzle (1mL, 200 μ L, 10 μ L), purchased from American Axygen company.

(7) 5mm nuclear magnetic tube, purchased from American Sigma-Aldrich company.

(8) 5L liquid nitrogen container, purchased from Cengdu Jinfeng Liquid Nitrogen Container Co. Ltd..

(9) disscting instrument, purchased from Chengdu Rong Hai Science and Technology Ltd..

(10) electronic analytical balance, purchased from German Sartorius company.

(11) pipettor, purchased from German Eppendorff company.

(12) refrigerator (4 DEG C ,-20 DEG C), purchased from Japanese Sanyo company.

(13) Ultralow Temperature Freezer (-80 DEG C), purchased from Japanese Sanyo company.

(14) pure water instrument, purchased from German Merckmillipore company.

(15) whizzer, purchased from American Thermoscientific company.

(16) ice-making machine, purchased from American Scotsman company.

(17) Nitrogen evaporator, purchased from Chengdu Yun Hong development in science and technology company limited.

(18) Biohazard Safety Equipment, purchased from Sujing Group Co., Ltd., Jiangsu Prov.

(19) Ultrasonic Cell Disruptor, purchased from Ningbo Xin Zhike device institute.

(20) high speed low temperature centrifugal machine, purchased from German Eppendorff company.

(21) nucleic acid electrophoresis appts, purchased from American Bio-Rad company.

(22) PCR amplification instrument, purchased from American MultigeneGradient company.

(23) Real-TimePCR instrument, purchased from American Bio-Rad company.

(24) fully automatic blood Biochemical Analyzer, purchased from Roche company of Switzerland.

(25) decolorization swinging table, purchased from Chengdu Jian Xin laboratory apparatus company limited.

(26) vortex oscillator, purchased from German IKA company.

(27) constant-temperature incubation case, purchased from Guangzhou Viscotek Corporation.

2.2 laboratory animal

Male SPF level health maturation (10-12 week) C57BL/6J mouse, purchased from Beijing Vital River Experimental Animals Technology Co., Ltd., body weight 20-22g, non-mating.Rearing conditions: new drug safety evaluation center, national Chengdu SPF level Animal House, temperature 20-25 DEG C, relative humidity 55-65%, in whole experimentation, animal freely ingests and drinks water.Feeding environment meets GB GB14925-2001, laboratory animal license licensed licenser licence: SCXK (river) 2003-01.

2.3 Naoliqing capsule operations

Naoliqing capsule-pipe laying operation: by mouse fixing head after vetanarcol (50mg/kg, i.p.) anesthesia, and expose skull.According to nucleus accumbens septi brain district coordinate ^[32](AP+1.6; ML ± 1.0; DV – 4.5) implant sleeve pipe to bilateral nucleus accumbens septi brain district, and fix with dental cement.Sew up a wound after dental cement is dry, tighten casing drive head.Animal is placed on electric blanket and recovers 7 days, and it is anti-infective to give penicillin intramuscular injection every day.

Naoliqing capsule-slow virus injection operation: by mouse fixing head after vetanarcol (50mg/kg, i.p.) anesthesia, and expose skull.According to nucleus accumbens septi brain district coordinate (AP+1.6; ML ± 1.0; DV – 4.5), the micro-injection pin that will be loaded with virus (0.25 μ L/ side) is in advance implanted behind bilateral nucleus accumbens septi brain district, with the speed of 0.1 μ L/min by virus injection to nucleus accumbens septi brain district.After injection, the 5min withdraw of the needle again that let the acupuncture needle remain at a certain point.Sew up a wound, animal is placed on electric blanket and recovers 7 days.

Preparation of reagents and administering mode is used in 2.4 brains

Hymeglusin: white powder, water insoluble, be dissolved in DMSO, solubleness is 1mg/mL.The preparation of solvent control: press corresponding proportion dilution DMSO with physiological saline.Owing to also there not being investigator that Hymeglusin is applied to animal experiment, dosage is 1 μ g/mL, in cocaine administration first 30 minutes, and with 0.1 μ L/min to intracerebral injection Hymglusin or solvent control, administration volume is 1 μ L/ side.

2.5 build shRNA-HMGCS2 slow virus ()

ShRNA-HMGCS2 slow virus is built according to the method for embodiment 1.The foundation of 2.6 Cocaine Conditioned place preference patterns

In experimentation on animals, all operations all meets AAALAC requirement, and mouse Conditioned place preference (CPP) method for establishing model is as follows, mouse position preference case as shown in Figure 1:

Start to test front 3-5 days, every day is stroked mouse by same operator, allows animal have certain adaptation to operator.

Mouse is put into CPP casing, CPP box partition porthole is opened, allow animal free shuttling in casing, acclimatization training three days, within the 4th day, measure animal in the time that black box and white box stop and the data of number of times as initial testing (Pretest) of shuttling back and forth.Each adaptation training and test duration are 15 minutes.During initial testing, when the time difference (Pretestscore) that animal stops in side (black and white both sides) more than 200s or the number of times that shuttles back and forth lower than 20 times time, should reject.

Using the side longer the animal residence time as natural preference case, then carry out intraperitoneal injection, dosage following (table 1).

Successive administration 6 days.Nature preference case is put into when cocaine hydrochloride group gives physiological saline; When giving cocaine hydrochloride, put into non-natural preference case, each training 15 minutes.Control group gives physiological saline at every turn and puts into corresponding casing (Fig. 2).

CPP box partition porthole was opened in 11st day, allow animal free shuttling, and measure animal at the time that black box and white box stop and the number of times that shuttles back and forth.During this test, the time difference stopped in the time stop animal in initial preference case and initial non-preference case is recorded as Prestscore.Test end dissected animal in 30 minutes.

The CPP scoring of animal is the difference of Testscore and Pretestscore.

Table 1 cocaine administration approach, dosage, administration volume summary sheet

2.7 mouse locomotor sensitivity models

In experimentation on animals, all operations all meets AAALAC (International Laboratory Animal assessment and accreditation the council) requirement, and the foundation of spontaneous activity in mice locomotor sensitivity model is as follows, spontaneous activity in mice case as shown in Figure 3:

Mouse is put into spontaneous activity casing, make animal freely movable in casing, acclimatization training, after three days, measures animal distance movable in casing for continuous three days, as baseline (Baseline) data.Each adaptation training and test duration are 15 minutes.In the process of three establishment of base lines, when baseline data (Baseline1/2/3) and mean level (ML) exist significant difference, corresponding animal should be rejected.

After starting dosage period, record the operating range casing in of animal after intraperitoneal injection every day, successive administration 7 days.Dosage is with CPP model (table 1).

Administration in 7th day terminates to dissect in latter 30 minutes.

2.8 protein extraction

50mMTris (pH7.4) is comprised in RIPA lysate, 150mMNaCl, 1%NP-40,0.5%sodiumdeoxycholate, 0.1%SDS, and sodiumorthovanadate, sodiumfluoride, the various inhibitors such as EDTA, leupeptin, can effectively arrestin degraded.Concrete operation step is as follows:

(1) use in forward direction RIPA lysate and add PMSF, make PMSF final concentration be 1mM.

(2) add the lysate containing PMSF to tissue, ultrasonic disruption cell is to abundant without after obvious tissue particles 4 DEG C, and the centrifugal 10min of 13000g, collects supernatant liquor.

(3) use BCA determination of protein concentration test kit, protein concentration in supernatant liquor is carried out quantitatively, adds the lysate containing PMSF and 5 × SDS sample-loading buffer, be adjusted to unified concentration.100 DEG C of heating in water bath make protein denaturation 5min, can carry out the operations such as follow-up protein immunoblot (Westernblot), or in-20 DEG C of preservations, use in one week.

2.9 protein immunoblottings (westernblot)

(1) SDS-PAGE gel is prepared: the gum concentration that upper strata concentrates glue is 5%, and the gum concentration of lower floor's separation gel is 10%.

(2) electrophoresis: every porin applied sample amount is 30-50 μ g, after 60V electrophoresis about 30min enters separation gel to sample, 80V electrophoresis about 80min, sample separation.

(3) transferring film: before electrophoresis closes to an end, the pvdf membrane be of moderate size is placed in methyl alcohol soak 10s activation after, be placed in transferring film damping fluid for subsequent use together with the filter paper of 6 equal sizes.After electrophoresis terminates, gel, filter paper and pvdf membrane are made transferring film " sandwich " structure according to the order of-3, (black flour) sponge filter paper-gel-pvdf membrane-3 filter paper-sponge (red face), get rid of the bubble of each interlayer, and be placed in transferring film folder, with 300mA constant current transferring film 60min.

(4) close: after transferring film terminates, pvdf membrane is performed mark and proceed to room temperature in Block buffer and close 1.5h.

(5) antibody incubation and wash film: wrap by pvdf membrane after primary antibodie being diluted to suitable concn with antibodies buffer, 4 DEG C of overnight incubation; Hatching 1h next day 37 DEG C makes primary antibodie rise again; Room temperature TBST (8min/ time, totally 4 times) washes away the primary antibodie of film excess surface; With antibodies buffer by two anti-be diluted to suitable concn after wrap by pvdf membrane, incubated at room 1h; TBST (8min/ time, totally 4 times) washes away two of film excess surface and resists; 1 × TBS (8min/ time, totally 2 times) washes away the tween in the TBST of film surface.

(6) expose: pvdf membrane evenly drips developing solution, expose in darkroom.

2.10 data analysis

SPSS19.0 software is adopted to carry out statistical analysis.One-way ANOVA (ANOVA), for weighing the significant difference of the test of Conditioned place preference and the test of spontaneous activity locomotor sensitivity.Student t checks the significant difference for weighing RT-PCR and protein immunoblotting test.P<0.05 representative test group difference has statistical significance.

3 experimental results

The expression of 3.1 nucleus accumbens septi HMGCS2 and activity

According to early stage metabolism group, form of energy and Metabolic Gene Expression result of study, in cocaine habituation mouse nucleus accumbens septi, raw bupropion metabolite path is comparatively active.Carry out detection display to the protein expression situation of the raw ketone key enzyme-HMGCS2 in Cocaine Conditioned place preference mouse nucleus accumbens septi, the HMGCS2 of cocaine habituation mouse nucleus accumbens septi expresses and significantly raises (Fig. 4 A).

Single injection Cocaine is after 30 minutes, 24 hours, and cocaine injection is after 7 days continuously, and HMGCS2 expresses increases (Fig. 4 B).The HMGCS2 enzymic activity of cocaine habituation mouse nucleus accumbens septi raises (Fig. 4 C).

These results illustrate that the expression of HMGCS2 and activity raise in cocaine habituation process.

3.2 suppress nucleus accumbens septi HMGCS2 enzymic activity on the impact of Cocaine locomotor sensitivity

HMGCS2 micromolecular inhibitor Hymeglusin is adopted to carry out pharmacological the Study of Interference.Hymeglusin forms thioesters adducts to the active cysteine residues of HMGCS2 carrying out covalent modification thus realizes restraining effect.Cocaine administration front 30 points of clockwise nucleus accumbens septi brain districts injection Hymglusin, then carry out follow-up locomotor sensitivity test.Experiment process is shown in Fig. 5 A.

Spontaneous activity in mice locomotor sensitivity test-results shows, the operating range giving the cocaine habituation mouse of Hymeglusin in nucleus accumbens septi significantly shortens (Fig. 5 B).Hymeglusin does not impact the spontaneous activity of saline control group mouse.HMGCS2 Enzyme assay shows, and Hymeglusin reduces the enzymic activity (Fig. 5 C) of cocaine habituation mouse and saline control group HMGCS2.The above results illustrates the enzymic activity suppressing HMGCS2, effectively weakens the mouse locomotor sensitivity of Cocaine induction.

3.3 suppress nucleus accumbens septi HMGCS2 enzymic activity on the impact of Cocaine Conditioned place preference

Cocaine administration first 30 minutes intracerebral injection Hymglusin, then carry out follow-up Conditioned place preference training.Administering mode is shown in Fig. 6 A.

Mouse Conditioned place preference result (Fig. 6 B) shows, Hymeglusin does not impact the position preference of saline control group mouse, but reduces the Conditioned place preference of cocaine habituation mouse.MRNA (Fig. 6 C) and the protein level (Fig. 6 D) of nucleus accumbens septi HMGCS2 do not change after giving Hymeglusin, illustrate that Hymeglusin does not affect the transcript and expression of HMGCS2.The above results shows the activity disturbing HMGCS2, effectively weakens the mouse Conditioned place preference behavior of Cocaine induction.

3.4 suppress nucleus accumbens septi HMGCS2 enzymic activity on the impact of Cocaine entice energy disorder

After Hymeglusin pre-treatment Cocaine Conditioned place preference mouse nucleus accumbens septi in ATP content comparatively solvent control treatment group significantly raise, illustrate energy expenditure reduce (Fig. 7 A).The acetyl-CoA (Fig. 7 B) raised, the enzymic activity (Fig. 7 C) of Oxalacetic transacetase lowered and the NAD+/NADH (Fig. 7 D) of increase illustrate that Hymeglusin weakens the tricarboxylic acid cycle in cocaine habituation mouse nucleus accumbens septi jointly.These results show, micromolecular inhibitor Hymeglusin disturbs the enzymic activity of raw ketone key enzyme HMGCS2, and the brain energy metabolism effectively improving Cocaine induction is abnormal.

The reticent Hmgcs2 of 3.5 nucleus accumbens septis is on the impact of Cocaine locomotor sensitivity

In order to confirm the effect in Addictive Behaviors that HMGCS2 induces at Cocaine, carry out the Study of Interference by the Hmgcs2 gene of the reticent nucleus accumbens septi of slow virus.Mouse Whole Brain after injecting lentivirus is cut into slices, is observed the slow virus region of mark green fluorescent protein by immunofluorescence, confirm that viral accurate injection is to nucleus accumbens septi brain district (Fig. 8 A).

After the slow virus of the reticent Hmgcs2 gene of nucleus accumbens septi locating injection or contrast slow virus one week, carry out the test of spontaneous activity in mice locomotor sensitivity.As shown in Figure 8 B, the operating range accepting the cocaine habituation mouse of reticent Hmgcs2 slow virus injection significantly shortens.Give contrast slow virus in brain not impact the spontaneous activity of saline control group mouse.The mRNA and the protein level detection that detect the rear nucleus accumbens septi HMGCS2 of slow virus injection show, the mRNA gene transcription level of HMGCS2 reduces (Fig. 8 C), and the protein expression of HMGCS2 reduces (Fig. 8 D).Fig. 8 C and 8D proves, slow virus interference effectively can lower the expression with HMGCS2 protein level of transcribing of Hmgcs2 gene.The above results illustrates reticent Hmgcs2 gene in nucleus accumbens septi, and the expression of lowering HMGCS2 effectively can weaken the locomotor sensitivity of Cocaine induction.

The reticent Hmgcs2 of 3.6 nucleus accumbens septis is on the impact of Cocaine Conditioned place preference

After nucleus accumbens septi slow virus injection operation one week, carry out display after the training of Cocaine Conditioned place preference, the position preference giving the saline control group mouse contrasting slow virus did not change; After giving reticent Hmgcs2 gene slow virus, the Conditioned place preference of cocaine habituation mouse declines (Fig. 9 A).After giving reticent Hmgcs2 gene slow virus, nucleus accumbens septi HMGCS2 enzymic activity reduces (Fig. 9 B).This shows that the reticent Hmgcs2 gene of nucleus accumbens septi can disturb the expression of HMGCS2, suppresses the enzymic activity of HMGCS2 simultaneously, effectively weakens the Conditioned place preference behavior of Cocaine induction.

The reticent Hmgcs2 of 3.7 nucleus accumbens septis is on the impact of Cocaine entice energy disorder

As shown in Figure 10 A, slow virus carry out after injecting reticent Hmgcs2 gene Cocaine Conditioned place preference training mouse nucleus accumbens septi in ATP content comparatively solvent control treatment group raise, illustrates ATP consumption minimizing.Meanwhile, the content of acetyl-CoA raises (Figure 10 B), illustrates that the acetyl-CoA entering tricarboxylic acid cycle energy supply reduces.

The enzymic activity of the key enzyme-Oxalacetic transacetase of tricarboxylic acid cycle also declines about 50% (Figure 10 C), illustrates that reticent Hmgcs2 lowers the tricarboxylic acid cycle activation degree in cocaine habituation mouse nucleus accumbens septi.Meanwhile, the NAD of tricarboxylic acid cycle efficiency is indicated ⁺/ NADH raises (Figure 10 D), illustrates that tricarboxylic acid cycle path eases up.The change of these form of energy illustrates in the Conditioned place preference mouse brain of Cocaine induction, expression and the activity of nucleus accumbens septi raw ketone key enzyme HMGCS2 is disturbed by the reticent Hmgcs2 of slow virus, tricarboxylic acid cycle can be slowed down, reduce energy expenditure, the brain energy metabolism improving cocaine habituation stress.

4 conclusions

Experimental result finds, by suppressing the activity of HMGCS2 or the expression with the reticent Hmgcs2 gene of shRNA, significantly can alleviate locomotor sensitivity and the Conditioned place preference of cocaine habituation, treatment cocaine habituation.

To sum up, shRNA primer shown in SEQIDNO.1 and SEQIDNO.2 of the present invention, the recombinant plasmid comprising aforementioned shRNA primer and the recombinant slow virus comprising this recombinant plasmid can as HMGCS2 inhibitor, the expression of effective reticent HMGCS2, and then effectively weaken Cocaine award behavior, alleviate locomotor sensitivity and Conditioned place preference, treatment cocaine habituation, potential applicability in clinical practice is good.

Claims

Nucleotide sequence shown in 1.SEQIDNO.1.
Nucleotide sequence shown in 2.SEQIDNO.2.
3. a recombinant plasmid, is characterized in that: it comprises the nucleotide sequence shown in SEQIDNO.1 and SEQIDNO.2.
4. recombinant plasmid according to claim 3, is characterized in that: described recombinant plasmid is restructuring PLLU2G plasmid.
5. according to claim 4 at recombinant plasmid, it is characterized in that: the nucleotide sequence of described recombinant plasmid is as shown in SEQIDNO.3.
6. a recombinant slow virus, is characterized in that: it comprises the recombinant plasmid described in claim 3 ~ 5 any one.
7. the nucleotide sequence described in claim 1 ~ 6 any one, recombinant plasmid or the recombinant slow virus purposes in preparation HMGCS2 inhibitor.
8. the nucleotide sequence described in claim 1 ~ 6 any one, recombinant plasmid or the recombinant slow virus purposes in the medicine of preparation treatment cocaine habituation.
9. treat a medicine for cocaine habituation, it is characterized in that: it be with nucleotide sequence, recombinant plasmid or the recombinant slow virus described in claim 1 ~ 6 any one for activeconstituents, add the preparation that pharmaceutically acceptable auxiliary material is prepared from.
10. medicine according to claim 9, is characterized in that: described preparation is injection formulations.