CN105087609B - A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation - Google Patents

A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation Download PDF

Info

Publication number
CN105087609B
CN105087609B CN201510510973.4A CN201510510973A CN105087609B CN 105087609 B CN105087609 B CN 105087609B CN 201510510973 A CN201510510973 A CN 201510510973A CN 105087609 B CN105087609 B CN 105087609B
Authority
CN
China
Prior art keywords
cocaine
hmgcs2
purchased
slow virus
nucleus accumbens
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510510973.4A
Other languages
Chinese (zh)
Other versions
CN105087609A (en
Inventor
岑小波
邵雪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan University
Original Assignee
Sichuan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan University filed Critical Sichuan University
Priority to CN201510510973.4A priority Critical patent/CN105087609B/en
Publication of CN105087609A publication Critical patent/CN105087609A/en
Application granted granted Critical
Publication of CN105087609B publication Critical patent/CN105087609B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses nucleotide sequences shown in SEQ ID NO.1 and 2, and the invention also discloses the recombinant plasmids comprising foregoing nucleotide sequence, and the recombinant slow virus comprising the recombinant plasmid.ShRNA primers, the recombinant plasmid comprising aforementioned shRNA primers shown in SEQ ID NO.1 and SEQ ID NO.2 of the present invention and include the recombinant slow virus of the recombinant plasmid, it can be with silence HMGCS2 genes, lower the expression of HMGCS2, effectively weaken cocaine and awards behavior, mitigate locomotor sensitivity and Conditioned place preference, cocaine habituation is treated, potential applicability in clinical practice is good.

Description

A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation
Technical field
A kind of purposes the present invention relates to recombinant slow virus and its in the drug for preparing treatment cocaine habituation.
Background technology
Cocaine (Cocaine) is also known as cocaine, the entitled benzoyl-methyl-ecgonine (methyl of chemistry Benzoylecgonine), general white lenticular, it is odorless, bitter and it is numb, be used for local anaesthesia earliest and treat asthma, It is strongest natural central stimulant, causes to abuse because of the excitation of its Central nervous system, as generation from 1985 One of main drugs of criticality.
Cocaine habituation is a kind of chronic recurrent brain diseases, belongs to pharmacological dependence (drug dependence) class disease Disease, cocaine habituation can cause the Changes of Plasticity of brain structure and function, related brain areas to include nucleus accumbens septi, corpus straitum, forehead Cortex, hippocampus and ventral tegmental area, health are also disorderly by various harm, including mental deterioration, personality defect, intelligence function Disorderly, concurrent corresponding infection complication and drug addict seek and are induced using drugs various delinquent work at all adventures It is dynamic.
The main feature of cocaine habituation is shown as even if patient after knowing the serious consequence of medication, still forces sex cords Take and use with meet desire, to drug seek and ask for it is out of hand, lose interest to things, Drug addiction it is very deep It carves, after the withdrawal and treatment several years, contacts stimulation related with habituation (such as poison friend, environment related with medication in the past Deng) all may induce relapse.
It is very big in view of cocaine habituation harm, suitable therapy target and drug are found, treatment cocaine habituation is compeled in eyebrow Eyelash.
Invention content
To solve the above-mentioned problems, the present invention provides the drugs of a kind for the treatment of cocaine habituation.
HMGCS2:3 hydroxyl, 3 first glutaryl coenzyme A synzyme 2.
HMGCS2 inhibitor:Inhibit the activity of 3 hydroxyl, 3 first glutaryl coenzyme A synzyme or the substance of expression.
First, the present invention provides a kind of nucleotide sequence, nucleotide sequence is following (shown in SEQ ID NO.1.
The present invention also provides a kind of nucleotide sequences, and nucleotide sequence is as shown in SEQ ID NO.2.
The present invention also provides a kind of recombinant plasmids, it includes nucleotides sequence described in SEQ ID NO.1 and SEQ ID NO.2 The recombinant plasmid of row.
Preferably, the recombinant plasmid is recombination PLLU2G plasmids.It is further preferred that the nucleotide of the recombinant plasmid Sequence is as shown in SEQ ID NO.3.
The present invention also provides a kind of recombinant slow virus, it includes the recombinant plasmid of aforementioned any one.
The present invention also provides nucleotide sequence above-mentioned, recombinant plasmid or recombinant slow virus to prepare HMGCS2 inhibitor In purposes.
The present invention also provides nucleotide sequence above-mentioned, recombinant plasmid or recombinant slow virus to prepare cocaine habituation Purposes in drug.
The present invention also provides a kind of drugs for treating cocaine habituation, it is with nucleotide sequence above-mentioned, recombination matter Grain or recombinant slow virus are active constituent, in addition the preparation that pharmaceutically acceptable auxiliary material is prepared.
Preferably, the preparation is ejection preparation.
ShRNA primers shown in SEQ ID NO.1 and SEQ ID NO.2 of the present invention, the recombination matter for including aforementioned shRNA primers Grain and the recombinant slow virus comprising the recombinant plasmid, can lower the expression of HMGCS2 with silence HMGCS2 genes, effectively weaken Cocaine awards behavior, mitigates locomotor sensitivity and Conditioned place preference, treats cocaine habituation, and potential applicability in clinical practice is good It is good.
The specific implementation mode of form by the following examples makees further specifically the above of the present invention It is bright.But the range that this should not be interpreted as to the above-mentioned theme of the present invention is only limitted to embodiment below.It is all to be wanted based on right of the present invention The technology that the content that secretary carries is realized is asked to all belong to the scope of the present invention.
Description of the drawings
Fig. 1 mouse Conditioned place preference casees
Fig. 2 Conditioned place preference experimental design schematic diagrames.Group Ⅰ:Physiological saline group;Group Ⅱ:Cocaine group. S:Intraperitoneal injection of saline;C:Cocaine is injected intraperitoneally.
Fig. 3 spontaneous activity in mice casees
Fig. 4 cocaines handle expression and the activity of inducing mouse nucleus accumbens septi HMGCS2.(A) cocaine Conditioned place preference The expression of mouse nucleus accumbens septi HMGCS2.(B) 30min (Single-30min) and for 24 hours after cocaine single-dose (Single-24h), the expression of successive administration 7 days (Repeated-7days) nucleus accumbens septi HMGCS2 afterwards.(C) cocaine item The enzymatic activity of part position preference mouse nucleus accumbens septi HMGCS2.Saline, SA:Intraperitoneal injection of saline group;Cocaine, CO: Cocaine group is injected intraperitoneally.N=6/ groups.*p<0.05, after cocaine Conditioned place preference habituation, single-dose 30min and For 24 hours, successive administration 7 days, each group relatively have significant difference with physiological saline group.
The influence for the locomotor sensitivity that Fig. 5 nucleus accumbens septis injection HMGCS2 micromolecular inhibitors induce cocaine.(A) nucleus accumbens septi It injects Hymeglusin and interferes cocaine spontaneous activity locomotor sensitivity model foundation ideograph.(B) nucleus accumbens septi is injected The influence for the spontaneous activity that Hymeglusin induces cocaine, n=15/ groups.(C) Hymeglusin pretreatments are to cocaine row For the influence of the enzymatic activity of sensitized mice nucleus accumbens septi HMGCS2, n=6/ groups.Saline-Saline:Nucleus accumbens septi injects physiology salt Water-intraperitoneal injection of saline group;Hymeglusin-Saline:Nucleus accumbens septi injects Hymeglusin- intraperitoneal injection of saline Group;Saline-Cocaine:Nucleus accumbens septi injecting normal saline-intraperitoneal injection cocaine group;Hymeglusin-Cocaine:Volt every Core injects Hymeglusin- and cocaine group is injected intraperitoneally.*p<0.05, Hymeglusin-Saline group, Saline-Cocaine Group, volt Hymeglusin-Cocaine groups have significant difference compared with Saline-Saline groups respectively.#p<0.05, Hymeglusin-Cocaine groups have significant difference compared with Saline-Cocaine groups.
Fig. 6 nucleus accumbens septis inject influence of the HMGCS2 micromolecular inhibitors to cocaine Conditioned place preference.(A) nucleus accumbens septi It injects Hymeglusin and interferes cocaine Conditioned place preference pattern establishment model figure.(B) nucleus accumbens septi injects Hymeglusin Influence to cocaine Conditioned place preference, n=15/ groups.(C) Hymeglusin pretreatments are inclined to cocaine Conditioned place The influence of the mRNA transcriptions of good mouse nucleus accumbens septi HMGCS2, n=15/ groups.(D) Hymeglusin pretreatments are to cocaine conditionity The influence of the protein expression of position preference mouse nucleus accumbens septi HMGCS2, n=15/ groups.Saline-Saline:Nucleus accumbens septi injection life Manage brine-intraperitoneal injection of saline group;Hymeglusin-Saline:Nucleus accumbens septi injects Hymeglusin- and physiology is injected intraperitoneally Brine group;Saline-Cocaine:Nucleus accumbens septi injecting normal saline-intraperitoneal injection cocaine group;Hymeglusin-Cocaine: Nucleus accumbens septi injects Hymeglusin- and cocaine group is injected intraperitoneally.*p<0.05, Hymeglusin-Saline group, Saline- Cocaine groups, Hymeglusin-Cocaine groups have significant difference compared with Saline-Saline groups respectively.#p<0.05, Hymeglusin-Cocaine groups have significant difference compared with Saline-Cocaine groups.
Influence of Fig. 7 HMGCS2 micromolecular inhibitors to cocaine Conditioned place preference mouse nucleus accumbens septi form of energy. (A) Hymeglusin interferes the changes of contents of nucleus accumbens septi ATP under cocaine Conditioned place preference pattern.(B)Hymeglusin Interfere the changes of contents of nucleus accumbens septi acetyl coenzyme A (Acetyl-CoA) under cocaine Conditioned place preference pattern.(C) Hymeglusin interferes the active variation of nucleus accumbens septi citrate synthase under cocaine Conditioned place preference pattern.(D) Hymeglusin interferes the variation of nucleus accumbens septi NAD+/NADH ratios under cocaine Conditioned place preference pattern.Saline- Saline:Nucleus accumbens septi injecting normal saline-intraperitoneal injection of saline group;Hymeglusin-Saline:Nucleus accumbens septi is injected Hymeglusin- intraperitoneal injection of saline groups;Saline-Cocaine:Nucleus accumbens septi injecting normal saline-intraperitoneal injection can block Because of group;Hymeglusin-Cocaine:Nucleus accumbens septi injects Hymeglusin- and cocaine group is injected intraperitoneally.N=6/ groups.*p< 0.05, Hymeglusin-Saline group, Saline-Cocaine groups, Hymeglusin-Cocaine groups respectively with Saline- Saline groups, which compare, significant difference.#p<0.05, Hymeglusin-Cocaine group has compared with Saline-Cocaine groups Significant difference.
Influences of Fig. 8 silence nucleus accumbens septi Hmgcs2 to cocaine locomotor sensitivity.(A) slow virus shHmgcs2 is noted in nucleus accumbens septi Penetrate schematic diagram.(B) influence for the spontaneous activity that nucleus accumbens septi injection shHmgcs2 slow virus induces cocaine, n=15/ groups.(C) Under cocaine locomotor sensitivity model, nucleus accumbens septi injects influence of the shHmgcs2 slow virus to HMGCS2mRNA transcriptional levels, n=6/ Group.(D) under cocaine locomotor sensitivity model, nucleus accumbens septi injects shadow of the shHmgcs2 slow virus to HMGCS2 protein expression levels It rings, n=6/ groups.*p<0.05, shHmgcs2-Saline group, shControl-Cocaine groups, shHmgcs2-Cocaine components There is not significant difference compared with shControl-Saline groups.#p<0.05, shHmgcs2-Cocaine group and shControl- Cocaine groups, which compare, significant difference.
The influence of Fig. 9 silence nucleus accumbens septi Hmgcs2 gene pairs cocaine Conditioned place preferences.(A) nucleus accumbens septi is injected The influence for the Conditioned place preference that shHmgcs2 slow virus induces cocaine, n=15/ groups.(B) cocaine locomotor sensitivity mould Under type, nucleus accumbens septi injects influence of the shHmgcs2 slow virus to HMGCS2 enzymatic activitys, n=6/ groups.*p<0.05, shHmgcs2- Saline groups, shControl-Cocaine groups, shHmgcs2-Cocaine groups have compared with shControl-Saline groups respectively Significant difference.#p<0.05, shHmgcs2-Cocaine group has significant difference compared with shControl-Cocaine groups.
The shadow of Figure 10 silence nucleus accumbens septi Hmgcs2 gene pairs cocaine Conditioned place preference mouse nucleus accumbens septi form of energy It rings.(A) nucleus accumbens septi injection shHmgcs2 slow virus interference cocaine Conditioned place preference pattern under nucleus accumbens septi ATP contain quantitative change Change.(B) nucleus accumbens septi acetyl coenzyme A under nucleus accumbens septi injection shHmgcs2 slow virus interference cocaine Conditioned place preference pattern (Acetyl-CoA) changes of contents.(C) nucleus accumbens septi injection shHmgcs2 slow virus interferes cocaine Conditioned place preference mould The active variation of nucleus accumbens septi citrate synthase under type.(D) nucleus accumbens septi injection shHmgcs2 slow virus interference cocaine conditionity position Set the variation of nucleus accumbens septi NAD+/NADH ratios under preference pattern.N=6/ groups.*p<0.05, shHmgcs2-Saline group, ShControl-Cocaine groups, shHmgcs2-Cocaine groups have statistics poor compared with shControl-Saline groups respectively It is different.#p<0.05, shHmgcs2-Cocaine group has significant difference compared with shControl-Cocaine groups.
Figure 11 swimming lanes 1:Blank control;Swimming lane 2:Positive control;3~swimming lane of swimming lane 9:PLLU2G-shHmgcs2 1.~8. Number clone;M:100bp DNA Ladder.
Figure 12 recombinant vector structural schematic diagrams.
Figure 13 PLLU2G-shHmgcs2-1 plasmid transfection 293T cell 48h lesion situations.
Figure 14 PLLU2G-shcontrol plasmid transfection 293T cell 48h lesion situations.
Specific implementation mode
The structure of 1 shRNA-Hmgcs2 slow virus of the present invention of embodiment (interference HMGCS2 expresses slow virus)
I, the preparation of recombinant vector
One, carrier information:
Plasmid designations:PLLU2G-shHmgcs2
Gene Name:Hmgcs2
Gene kind:Mus musculus
Mrna length:1527bp
Cloning vector:PLLU2G
Carrier resistance:Amp
Basic scheme:Annealing, digestion connection
Two, materials and methods
(1) material
1. instrument and equipment
1) PCR instrument, U.S. BIO-RAD, model PTC-220/ALS-1296G/ALD1244G;
2) electrophoresis apparatus, Beijing Liuyi Instrument Factory, model DYY-12;
3) Horizontal electrophoresis tank, Beijing Liuyi Instrument Factory, model DYCP-31DN;
4) UV transilluminator, U.S. UVP, model M-26;
5) compact centrifuge, U.S. Eppendorf, model 5418;
6) micro-wave oven, middle Guomei, model MW721AAU-PW;
7) air-heating type Constant Temp. Oven, Guangzhou east electrothermal drying instrument factory, model east-B;
8) thermostat water bath, HENGAO, model HWT-6B;
9) full warm air shaking table, Shanghai Fuma Experiment Equipment Co., Ltd., model QYC-200;
2. reagent
1) QIAquick Gel Extraction Kit, QIAGEN, article No. 28704;
2) the small extraction reagent kit of plasmid, TIANGEN, article No. DP103-02;
3) dNTP Mix, Fermentas, article No. #R0192;
4)GeneRulerTM100bp DNA Ladder, Fermentas, article No. #SM0241;
5) Hpa I, TAKARA, article No. D1064A;
6) Xho I, TAKARA, article No. D1094A;
7) T4DNA Ligase, TAKARA, article No. D2011A;
8) 5 × Annealing Buffer for DNA Oligos, Beyotime, article No. D0251;
9) Taq DNA Polymerase, Fermentas, article No. EP0404;
(2) method
1. it is as follows to design and synthesize 1 pair of shRNA oligo, oligo sequence according to target gene Hmgcs2:
Oligo titles 5 ' to 3 ' of oligo sequences
shHmgcs2-F(SEQ ID NO.1) TCGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGTTTTTC
shHmgcs2-R(SEQ ID NO.2) TCGAGAAAAACGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGA
Negative-F TGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTTC
Negative-R TCGAGAAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGCA
2. vector construction
The annealing of 2.1Oligo DNA
1) DNA oligo to be annealed are configured to 50 μM with the DEPC water handled, dissolving Annealing Buffer for DNA Oligos (5 ×), mixing is spare.
2) setting reaction system is as follows:
DEPC-water 40μl
Annealing Buffer for DNA Oligos(5×) 20μl
DNA oligo-F(50μM) 20μl
DNA oligo-R(50μM) 20μl
Total volume 100μl
Various reagents, mixing are sequentially added according to above-mentioned reaction system.
3) it is as follows to carry out annealing reaction for setting PCR instrument:
95℃ 2min
Decline 0.1 DEG C per 8s, is down to 25 DEG C About 90min
4℃ It preserves for a long time
4) -20 DEG C of refrigerators preserve.
2.2 digestion carrier PLLU2G
1) setting of digestion system is as follows:
2) 3 hours of 37 DEG C of digestions
3) 10 × loading buffer terminate reaction, and electrophoresis and gel extraction are carried out with 1% Ago-Gel.
The recycling of 2.3DNA agarose gel electrophoresis is returned with reference to the DNA agarose gel electrophoresis QIAquick Gel Extraction Kits of Tiangeng It receives, electrophoresis again after recycling, and surveys concentration.
2.4 connection PLLU2G and shRNA segments
1) linked system setting is as follows:
PLLU2G digestions recovery product (200~300ng) 3μl
The Oligo DNA (1/10dilute) of annealing 1μl
10×T4DNA ligase buffer 2.5μl
T4DNA ligase 1μl
H2O 17.5μl
Total system 25μl
2) 4 DEG C of connections are stayed overnight.
2.5 conversion stb13 bacteriums
1) 10 μ L ligation reactions are added in 100 μ L STBL3Chemically Competent E.coli, on ice It is incubated 30 minutes;
2) 42 DEG C of thermal shock cells 30 seconds;
3) it is immediately transferred to be incubated on ice 2 minutes;
4) 250 μ L S.O.C.medium are added, are incubated 1 hour in 37 DEG C, the shaking table of 225RPM.;
5) 100 μ L conversion products are coated onto on the LB tablets containing 100 μ g/mL Amp, 37 DEG C of overnight incubations.
2.6PCR screens positive recombinant.
1) PCR identifies primer:
F:AGGCTTAATGTGCGATAAAAGAC
R:GAGCTTATCGATACCGTCGAC
2) PCR reaction systems:
3) PCR amplification program:
2.7 picking positive colony plasmids.
2.8 deliver positive colony sequencing identification.
Forward primer PLLU2G-CX-F is sequenced:TGATAGGCTTGGATTTCT
Three, experimental result
1.PCR qualification results
PLLU2G-shHmgcs2PCR qualification figures are as shown in figure 11, which is 279bp, with positive control item Band is positive colony in the clone of same position.
TTTCCCCGAAAAGTGCCACC TGAC。
2. qualification result is sequenced
The structure chart collection of illustrative plates of recombinant vector PLLU2G-shHmgcs2 is as shown in figure 12, sequence such as SEQ ID NO.3 institutes Show.
PLLU2G-shcontrol complete sequences are as shown in SEQ ID NO.4.
II, virus packaging and titer determination
One, plasmid information
Purpose plasmid designations:PLLU2G-shHmgcs2,PLLU2G-shcontrol
Gene Name:shHmgcs2
Helper plasmid title:pLV/helper-SL3,pLV/helper-SL4,pLV/helper-SL5
Drug resistance:Nothing
Two, related equipment is tested
Three, related reagent material is tested
Transfection reagent:Lipofectamine 2000
Transfectional cell:293T
Culture solution:H-DMEM+10%FBS
Transfection cocktail:Serum-freeCulture solution
Other consumptive materials:10cm culture dishes, 5mL centrifuge tubes, 0.45 μm of filter, 0.25% pancreatin
Four, experimentation
1. virus packaging
1.1 take cell state good, the 293T cells of exponential phase are in, after cell count, according to each 10cm's Culture dish 5 × 106A cell number is inoculated in culture dish, 37 DEG C, overnight incubation in the incubator of 5%CO2;
The old culture solution of removal before transfection in 1.2 second days, be added 5mL it is fresh contain 10% serum DMEM culture solutions;It prepares 2000 compounds of DNA-Lipofectamine are demonstration with the dosage of a 10cm culture dish:
A. prepare a sterile 5mL centrifuge tube, 1.5mL serum-frees are first addedCulture solution adds PLV/helper-SL3, pLV/helper-SL4, pLV/helper-SL5, purpose plasmid (each 4ug) gently overturn mixing;
B. prepare in other one sterile 5mL centrifuge tube, 1.5mL serum-frees are addedCulture solution and 40 μ L Lipofectamine 2000, gently overturn mixing.Incubation at room temperature 5 minutes;
C.5 after minute, dilution DNA is added to the serum-free containing Lipofectamine 2000Training Nutrient solution gently overturns mixing.Incubation at room temperature 20 minutes;
1.3 are drop by drop added to 2000 compounds of DNA-Lipofectamine in 293T cells, lightly before After rock culture dish with mixing compound.Place 37 DEG C, 5%CO2It is incubated overnight in saturated humidity incubator;
1.4 transfections one day after, replace 10mL and contain 10% serum DMEM culture solutions.Place 37 DEG C, 5%CO2Saturated humidity is trained It supports and continues to cultivate in case;
Culture supernatant is collected within 48 hours after 1.5 transfections to be concentrated;The fresh culture solutions of 10mL are added to continue to cultivate, transfect Afterwards concentration is collected again within 72 hours;
A.3000rpm low-speed centrifugal 15min, supernatant is filtered with 0.45 μm of filter, thoroughly to remove cell fragment;
B. each UT centrifuge tubes fill 20mL filtrates, and 50000 × g high speed centrifugation 90min precipitate virus particles discard supernatant;
C. take the HBSS of 2mL that viral pellet is resuspended;
D. it takes UT centrifuge tubes to fill 20% sucrose solutions of 15mL, is then slowly added into 2mL viral suspensions in superjacent, 50000 × g high speed centrifugation 120min purified virus, discards supernatant;
E. it takes suitable culture solution that viral pellet is resuspended, dispenses into 0.5mL import AXYGEN pipes, often 100 μ l of pipe.
1.6 viruses dispensed place -80 DEG C of preservations.
2. titer determination
2.1 titres detect the previous day, with every hole 5x103A cell (volume is 100 μ l) is inoculated with 293T cells to 96 orifice plates In, each virus needs to use 10 holes, and parallel dilution is twice;
2.2 titres detect the previous day, with every hole 5x103A cell (volume is 100 μ l) is inoculated with 293T cells to 96 orifice plates In, each virus needs to use 20 holes, and parallel dilution is twice;
Before 2.3 infection, each virus need to prepare 10 sterile Ep pipes, and the fresh culture of 90 μ l is added in each pipe (DMEM+10%FBS, high sugar);It takes 11 μ l of virus stock solution used to be determined to be added in first pipe, after mixing, is managed from first In take 11 μ l to be added in second pipe.Continue an identical operation to the last pipe;Take virus stock solution used to be determined parallel again Dilution is primary.
2.4 choose needed for cell hole and being covered in culture plate mark, suck 90 μ l culture mediums.As diluted in each pipe 90 good μ l viral solutions, it is 9.9 μ l that virus is practical in first pipe, takes 10 μ l as, is denoted as 1E1, the second pipe is denoted as 1E- 0.... the 10th pipe is 1E-8;
2.537 DEG C, after 5%CO2 is cultivated 48 hours, 100 μ l of fresh culture is added and more renew after 24 hours 150 μ l of fresh culture medium;(careful operation avoids cell from being blown afloat)
After 2.696 hours, luciferase expression situation is observed.Fluorecyte number is resistance to few with the increase of extension rate.It counts most Fluorecyte number in 1 hole in the hole containing fluorecyte afterwards.To obtain numerical value respectively divided by corresponding extension rate just The titre value of virus stock solution used is obtained.(it is generally acknowledged that the reading in penultimate hole is more acurrate)
Such as:1E-5 gradients read 5 fluorecytes, then the virus titer of this virus stock solution used is:5/1E-5=5* 105TU/ μ l, i.e. 5*108TU/mL。
1E1 1E-0 1E-1 1E-2 1E-3 1E-4 1E-5 1E-6 1E-7 1E-8 Negative control Negative control
1E1 1E-0 1E-1 1E-2 1E-3 1E-4 1E-5 1E-6 1E-7 1E-8 Negative control Negative control
Five, experimental result
1. virus packaging result
(200 × visual field, 20mm are glimmering as shown in figure 13 for PLLU2G-shHmgcs2 plasmid transfection 293T cell 48h lesions situation Light exposure rate).
PLLU2G-shcontrol plasmid transfection 293T cell 48h lesions situation (200 × visual field, 20mm as shown in figure 14 Fluorescence exposure rate):
2. titer determination result
PLLU2G-shHmgcs2 titre results:
PLLU2G-shcontrol titre results:
Hereinafter beneficial effects of the present invention are verified with the mode of experimental example:
Experimental example 1HMGCS2 inhibitor for treating cocaine habituations
1 foreword
In this research, using pharmacology and genetic approach, the little molecules in inhibiting of locating injection key enzyme into mouse nucleus accumbens septi The slow virus of agent or silence key gene, in conjunction with1H-NMR metabonomic analysis confirms that HMGCS2 inhibitor can be treated effectively Cocaine habituation.
2 materials and methods
2.1 experiment material
2.1.1 experiment reagent
(1) cocainehydrochloride identifies institute purchased from Chinese pharmaceutical biological product.
(2) physiological saline is purchased from Kelun Pharm Ind Co., Ltd., Sichuan.
(3)Hymeglusin(1233A;F244;L-659-699), it is purchased from Sigma-Aldrich, structure FormulaChemical formula is C18H28O5, molecular weight 324.41.
(4) HMG-CoA synthase activities kit is purchased from Genmed Scientifics companies of the U.S..
(5) glucokinase kit is purchased from Protein One companies of Australia.
(6) RIPA lysates are purchased from the green skies Bioisystech Co., Ltd in Shanghai.
(7) BCA methods determination of protein concentration kit is purchased from Pierce companies of the U.S..
(8) 5 × SDS-PAGE electrophoretic buffers are purchased from the green skies Bioisystech Co., Ltd in Shanghai.
(9) SDS-PAGE reagents (30% polyacrylamide, Tris-base, SDS, ammonium persulfate, TEMED, glycine), 0.22 μM of aperture pvdf membrane is purchased from Bio-Rad companies of the U.S..
(10) pre- dsred protein marker is purchased from the U.S. Thermo Scientfic (Fermentas) company.
(11) chemiluminescence development kit is purchased from U.S. Pierce.
(12) Kodak Kodak films are purchased from Kodak.
(13) antibody:Rabbit anti-mouse HMGCS2 monoclonal antibodies (ab137043), rabbit anti-mouse GCK polyclonal antibodies (ab37796), Abcam companies are purchased from;Rabbit anti-mouse β-actin antibody (4697) is purchased from Cell Signaling Technology companies;The goat-anti rabbit secondary antibody (AS014) of horseradish peroxidase-labeled is purchased from Abclonal companies.
(14) silence Hmgcs2 slow virus and control slow virus, are built by the Guangzhou bio tech ltd Sai Ye.
(15) liquid nitrogen, purchased from Chengdu emigrant's source gas Co., Ltd.
(16) nitrogen, purchased from Chengdu emigrant's source gas Co., Ltd.
(17) hplc grade methanol is purchased from Fisher scientific companies of the U.S..
(18) chromatographic grade chloroform is purchased from Scharlau companies of Spain.
(19) deuterated heavy water is purchased from U.S. CIL (Cambridge Isotope Laboratories) company.
(20) TSP is purchased from Sigma-Aldrich.
(21) Trizol is purchased from Invitrogen life technologies companies of the U.S..
(22) absolute ethyl alcohol is purchased from Solution on Chemical Reagents in Shanghai Co., Ltd.
(23) without DNA enzymatic/RNA enzyme deionized water, it is purchased from Beijing Tiangeng biochemical technology Co., Ltd.
(24) Gold View dyestuffs, purchased from Shanghai match Bai Sheng gene technology Co., Ltd.
(25) agarose is purchased from Amerosco companies of the U.S..
(26) PrimeScript RT reagent kit (Reverse Transcriptase kit) are purchased from Bio-Rad companies of the U.S..
(27) SYBR Green Supermix kit are purchased from Bio-Rad companies of the U.S..
(28) acetyl coenzyme A detection kit is purchased from Sigma-Aldrich.
(29) ATP detection kits, NAD+/ NADH detection kits and citrate synthase activity detection kit, are purchased from Abcam companies of the U.S..
mAcat2-F CCCGTGGTCATCGTCTCAG
mAcat2-R GGACAGGGCACCATTGAAGG
mOxct1-F CATAAGGGGTGTGTCTGCTACT
mOxct1-R GCAAGGTTGCACCATTAGGAAT
mOxct2b-F GGGAGTGTCCATTTCTACACG
mOxct2b-R CCCAGGTAGGAGCACACCA
mAacs-F ATACCACTGGTCTGTCCGGTC
mAacs-R CGTGAGTAGACGATTCCACTGA
β-actin-F GAGACCTTCAACACCCCAGC
β-actin-R ATGTCACGCACGATTTCCC
(30) other reagents are domestic or Import Analysis is pure.
2.1.2 the preparation of main agents
(1) SDS-PAGE electrophoretic buffers:To 15.1g Tris-base, 94g glycine and 5g SDS, middle addition 800mL Distilled water is settled to 1000mL, room temperature preservation after stirring and dissolving.
(2) transferring film buffer solution:The bis- steamings of 600mL are added into 2.9g glycine, 5.8g Tris-base and 0.37g SDS Water is settled to 800mL after stirring and dissolving, is eventually adding 200mL methanol, room temperature preservation.
(3) 10 × TBS buffer solutions:To 60.5g Tris-base, 800mL distilled waters are added in 87.5g NaCl, stirring is molten It is 7.4 that concentrated hydrochloric acid is added dropwise after solution and adjusts pH, is finally settled to 1000mL, room temperature preservation.
(4) TBST buffer solutions:With 10 × TBS buffer 1000mL 1 × TBS buffer solutions, 1mL is then added Tween 20 is mixed well, room temperature preservation.
(5) Block buffer:100mL TBST buffer solutions are added into 5g skimmed milk powers, stirring and dissolving uses or 4 immediately DEG C preserve (matching while using).
(6) antibodies buffer:100mL TBST buffer solutions are added to 5g bovine serum albumin(BSA)s, stirring and dissolving uses immediately Or 4 DEG C of preservations (matching while using).
2.1.3 instrument is tested
(1) stereotaxic apparatus, casing, flat mouth microsyringe (1 μ L, 5 μ L) are purchased from Shenzhen Rui Wode companies.
(2) Ultrasonic Cell Disruptor is purchased from Ningbo Xin Zhike devices research institute.
(3) x-ray film automatic film developer:Purchased from German Protec GmbH companies.
(4) ice machine is purchased from Scotsman companies of the U.S..
(5) high speed low temperature centrifugal machine is purchased from Eppendorff companies of Germany.
(6) protein electrophorese slot and electrophoresis power are purchased from Bio-Rad companies of the U.S..
(7) gel imager is purchased from Bio-Rad companies of the U.S..
(8) mouse position preference case is purchased from Huaibei Zhenghua Biological Instrument Co., Ltd..
(9) spontaneous activity in mice case is purchased from Huaibei Zhenghua Biological Instrument Co., Ltd..
(10) microplate reader is purchased from Thermo scientific companies of the U.S..
(11) multiple labeling detector is purchased from Perkin Elmer companies of the U.S..
(1) pan paper is purchased from Chengdu Rong Hai Science and Technology Ltd.s.
(2) spoon is purchased from Chengdu Bao Xin bioengineering Co., Ltd.
(3) anticoagulant tube is purchased from Jiangsu Kangjian Medical Apparators Co., Ltd..
(4) 1.5mL centrifuge tubes are purchased from Axygen companies of the U.S..
(5) 15mL and 50mL centrifuge tubes are purchased from Corning companies of the U.S..
(6) suction nozzle (1mL, 200 μ L, 10 μ L) are purchased from Axygen companies of the U.S..
(7) 5mm nuclear magnetic tubes are purchased from Sigma-Aldrich.
(8) 5L liquid nitrogen containers are purchased from Cengdu Jinfeng Liquid Nitrogen Container Co. Ltd..
(9) disscting instrument is purchased from Chengdu Rong Hai Science and Technology Ltd.s.
(10) electronic analytical balance is purchased from Sartorius companies of Germany.
(11) pipettor is purchased from Eppendorff companies of Germany.
(12) refrigerator (4 DEG C, -20 DEG C) are purchased from Sanyo companies of Japan.
(13) ultra low temperature freezer (- 80 DEG C) are purchased from Sanyo companies of Japan.
(14) pure water meter is purchased from Merck millipore companies of Germany.
(15) centrifuge is purchased from Thermo scientific companies of the U.S..
(16) ice machine is purchased from Scotsman companies of the U.S..
(17) nitrogen evaporator is purchased from Chengdu Yun Hong developments in science and technology Co., Ltd.
(18) Biohazard Safety Equipment is purchased from Sujing Group Co., Ltd., Jiangsu Prov.
(19) Ultrasonic Cell Disruptor is purchased from Ningbo Xin Zhike devices research institute.
(20) high speed low temperature centrifugal machine is purchased from Eppendorff companies of Germany.
(21) nucleic acid electrophoresis apptss are purchased from Bio-Rad companies of the U.S..
(22) PCR amplification instrument is purchased from Multigene Gradient companies of the U.S..
(23) Real-Time PCR instruments are purchased from Bio-Rad companies of the U.S..
(24) fully automatic blood Biochemical Analyzer is purchased from Roche companies of Switzerland.
(25) decolorization swinging table is purchased from Chengdu Jian Xin laboratory apparatus Co., Ltd.
(26) vortex oscillator is purchased from IKA companies of Germany.
(27) constant-temperature incubation case is purchased from Guangzhou Viscotek Corporation.
2.2 experimental animal
Male SPF grades healthy sexal maturity (10-12 weeks) C57BL/6J mouse, purchased from Beijing dimension tonneau China experimental animal technology Co., Ltd, weight 20-22g, did not mated.Rearing conditions:Center SPF grades of animal house of national Chengdu new drug safety evaluatio, 20-25 DEG C of temperature, relative humidity 55-65%, in whole experiment process, animal freely ingests and drinks water.Feeding environment meets state Mark GB14925-2001, experimental animal licensing:SCXK (river) 2003-01.
2.3 Naoliqing capsules are performed the operation
Naoliqing capsule-pipe laying operation:Fixing head after mouse is anaesthetized with yellow Jackets (50mg/kg, i.p.), and Exposure skull.According to nucleus accumbens septi brain area coordinate[32](AP+1.6;ML±1.0;DV -4.5) it is covered to the implantation of bilateral nucleus accumbens septi brain area Pipe, is used in combination dental cement to fix.It sews up a wound after dental cement is dry, tightens sleeve cap.Animal is placed on electric blanket and restores 7 It, and it is anti-infective that penicillin intramuscular injection is given once daily.
Naoliqing capsule-slow virus injection operation:It is fixed after mouse is anaesthetized with yellow Jackets (50mg/kg, i.p.) Head, and exposure skull.According to nucleus accumbens septi brain area coordinate (AP+1.6;ML±1.0;DV -4.5), virus will be pre-loaded with (0.25 sides μ L/) micro-injection needle implantation bilateral nucleus accumbens septi brain area after, with the speed of 0.1 μ L/min by virus injection to lie prostrate every Core brain area.After injection, the 5min withdraws of the needle again that let the acupuncture needle remain at a certain point.It sews up a wound, animal is placed on electric blanket and is restored 7 days.
Naoliqing capsule-slow virus injection operation:It is fixed after mouse is anaesthetized with yellow Jackets (50mg/kg, i.p.) Head, and exposure skull.According to nucleus accumbens septi brain area coordinate (AP+1.6;ML±1.0;DV -4.5), virus will be pre-loaded with (0.25 sides μ L/) micro-injection needle implantation bilateral nucleus accumbens septi brain area after, with the speed of 0.1 μ L/min by virus injection to lie prostrate every Core brain area.After injection, the 5min withdraws of the needle again that let the acupuncture needle remain at a certain point.It sews up a wound, animal is placed on electric blanket and is restored 7 days.
2.4 intracerebrals use preparation of reagents and administering mode
Hymeglusin:White powder, it is not soluble in water, it is dissolved in DMSO, solubility is 1mg/mL.The preparation of solvent control: With physiological saline DMSO is diluted by corresponding proportion.Due to not there is also researcher that Hymeglusin is applied to animal experiment, administration Dosage is that 1 μ g/mL, with 0.1 μ L/min to intracerebral injection Hymglusin or solvent control, give 30 minutes before cocaine administration Medicine body product is 1 sides μ L/.
2.5 structure shRNA-HMGCS2 slow virus ()
ShRNA-HMGCS2 slow virus is built according to the method for embodiment 1.2.6 cocaine Conditioned place preference patterns It establishes
All operations meet AAALAC requirements, the model foundation side mouse Conditioned place preference (CPP) in zoopery Method is as follows, and mouse position preference case is as shown in Figure 1:
Start before testing 3-5 days, mouse is stroked by same operating personnel daily, animal is allowed to have one to operating personnel Fixed adaptation.
Mouse is put into CPP babinets, CPP box partitions passway is opened, allows animal free shuttling in babinet, is fitted Answering property is trained three days, measures within the 4th day animal in black box and white box residence time and shuttle number as initial testing (Pretest) data.Each adaptation training and testing time are 15 minutes.When initial testing, when animal is in side (black and white Both sides) residence time poor (Pretest score) when being less than 20 times more than 200s or shuttle number, should reject.
Using animal residence time longer side as nature preference case, intraperitoneal injection, dosage are then carried out (table 1) as follows.
Successive administration 6 days.Cocainehydrochloride group is put into nature preference case when giving physiological saline;Give cocainehydrochloride When, it is put into non-natural preference case, every time training 15 minutes.Control group gives physiological saline and is put into corresponding babinet (figure every time 2)。
CPP box partitions passway was opened in 11st day, allows animal free shuttling, and measure animal and stop in black box and white box The time stayed and shuttle number.When this test, by animal in initial preference case in residence time and initial non-preference case Residence time difference is recorded as Prest score.Test terminates to dissect animal in 30 minutes.
The CPP scorings of animal are the difference of Test score and Pretest score.
1 cocaine administration approach of table, dosage, administered volume summary sheet
2.7 mouse locomotor sensitivity models
All operations meet AAALAC (committee is assessed and approved to International Laboratory Animal) and require, mouse in zoopery The foundation of spontaneous activity locomotor sensitivity model is as follows, and spontaneous activity in mice case is as shown in Figure 3:
Start before testing 3-5 days, mouse is stroked by same operating personnel daily, animal is allowed to have one to operating personnel Fixed adaptation.
Mouse is put into spontaneous activity box body, allows animal freely activity in babinet, after acclimatization training three days, continuously Animal movable distance in babinet is measured within three days, as baseline (Baseline) data.Each adaptation training and testing time It is 15 minutes.During establishment of base line three times, there are conspicuousnesses with average level for base-line data (Baseline1/2/3) When difference, corresponding animal should be rejected.
After starting dosage period, operating range babinet in of the animal after intraperitoneal injection is recorded daily, continuously Administration 7 days.Dosage is the same as CPP models (table 1).
It is dissected in 30 minutes after administration in 7th day.
2.8 protein extraction
Include 50mM Tris (pH 7.4), 150mM NaCl, 1%NP-40,0.5%sodium in RIPA lysates Deoxycholate, 0.1%SDS and sodium orthovanadate, sodium fluoride, EDTA, leupeptin Equal various inhibitors, can effectively inhibit protein degradation.Concrete operation step is as follows:
(1) PMSF is added into RIPA lysates before, makes the final concentration of 1mM of PMSF.
(2) lysate containing PMSF is added to tissue, ultrasonic disruption cell is to abundant without after apparent tissue particles 4 DEG C, 13000g centrifuges 10min, collects supernatant.
(3) BCA determination of protein concentration kits are used, after albumen concentration quantifies in supernatant, addition contains The lysate and 5 × SDS sample-loading buffers of PMSF, is adjusted to unified concentration.100 DEG C of heating water baths make albuminous degeneration 5min, The operations such as subsequent protein immunoblot (Western blot) can be carried out, or in -20 DEG C of preservations, are used in one week.
2.9 protein immunoblottings (western blot)
(1) PAGE gel is prepared:The gum concentration that upper layer concentrates glue is 5%, and the gum concentration of lower layer's separation gel is 10%.
(2) electrophoresis:After entering separation gel to sample per porin applied sample amount for 30-50 μ g, 60V electrophoresis 30min or so, 80V electrophoresis 80min or so detaches sample.
(3) transferring film:Before electrophoresis closes to an end, the pvdf membrane being of moderate size is placed in methanol after impregnating 10s activation, with 6 The filter paper of same size is placed in spare in transferring film buffer solution together.After electrophoresis, by gel, filter paper and pvdf membrane according to Transferring film " sandwich " structure is made in the sequence of-3 filter paper-gels of (black flour) sponge-filter paper of pvdf membrane-3-sponge (red face), The bubble for excluding each interlayer is placed in transferring film folder, with 300mA constant current transferring films 60min.
(4) it closes:After transferring film, pvdf membrane is performed into label and is transferred to room temperature closing 1.5h in Block buffer.
(5) antibody incubation and film is washed:Primary antibody is diluted to after suitable concentration with antibodies buffer and is coated with pvdf membrane, 4 DEG C incubate It educates overnight;37 DEG C of next day, which is incubated 1h, makes primary antibody rise again;Room temperature washes away extra one of film surface with TBST (8min/ times, totally 4 times) It is anti-;Secondary antibody is diluted to after suitable concentration with antibodies buffer and is coated with pvdf membrane, is incubated at room temperature 1h;TBST (8min/ times, totally 4 It is secondary) wash away the extra secondary antibody of film surface;1 × TBS (8min/ times, totally 2 times) washes away the tween in film surface TBST.
(6) it exposes:Developer solution is dropped evenly on pvdf membrane, is exposed in darkroom.
2.10 data analysis
Statistical analysis is carried out using 19.0 softwares of SPSS.One-way ANOVA (ANOVA), for weighing conditionity position Set the significant difference of preference experiment and the experiment of spontaneous activity locomotor sensitivity.Student t is examined for weighing RT-PCR and protein The significant difference of western blot test.p<0.05, which represents experiment group difference, has statistical significance.
3 experimental results
The expression of 3.1 nucleus accumbens septi HMGCS2 and activity
According to the result of study of metabolism group early period, form of energy and Metabolic Gene Expression, cocaine habituation mouse volt every Raw bupropion metabolite access is more active in core.To the life ketone key enzyme-in cocaine Conditioned place preference mouse nucleus accumbens septi The protein expression situation of HMGCS2 is detected display, and the HMGCS2 expression of cocaine habituation mouse nucleus accumbens septi significantly increases (figure 4A)。
After single injection cocaine 30 minutes, 24 hours, and continuous cocaine injection, after 7 days, HMGCS2 expression increases (Fig. 4 B).The HMGCS2 enzymatic activitys of cocaine habituation mouse nucleus accumbens septi increase (Fig. 4 C).
These results illustrate that the expression of HMGCS2 and activity are raised during cocaine habituation.
3.2 inhibit influence of the nucleus accumbens septi HMGCS2 enzymatic activitys to cocaine locomotor sensitivity
Pharmacological the Study of Interference is carried out using HMGCS2 micromolecular inhibitors Hymeglusin.Hymeglusin is to HMGCS2 Active cysteine residues on carry out covalent modification formed thioesters adduct to realize inhibiting effect.30 before cocaine administration Minute injects Hymglusin to nucleus accumbens septi brain area, then carries out subsequent locomotor sensitivity experiment.Experiment process is shown in Fig. 5 A.
Spontaneous activity in mice locomotor sensitivity test result shows that the cocaine habituation that Hymeglusin is given in nucleus accumbens septi is small The operating range of mouse significantly shortens (Fig. 5 B).Hymeglusin does not cause shadow to the spontaneous activity of saline control group mouse It rings.HMGCS2 Enzyme assays show, Hymeglusin reduces cocaine habituation mouse and saline control group HMGCS2 Enzymatic activity (Fig. 5 C).The above results illustrate the enzymatic activity for inhibiting HMGCS2, effectively weaken the mouse locomotor sensitivity of cocaine induction.
3.3 inhibit influence of the nucleus accumbens septi HMGCS2 enzymatic activitys to cocaine Conditioned place preference
30 minutes intracerebral injection Hymglusin before cocaine administration, then carry out subsequent Conditioned place preference training.It gives Prescription formula is shown in Fig. 6 A.
Mouse Conditioned place preference result (Fig. 6 B) shows Hymeglusin not to the position of saline control group mouse It sets preference to impact, but reduces the Conditioned place preference of cocaine habituation mouse.The mRNA of nucleus accumbens septi HMGCS2 (Fig. 6 C) and protein level (Fig. 6 D) do not change after giving Hymeglusin, and illustrating Hymeglusin not influences turning for HMGCS2 Record and expression.The above results show to interfere the activity of HMGCS2, effectively the mouse Conditioned place preference of decrease cocaine induction Behavior.
3.4 inhibit influence of the nucleus accumbens septi HMGCS2 enzymatic activitys to cocaine induction energy disorder
ATP contents after Hymeglusin pretreatments in the nucleus accumbens septi of cocaine Conditioned place preference mouse are compared with solvent pair It is significantly increased according to processing group, illustrates that energy expenditure reduces (Fig. 7 A).Raised acetyl coenzyme A (Fig. 7 B), the citric acid lowered close The enzymatic activity (Fig. 7 C) and increased NAD+/NADH (Fig. 7 D) of enzyme illustrate that Hymeglusin weakens cocaine habituation mouse volt jointly Every the tricarboxylic acid cycle in core.These results indicate that the raw ketone key enzyme HMGCS2 of micromolecular inhibitor Hymeglusin interference Enzymatic activity, the brain energy metabolism for being effectively improved cocaine induction are abnormal.
Influences of the 3.5 nucleus accumbens septi silence Hmgcs2 to cocaine locomotor sensitivity
In order to confirm effects of the HMGCS2 in the Addictive Behaviors that cocaine induces, pass through slow virus silence nucleus accumbens septi Hmgcs2 genes carry out the Study of Interference.Mouse Whole Brain after injecting lentivirus is sliced, is observed and is marked by immunofluorescence The slow virus region of green fluorescent protein confirms viral accurate injection to nucleus accumbens septi brain area (Fig. 8 A).
The slow virus of nucleus accumbens septi locating injection silence Hmgcs2 genes or control slow virus latter week, carry out the spontaneous work of mouse Dynamic locomotor sensitivity experiment.As shown in Figure 8 B, receive the operating range of the cocaine habituation mouse of silence Hmgcs2 slow virus injection Significantly shorten.Intracerebral is given control slow virus and is not impacted to the spontaneous activity of saline control group mouse.The slow disease of detection The mRNA of nucleus accumbens septi HMGCS2 and protein level detection show that the mRNA gene transcription levels of HMGCS2 reduce (figure after poison injection 8C), the protein expression of HMGCS2 reduces (Fig. 8 D).Fig. 8 C and 8D prove that slow virus interference can effectively lower Hmgcs2 genes Transcription and HMGCS2 protein levels expression.The above results illustrate silence Hmgcs2 genes in nucleus accumbens septi, lower HMGCS2's Expression can effectively weaken the locomotor sensitivity of cocaine induction.
Influences of the 3.6 nucleus accumbens septi silence Hmgcs2 to cocaine Conditioned place preference
It nucleus accumbens septi slow virus injection operation latter week shows, gives pair after carrying out the training of cocaine Conditioned place preference It does not change according to the position preference of the saline control group mouse of slow virus;After giving silence Hmgcs2 gene slow virus, The Conditioned place preference of cocaine habituation mouse declines (Fig. 9 A).After giving silence Hmgcs2 gene slow virus, volt every Core HMGCS2 enzymatic activitys reduce (Fig. 9 B).This shows that nucleus accumbens septi silence Hmgcs2 genes can interfere the expression of HMGCS2, presses down simultaneously The enzymatic activity of HMGCS2 processed effectively weakens the Conditioned place preference behavior of cocaine induction.
3.7 nucleus accumbens septi silence Hmgcs2 induce cocaine the influence of energy disorder
As shown in Figure 10 A, progress cocaine Conditioned place preference training is small after slow virus injection silence Hmgcs2 genes ATP contents are increased compared with solvent control processing group in the nucleus accumbens septi of mouse, illustrate that the consumption of ATP is reduced.Meanwhile acetyl coenzyme A contains Amount increases (Figure 10 B), illustrates that the acetyl coenzyme A for entering tricarboxylic acid cycle energy supply is reduced.
The enzymatic activity of key enzyme-citrate synthase of tricarboxylic acid cycle also declines about 50% (Figure 10 C), illustrates silence Hmgcs2 lowers the tricarboxylic acid cycle activation degree in cocaine habituation mouse nucleus accumbens septi.Meanwhile indicating tricarboxylic acid cycle efficiency NAD+/ NADH increases (Figure 10 D), illustrates that tricarboxylic acid cycle access eases up.The variation of these form of energy illustrates in cocaine In the Conditioned place preference mouse brain of induction, nucleus accumbens septi is interfered to give birth to ketone key enzyme HMGCS2's by slow virus silence Hmgcs2 Expression and activity, can slow down tricarboxylic acid cycle, reduce energy expenditure, the brain energy metabolism for improving cocaine habituation stress.
4 conclusions
Experimental result is found, by inhibiting the activity of HMGCS2 or with the expression of shRNA silence Hmgcs2 genes, all may be used Significantly to mitigate the locomotor sensitivity and Conditioned place preference of cocaine habituation, cocaine habituation is treated.
To sum up, shRNA primers shown in SEQ ID NO.1 and SEQ ID NO.2 of the present invention, include aforementioned shRNA primers Recombinant plasmid and recombinant slow virus comprising the recombinant plasmid can be used as HMGCS2 inhibitor, the table of effective reticence HMGCS2 Reach, and then effectively weaken cocaine award behavior, mitigate locomotor sensitivity and Conditioned place preference, treatment cocaine at Addiction, potential applicability in clinical practice are good.

Claims (7)

1. a kind of purposes of recombinant plasmid or recombinant slow virus in the drug for preparing treatment cocaine habituation;
The recombinant plasmid includes nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.2;
The recombinant slow virus includes above-mentioned recombinant plasmid.
2. purposes according to claim 1, it is characterised in that:The recombinant plasmid is recombination PLLU2G plasmids.
3. purposes according to claim 2, it is characterised in that:The nucleotide sequence of the recombinant plasmid such as SEQ ID Shown in NO.3.
4. a kind of drug for treating cocaine habituation, it is characterised in that:It is to live that it, which is with a kind of recombinant plasmid or recombinant slow virus, Property ingredient, in addition the preparation that pharmaceutically acceptable auxiliary material is prepared;
The recombinant plasmid includes nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.2;
The recombinant slow virus includes above-mentioned recombinant plasmid.
5. drug according to claim 4, it is characterised in that:The recombinant plasmid is recombination PLLU2G plasmids.
6. drug according to claim 5, it is characterised in that:The nucleotide sequence of the recombinant plasmid such as SEQ ID Shown in NO.3.
7. according to the drug described in claim 4-6 any one, it is characterised in that:The preparation is ejection preparation.
CN201510510973.4A 2015-08-19 2015-08-19 A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation Active CN105087609B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510510973.4A CN105087609B (en) 2015-08-19 2015-08-19 A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510510973.4A CN105087609B (en) 2015-08-19 2015-08-19 A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation

Publications (2)

Publication Number Publication Date
CN105087609A CN105087609A (en) 2015-11-25
CN105087609B true CN105087609B (en) 2018-10-23

Family

ID=54568941

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510510973.4A Active CN105087609B (en) 2015-08-19 2015-08-19 A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation

Country Status (1)

Country Link
CN (1) CN105087609B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105597107B (en) * 2015-12-01 2019-09-13 宁波市微循环与莨菪类药研究所 Regulate and control the purposes of the miRNA-382 of AKT3 gene expression
CN113913424B (en) * 2020-07-09 2023-08-08 四川大学华西医院 Adeno-associated virus and application thereof in preparation of medicines for treating cocaine addiction

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1832957A (en) * 2003-07-09 2006-09-13 福布斯梅迪泰克公司 Novel compounds and compositions comprising sterols and/or stanols and cholesterol biosynthesis inhibitors and use thereofin treating or preventing a variety of diseases and conditions
CN104353059A (en) * 2014-10-15 2015-02-18 南方医科大学 Application of Activin A in preparation of medicine for treating withdrawal symptoms after mental excitation type drug addiction

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1832957A (en) * 2003-07-09 2006-09-13 福布斯梅迪泰克公司 Novel compounds and compositions comprising sterols and/or stanols and cholesterol biosynthesis inhibitors and use thereofin treating or preventing a variety of diseases and conditions
CN104353059A (en) * 2014-10-15 2015-02-18 南方医科大学 Application of Activin A in preparation of medicine for treating withdrawal symptoms after mental excitation type drug addiction

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"探讨HMG-CoA synthase 2(HMGCS2)in Breast Cancer Development";张芳瑜;《台北医学大学医学校检验暨生物技术学系所学位论文》;20120101;摘要 *

Also Published As

Publication number Publication date
CN105087609A (en) 2015-11-25

Similar Documents

Publication Publication Date Title
CN105255887B (en) A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation
CN106222170B (en) Circular rna circ-CCNY and application thereof
CN105524924B (en) Cyclic RNA circ-ZKSCAN1 use
CN106191067B (en) Circular rna circ-NFATC3 and application thereof
CN105979780A (en) Glucocorticoid inhibitors for treatment of prostate cancer
CN107012116A (en) A kind of construction method of small intestine 3D organoids research BCRP mediate drug transshipment models and application
CN106754914A (en) A kind of long non-coding RNA and its application in diagnosis/treatment preeclampsia
CN109609653A (en) The molecular marked compound and its application of diagnosis or treatment glioma
CN107663539A (en) Circular rna circ PTGR1 purposes
CN105087609B (en) A kind of recombinant slow virus and its purposes in the drug for preparing treatment cocaine habituation
CN105055404B (en) Purposes of the HMGCS2 inhibitor in the medicine for preparing treatment cocaine habituation
Zhao et al. Ultrasound-targeted microbubble destruction enhances the inhibitive efficacy of miR-21 silencing in HeLa cells
CN105055412A (en) Application of NAMPT inhibitor in preparing cocaine addiction treatment medicine
CN107267616A (en) A kind of application of Noncoding gene biomarker in liver cancer
CN107164554A (en) Applications of the ASPRV1 as biomarker in larynx squamous carcinoma diagnosis and treatment
CN106148337A (en) Long non-coding RNA AY927503 and application thereof
CN108660211A (en) A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application
CN110157708A (en) It is a kind of inhibit human glioma targeting linc01023 gene inhibitor and its application
Zhang et al. MiR-150 inhibits proliferation of mantle-cell lymphoma cells via regulation of MET
CN105251006B (en) Purposes of the TLR3 inhibitor in the drug for preparing treatment cocaine habituation
CN108707672A (en) Applications of the DUXAP8 in diagnosis of hepatoma and treatment
CN105688227A (en) Application of miR-127 in preparation of medicines for treating muscle diseases
CN104267188B (en) For the application of related preparations in preparation 5-FU Resistance detection reagent and 5-FU reversal agent of drug resistance of MSK1 gene
CN107227362A (en) A kind of gene related to liver cancer and its application
CN106834288A (en) A kind of long non-coding RNA and its application in diagnosis/treatment stomach cancer

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant