CN105524924B - Cyclic RNA circ-ZKSCAN1 use - Google Patents
Cyclic RNA circ-ZKSCAN1 use Download PDFInfo
- Publication number
- CN105524924B CN105524924B CN201511025996.2A CN201511025996A CN105524924B CN 105524924 B CN105524924 B CN 105524924B CN 201511025996 A CN201511025996 A CN 201511025996A CN 105524924 B CN105524924 B CN 105524924B
- Authority
- CN
- China
- Prior art keywords
- zkscan1
- circ
- gene
- cell
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
Abstract
The present invention provides cyclic RNA circ-ZKSCAN1 use, the objective existence of circ-ZKSCAN1 gene is first confirmed; expression status of the circ-ZKSCAN1 gene in a patient with hepatocarcinoma is detected to find that the expression level of the circ-ZKSCAN1 gene is significantly reduced; hepatoma cells transfected with circ-ZKSCAN1 gene shRNA sequence are compared with control hepatoma cells transfected with an empty vector to find that the proliferation rate, cell migration ratio and cell invasion ability and the like are significantly improved. The circ-ZKSCAN1 gene and a circ-ZKSCAN1 gene expression product are used as a hepatoma diagnostic marker, so that hepatoma diagnosis is more accurate and rapid, and the circ-ZKSCAN1 gene as a target gene for preparing hepatoma treatment drugs provides a new therapeutic target and therapeutic approach.
Description
Technical field
The present invention relates to a kind of circular rna, and in particular to a kind of purposes of circular rna circ-ZKSCAN1.
Background technology
Primary hepatoma (Hepatocellular carcinoma, HCC, hereinafter referred to as liver cancer) is in global range
One of modal malignant tumour.The whole world there are about 740,000 patients every year and is newly diagnosed as hepatocellular carcinoma, while there are about 690,000 patients
Die from liver cancer.Wherein China has accounted for the 55% of global annual new cases, becomes one of whole world liver cancer area most occurred frequently.
So far, the complex treatment with operative treatment as core remains Patients with Primary and obtains the unique of long term survival
Wish, but liver cancer treatment situation has early diagnosis difficulty at present, surgical radical treatment rate is low, the puzzlement of high recurrence rate, poor prognosis.
One of the main reasons is that early diagnosis is difficult, and AFP is used as the serology mark being uniquely widely accepted for diagnosing cancer of liver or detection
Note thing, the susceptibility of its diagnosing liver cancer can only achieve about 50%, and many factors ultimately result in patient more than 70% first
Just later period of hepatocarcinoma is had been enter into when examining, so as to lose the chance of the surgery radical treatment including surgery excision or liver transfer operation.Therefore
Molecular mechanism in further investigation liver cancer occurrence and development, develop new diagnosis marker and therapy target and become current cancer and grind
The focus and emphasis field studied carefully.
Circular rna (ciucular RNA, circRNA) is the RNA families newcomer for being different from conventional linear RNA, is not had
There are 5' ends cap and 3' ends poly (A) tails the non-coding RNA molecule with covalent bond formed loop configuration.It is newest to grind
Study carefully and show that circRNA has closed hoop structure, mainly produced by the processing of atypia variable sheer, be widely present in various lifes
In thing cell, with Stability Analysis of Structures, it is difficult to which good by conservative between RNase degraded, gene expression abundance height, species, expression is with tissue
And the feature such as Space-time speciality, these features cause circRNA to have in the development and application of New Type of Diseases Clinics and Practices method
Hold out broad prospects.
Circ-ZKSCAN1(CircBase ID：Hsa_circ_0001727), its orientating as on genome：chr7:
99621041-99621930, corresponding glm gene are ZKSCAN1 (NM_003439), and cyclization sequence has 668 bases, comprising
The second of ZKSCAN1 genes and the 3rd extron.Have been reported that ZKSCAN1 can promote the invasion and attack and transfer of cancer of the stomach, but in liver cancer
In without study.
The content of the invention
It is an object of the invention to expression according to inventor to circular rna circ-ZKSCAN1 in human liver cancer and its
Research to the adjustment effect of HCC biological function, there is provided based on circ-ZKSCAN1 genes and its expression product in liver
Purposes in terms of the diagnosis and treatment of cancer.
For achieving the above object, the technical scheme taken：A kind of circular rna circ-ZKSCAN1, the circular rna
The nucleotide sequence of circ-ZKSCAN1 such as SEQ ID NO:Shown in 14.The structure of the circular rna circ-ZKSCAN1 be by
Such as SEQ ID NO:The circulus that nucleotide sequence head and the tail shown in 14 are connected into.
The invention provides a kind of pharmaceutical composition, described pharmaceutical composition includes circular rna as claimed in claim 1
circ-ZKSCAN1。
The invention provides a kind of diagnosing cancer of liver kit, the kit is comprising can expand ring-type described above
The primer of RNA circ-ZKSCAN1.
Preferably, the amplimer is by such as SEQ ID NO:2 and SEQ ID NO:DNA sequence dna composition shown in 3
Primer pair or by such as SEQ ID NO:4 and SEQ ID NO:The primer pair of the DNA sequence dna composition shown in 5.
The invention provides the use of circular rna circ-ZKSCAN1 described above in the medicine for preparing treatment liver cancer
On the way.
The invention provides purposes of the circ-ZKSCAN1 genes as target gene in the medicine for preparing treatment liver cancer, institute
State the nucleotide sequence such as SEQ ID NO of circ-ZKSCAN1 genes:Shown in 1..
The invention provides purposes of the circ-ZKSCAN1 gene activations in the medicine for preparing treatment liver cancer, described
The nucleotide sequence of circ-ZKSCAN1 genes such as SEQ ID NO:Shown in 1..
Compared with prior art, the beneficial effects of the present invention is：
(1) present invention carries out RT-PCR, generation sequencing, RNase degraded in fact by designing special circular rna primer first
The objective reality of checking reality circ-ZKSCAN1 genes；
(2) by detecting circ-ZKSCAN1 expression conditions in hepatocarcinoma patient, the present invention has found that its expression is bright
It is aobvious to reduce, therefore, can be used as the diagnostic markers of liver cancer；
(3) present invention has carried out the research of cell in vitro function assessment to circ-ZKSCAN1 genes, by by circ-
ZKSCAN1 gene orders specificity shRNA sequences are transfected into SMMC-7721 SMMC-7721s, to set up the down regulation of gene expression
Cell line.Transfected the HCC of circ-ZKSCAN1 gene shRNA sequences and transfection empty carrier compares HCC
Compare, its growth rate, cell migration rate and cell invasion ability etc. are significantly raised.Circ-ZKSCAN1 genes and its expression
Product can be applied in the medicine for preparing treatment liver cancer.
The mark of circ-ZKSCAN1 genes and its expression product as diagnosing liver cancer, make diagnosing cancer of liver more accurately,
Quickly, new therapy target and therapy approach are provided to treat liver cancer as the target gene for preparing treatment liver-cancer medicine.
Description of the drawings
Fig. 1 is the structural representation of circ-ZKSCAN1 in the embodiment of the present invention 1；
Fig. 2 is the agarose gel electrophoresis figure of circ-ZKSCAN1 gene expression products in the embodiment of the present invention 1；
Fig. 3 is the sequencing peak figure in circ-ZKSCAN1 cyclisation site in the embodiment of the present invention 1；
Fig. 4 is to reflect block diagrams of the RNaseR on circ-ZKSCAN1 and GAPDH impact situations in the embodiment of the present invention 2.
Fig. 5 is circ-ZKSCAN1 expression of results comparison diagrams in QPCR detections liver cancer tissue in the embodiment of the present invention 2；
Fig. 6 is the stable cell line shows fluorescent microscopy images that build in the embodiment of the present invention 3；
Fig. 7 is SMMC-7721-sh circ-ZKSCAN1 cell lines expression circ-ZKSCAN1 in the embodiment of the present invention 3
Comparative result figure；
Fig. 8 is that the hepatoma cell strain speed of growth of circ-ZKSCAN1 expression downwards in the embodiment of the present invention 4 is accelerated.
Fig. 9 is that the hepatoma cell strain mobility of circ-ZKSCAN1 expression downwards in the embodiment of the present invention 5 increases.In liver cancer
Cell migration assay result schematic diagram in cell SMMC-7721 after special interference circ-ZKSCAN1 genes, wherein abscissa
For number of days, ordinate is the cell number that migration occurs.
Figure 10 is that the hepatoma cell strain invasive ability of circ-ZKSCAN1 expression downwards in the embodiment of the present invention 6 is strengthened.
Cell invasion experimental result schematic diagram in Hepatocellular carcinoma cell line after special interference circ-ZKSCAN1 genes, wherein horizontal
Coordinate is number of days, and ordinate is the cell number that invasion and attack occur.
Specific embodiment
The present invention can expand the specific primer of circular rna first by design, and PCR expands out ZKSCAN1 genes
Circular rna, and the method being sequenced by a generation has determined out the accurate cyclisation site of circular rna circ-ZKSCAN1, connects
Carries out RNaseR degradation experiments, it is determined that ZKSCAN1 gene expressions are a kind of to be made up of 668 nucleotides, with closure ring
The circular RNA molecule of shape structure, the structural representation of circular rna circ-ZKSCAN1 of the present invention are as shown in Figure 1.
Further, the present invention detects circ-ZKSCAN1 genes in liver cancer sample by the method using quantitative fluorescent PCR
In differential expression, as a result show expression of the circ-ZKSCAN1 genes in liver cancer tissue significantly lower than in cancer beside organism
Expression.Therefore the kit for detecting the changes in gene expression can be made for diagnosing liver cancer.
Then, we have carried out the research of cell in vitro function assessment to circ-ZKSCAN1 genes, by by circ-
ZKSCAN1 gene orders specificity shRNA sequences are transfected into SMMC-7721 SMMC-7721s, to set up the down regulation of gene expression
Cell line.Transfected the HCC of circ-ZKSCAN1 gene shRNA sequences and transfection empty carrier compares HCC
Compare, its growth rate, cell migration rate and cell invasion ability etc. are significantly raised.Therefore, circ-ZKSCAN1 genes and
Its expression product can be applied in the medicine for preparing treatment liver cancer.
Technology involved in the present invention is molecular cloning routine techniques means, the enzyme being directed to, primer, reagent and
Reaction condition can carry out reasonable selection according to the experience of those skilled in the art in the case of not specified (NS), be directed to examination
Agent consumptive material belongs to commercially available mill run, and the detection means and instrument being directed to also is well known to the skilled person
And skillfully grasp.
Technical scheme is described further below by embodiment and test example, but should not be construed as it is right
The restriction of the present invention.
Embodiment 1：Expression of the RT-PCR reaction detection circ-ZKSCAN1 genes in liver cancer tissue.
Specific experiment scheme is as follows：
1.RNA is extracted
1) tissue treatment：Take 10mg or so tissues and add 1mlTrizol, be homogenized with refiner；Centrifugation 15 minutes,
12000g, takes supernatant.
2) 200ul chloroforms are added in supernatant, it is firmly reverse up and down to mix half a minute, stand 3 minutes.
3) 4 DEG C, 12000g is centrifuged 15 minutes, now visible lysate points three layers：RNA of the upper strata for water phase；Middle level is
DNA, lipid etc.；Lower floor is cell residue, albumen, polysaccharide etc..
4) take supernatant interior to new EP pipes；Isopyknic isopropanol is added, is mixed, after standing 10 minutes, 4 DEG C, 12000g
Centrifugation 10 minutes.
5) carefully remove supernatant, be careful not to lose RNA precipitate, add 75% ethanol of 1ml, turn upside down, make precipitation block
Resuspended.
6) 4 DEG C, 12000g is centrifuged 10 minutes, carefully removes supernatant, blots the liquid of tube wall as far as possible, is careful not to lose
RNA precipitate, if precipitation loosening can be centrifuged again.Dry about 15 minutes, to tube wall no liquid.
7) the DEPC water dissolving RNAs of appropriate volume (20-30ul), 58 DEG C of water-baths 10 minutes are added.
8) take out 2ul quantitative, measure buffer:10mM TrisCl (pH7.8), carry out reverse transcription according to quantitative result.
(1A260=40 μ g/ml, A260/A280=1.8～2.1).
2.cDNA reverse transcriptions
1) experimental system
M-MLV Reverse Transcriptase：
3. primer：Circular rna primer is reverse primer, while design a pair of forward primers compareing, is set up during RT-PCR
One group of gDNA Template Controls, it was demonstrated that circRNA is from post transcription cleavage, rather than the mutation such as Gene Fusion.Detect simultaneously linear
Gene GAPDH is used as negative control.The primer for using is listed below (such as SEQ ID NO:Shown in 2 to 9)：
| circ-ZKSCAN1_F divergent | AGTCCCACTTCAAACATTCGTCT |
| circ-ZKSCAN1_R divergent | CACCTTCACTATTACGATACCATCC |
| circ-ZKSCAN1_F convergent | TACCGCCCCGATAGTGGAGA |
| circ-ZKSCAN1_R convergent | TGAAGTGGGACTGGGTGGC |
| hsaGAPDH convergent_F | GAGTCAACGGATTTGGTCGT |
| hsaGAPDH convergent_R | GACAAGCTTCCCGTTCTCAG |
| hsaGAPDH divergent_F | TCCTCACAGTTGCCATGTAGACCC |
| hsaGAPDH divergent_R | TGCGGGCTCAATTTATAGAAACCGGG |
4.PCR：Using GAPDH as internal reference.The reaction system of PCR：Be separately added in each reaction tube 2 μ l 10 ×
Buffer, is separately added into 2 μ l dNTP, and 1 μ l forward primers, 1 μ l reverse primers, 1 μ l cDNA templates, 0.2 μ l Taq enzymes add water
To 20 μ l.PCR reaction conditions are as follows：94 DEG C, 5 minutes denaturations；94 DEG C, denaturation in 30 seconds；55 DEG C, anneal within 30 seconds；72 DEG C, 30 seconds
Extend；35 circulations, agarose gel electrophoresis detection pcr amplification product, are as a result shown in Fig. 2, and in Fig. 2, circular rna primer is reverse
Primer (black triangle symbol), while designing a pair of forward primers compares (white triangles pictograph number), sets up during RT-PCR
One group of gDNA Template Controls, it was demonstrated that circRNA is from post transcription cleavage, rather than the mutation such as Gene Fusion.Detect simultaneously linear
Gene GAPDH is used as negative control.PCR primer send sequencing company to be sequenced, and can clearly detect cyclisation site, as a result see Fig. 3, will
RT-PCR products in Fig. 2 send sequencing company to carry out sanger sequencings, and sequencing result shows cyclisation site, it was demonstrated that circ-
There is cyclisation in ZKSCAN1..
Embodiment 2：The expression of circ-ZKSCAN1 in QPCR detection liver cancer
1.RNA is extracted：With embodiment 1；
2.cDNA reverse transcriptions：With embodiment 1；
3.QPCR amplification experiments
1) experimental system：
It is used to expand circular rna circ-ZKSCAN1 from the circ-ZKSCAN1divergent primers of embodiment 1, it is real
The hsaGAPDH convergent primers for applying example 1 are used to expand reference gene.
2) reaction condition：
The first step：95℃2min
Second step (40 circulations)：95 DEG C 3 seconds, 60 DEG C 30 seconds
3rd 60 95 DEG C of step solubility curve
3) on, machine carries out target gene amplification
4) qPCR relative quantifications result
The relative expression quantity computing formula of target gene is：2- Δ Δ Ct=2-【(ΔCt)Test-(ΔCt)
Control】.Ct purposes are target gene Ct values, and house keeper Ct is house-keeping gene Ct values.Δ Ct=Ct purpose-Ct house keepers, represent each
Relative Ct value of the sample genes of interest with respect to house-keeping gene, Δ Δ Ct=(Δ Ct) Test- (Δ Ct) Control, expression are processed
Group relative comparison group is normalized, and 2- Δ Δ Ct represent the relative expression quantity for the treatment of group relative comparison group, represents target gene
Relative fold expression.
Total RNA add RNaseR to be digested in the ratio of 3U/ug, and QPCR detections add and are not added with RNaseR pair
The impact of circ-ZKSCAN1 and GAPDH, is as a result shown in Fig. 4, and RNaseR digestion confirms that circ-ZKSCAN1 is insensitive to RNase.
RNaseR is one and can digest linear rna, but does not have influential RNase on circular rna, and total RNA are digested with RNaseR
Carry out QPCR detections afterwards again, as a result show plus circ-ZKSCAN1 expression is had not significant impact with RNaseR is not added with, but line
Property gene GAPDH Jing after RNaseR digestion express and significantly reduce..
QPCR detects the expression of circ-ZKSCAN1 and GAPDH in liver cancer and corresponding adjacent tissues, as a result sees Fig. 5,
The expression of circ-ZKSCAN1 is detected in 30 pairs of liver cancer clinical tissue samples, as a result shows circ-ZKSCAN1 in cancerous tissue
Significantly lower.N：Cancer beside organism, T：Liver cancer tissue.
Embodiment 3：Sh circ-ZKSCAN1 slow virus and its stable cell lines build
1.sh circ-ZKSCAN1 slow virus carriers build：The JaRa company synthesis shRNA sequences in Shanghai, sequence are passed through
Double chain DNA fragment is annealed into, LV008 (pLL-U6-shRNA-CMV-GFP-Puro) carrier is inserted into by MCS, weight
Group plasmid is identified by sequencing.The nucleotides positive-sense strand of shcirc-ZKSCAN1 and antisense strand sequence such as SEQ ID NO:10
With shown in 11.The nucleotides positive-sense strand of Control negative controls and antisense strand sequence such as SEQ ID NO:Shown in 12 and 13.
2. slow virus is packed
(1) 24h before transfecting, digests the 293T cells of exponential phase with pancreatin, passes on 10cm Tissue Culture Dish, and 37
DEG C, culture in 5%CO2 incubators.24h when cell density is up to 70%～80% can be used to transfect.Cell state is for disease
Poison packaging is most important, it is therefore desirable to ensure good cell state and less passage number.
(2) cell culture medium is replaced by into serum free medium before transfecting.
(3) add in a sterile centrifugation tube prepared each DNA solution (10 μ g of pLL-sh circ-ZKSCAN1 carriers,
5 μ g, pRev carrier of pGag/Pol carriers, 5 μ g, pVSV-G carrier, 5 μ g), it is well mixed with the Opti-MEM of respective volume, adjusts
Cumulative volume is 1.5ml.
(4) 2000 reagents of Lipofectamine are softly shaken up, 60 μ l Lipofectamine, 2000 reagents are taken another
Mix with 1.5ml Opti-MEM in one pipe, incubate 5 minutes at room temperature.
(5) DNA after dilution is mixed with the Lipofectamine 2000 after dilution, lightly overturns and mix,
Should not vibrate.
(6) after mixing, incubate 20 minutes at room temperature, to form DNA with 2000 dilutions of Lipofectamine
Transfection composite.
(7) DNA is transferred in the nutrient solution of 293T cells with 2000 mixed liquors of Lipofectamine, is mixed, in 37
DEG C, cultivate in 5%CO2 cell culture incubators.
(8) culture medium containing transfection mixture is sucked after cultivating 6 hours, is added in every bottle of cell thin containing 10% serum
Born of the same parents culture medium 10ml, continues culture 48 hours in 37 DEG C, 5%CO2 incubators.
3. the results of virus and concentration
(1) the 293T cell supernatants of (transfection can be to count for 0 hour) 48 hours and 72 hours after collecting transfection.
(2) in 4 DEG C, 4000g centrifugation 10min remove cell fragment.
(3) with 0.45 μm of filter filtering supernatant in 50ml centrifuge tubes.
(4) viral crude extract sample is added in filter cup (most 19ml), is closed the lid.Filter cup is inserted into into filtration
In liquid collecting pipe.
(5), after combining, balance is carried out, is placed in rotary head.
(6) it is centrifuged in 5000 × g, to the viral concentration volume for needing.The time for generally needing is 10-15 minutes.
(7) the as viral concentration liquid after centrifugation terminates, in filter cup.
(8) viral concentration liquid is removed, is stored in after packing in viral pipe, can be preserved one week at 4 DEG C, or -80 DEG C long-term
Preserve.Taking wherein one carries out viral biology titer determination.
4. slow virus infected cell：
(1) cell is collected by centrifugation in 1.5ml pipes according to the amount of cell and then uses the serum-free medium of 100-200ul
Diluting cells are precipitated, and are totally submerged by cell and are defined in the medium.
(2) draw in pLL-sh circ-ZKSCAN1 virus liquids addition cell, 1.5ml pipes are placed on into 37 DEG C of degree incubators
Middle incubation 30 minutes.Separately take the virus infection of pLL-GFP empty vector controls and do control cell lines.
(3) mixed solution in pipe is suctioned out and is added in culture dish or in hole.
(4) add the fresh medium of q.s.
Liquid is changed after (5) 12 hours.
2ug/ml puromycin are added to carry out stable cell line screening after (6) 48 hours.
5. stable cell line identification：Take pictures under the stable cell line fluorescence microscope for building observation, GFP positive rates>
95%, while collecting part cell QPCR detections, it was demonstrated that the knockdown efficiency of circ-ZKSCAN1>70%.As a result see Fig. 6
With 7, by the shRNA sequence constructs of circ-ZKSCAN1 gene specifics to pLL-U6-GFP-Puro slow virus carriers, by slow
Virus formulation SMMC-7721 stable cell lines, as a result show GFP positive rates>95%, QPCR detection confirms circ-ZKSCAN1 quilts
Effectively disturb, expression is reduced to 20% or so.
Embodiment 4：The hepatoma cell proliferation ability of knockdown circ-ZKSCAN1 genes is determined
(1) shcirc-ZKSCAN1 cell lines and compared with control cells are digested to into single cell suspension, are counted, adjust cell concentration
For 1 × 105/ml, 96 orifice plates are assigned to, per hole 100ul, i.e., be 1 × 104 per hole cell, each 9 hole.
(2) MTS reagent is added in different time points (24h, 48h, 72h) respectively, ratio is 1：10, i.e. 100 μ l are cultivated
Liquid adds 10 μ l detection liquid.
After (3) 37 DEG C of incubation 4h, ELIASA detection 490nm light absorption values.
As a result see Fig. 8, the hepatoma cell strain speed of growth that circ-ZKSCAN1 expression is lowered is accelerated, in HCC
Cell growth curve schematic diagram in SMMC-7721 after specificity shRNA interference circ-ZKSCAN1 genes, wherein abscissa is
Number of days, ordinate are the 490nm light absorption values of ELIASA detection.
Embodiment 5：The fucosylation ability detection of knockdown circ-ZKSCAN1 genes
(1) pancreatin is digested to single cell suspension, counts, and adjusts cell concentration to 1 × 106/ml with serum free medium.
(2) add 100 μ l cell suspensions to room on cell, in lower room, add 600 μ l to contain variable concentrations hyclone
Complete medium.37 DEG C, be incubated 24h in 5%CO2 incubators.
(3) cell being taken out, the cell of upper room being wiped with cotton swab, 4% paraformaldehyde fixes 10min, and PBS washed once, and ties
Crystalviolet dyes 10min, and PBS washed once, and microscopic is simultaneously taken pictures.
As a result see Fig. 9, the hepatoma cell strain mobility that circ-ZKSCAN1 expression is lowered increases, in HCC SMMC-
Cell migration assay result schematic diagram in 7721 after special interference circ-ZKSCAN1 genes, wherein abscissa are number of days, are indulged
Coordinate is the cell number that migration occurs.
Embodiment 6：The HCC cell invasion experiment of knockdown circ-ZKSCAN1 genes
(1) Matrigel is placed in 4 DEG C and is overnight dissolved, Matrigel is pressed with the basal medium of precooling：Culture medium=
1：3 dilution proportion, takes in the Transwell cells that 40 μ l add precooling, and action is slow, it is to avoid produce bubble.
(2) 37 DEG C of incubations solidify Matrigel in 2 hours.
(3) 100 μ l and 600 μ l basal mediums, 37 DEG C of hydrated overnights are added in upper and lower room respectively.Next day sucks culture
Base.
(4) after the digestion of experimental cell pancreatin, appropriate cell suspension is taken, 800rpm is centrifuged 5 minutes.
(5) supernatant is sucked, after basal medium re-suspended cell, cell count simultaneously adjusts cell concentration with basal medium
To 1 × 106/ml, take 100 μ l and add to room on Transwell cells, 600 μ l complete mediums are added in lower room.
(6), after cultivating 24,48 hours in being put into incubator, cell is taken out, the cell of upper room, 4% poly is wiped with cotton swab
Formaldehyde fixes 15 minutes, and PBS washed once, 1% violet staining 10 minutes, and PBS washed once, and basis of microscopic observation cell is
It is no through aperture.If any passing through, terminate other experimental groups, take pictures and count through cell number.
As a result see Figure 10, the hepatoma cell strain invasive ability that circ-ZKSCAN1 expression is lowered is strengthened, in HCC
Cell invasion experimental result schematic diagram in SMMC-7721 after special interference circ-ZKSCAN1 genes, wherein abscissa are day
Number, ordinate are the cell number that invasion and attack occur.
Last should be noted that above example is only to illustrate technical scheme rather than the present invention is protected
The restriction of shield scope, although being explained in detail to the present invention with reference to preferred embodiment, one of ordinary skill in the art should
Understand, technical scheme can be modified or equivalent, without deviating from the essence of technical solution of the present invention
And scope.
Claims (3)
1. purposes of the circular rna circ-ZKSCAN1 in diagnosing cancer of liver kit is prepared, it is characterised in that the circular rna
The CircBase ID of circ-ZKSCAN1 be hsa_circ_0001727, the nucleotides sequence of the circular rna circ-ZKSCAN1
Row such as SEQ ID NO:Shown in 14, the structure of the circular rna circ-ZKSCAN1 is by such as SEQ ID NO:Core shown in 14
The circulus that nucleotide sequence head and the tail are connected into.
2. purposes according to claim 1, it is characterised in that the kit includes amplification circular rna circ-
The primer of ZKSCAN1.
3. purposes according to claim 2, it is characterised in that the amplimer is by such as SEQ ID NO:2 and SEQ
ID NO:Shown in 3 DNA sequence dna composition primer pair or by such as SEQ ID NO:4 and SEQ ID NO:DNA sequence dna group shown in 5
Into primer pair.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511025996.2A CN105524924B (en) | 2015-12-29 | 2015-12-29 | Cyclic RNA circ-ZKSCAN1 use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511025996.2A CN105524924B (en) | 2015-12-29 | 2015-12-29 | Cyclic RNA circ-ZKSCAN1 use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105524924A CN105524924A (en) | 2016-04-27 |
| CN105524924B true CN105524924B (en) | 2017-03-22 |
Family
ID=55767452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511025996.2A Active CN105524924B (en) | 2015-12-29 | 2015-12-29 | Cyclic RNA circ-ZKSCAN1 use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105524924B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106048040A (en) * | 2016-07-05 | 2016-10-26 | 周重昌 | Coloresctal cancer annular RNA molecular marker and detection reagent |
| CN106222170B (en) * | 2016-08-05 | 2019-05-07 | 广州永诺生物科技有限公司 | Circular rna circ-CCNY and application thereof |
| CN106834290B (en) * | 2017-01-23 | 2020-05-22 | 中山大学附属肿瘤医院 | Circular RNA and application thereof |
| CN107828888B (en) * | 2017-11-09 | 2021-05-04 | 中山大学附属第一医院 | Use of circular RNA circ-PTPRA |
| CN109371137B (en) * | 2018-12-29 | 2020-08-11 | 中山大学孙逸仙纪念医院 | Method for detecting hsa _ circ _0007986 in serum of esophageal cancer patient as novel biomarker and application |
| CN110551197B (en) * | 2019-08-01 | 2021-04-13 | 北京大学第三医院（北京大学第三临床医学院） | Micro-peptide and cancer treatment drug |
| CN111778334A (en) * | 2020-07-13 | 2020-10-16 | 中山大学孙逸仙纪念医院 | Evaluation method of CircRNA as liver cancer tumor marker |
| CN111893121B (en) * | 2020-08-24 | 2021-12-03 | 四川大学华西医院 | Circular RNA and application thereof |
| CN112695074A (en) * | 2020-12-25 | 2021-04-23 | 东莞市寮步医院 | Non-diagnostic fluorescent quantitative detection method for circular circZKSCAN1 gene in serum |
| CN113789340B (en) * | 2021-08-25 | 2023-06-13 | 重庆医科大学 | Expression vector of circular RNA hsa_circ_0001741, recombinant engineering bacterium and application thereof |
-
2015
- 2015-12-29 CN CN201511025996.2A patent/CN105524924B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Array comparative genomic hybridization, expression array, and protein analysis of critical regions on chromosome arms 1q, 7q, and 8p in adenocarcinomas of the gastroesophageal junction;Herman van Dekken等;《Cancer Genetics and Cytogenetics》;20090201;第189卷;第37-42页 * |
| Expanded identification and characterization of mammalian circular RNAs;Junjie U Guo等;《Genome Biology》;20140729;第15卷(第409期);第1-14页 * |
| Short intronic repeat sequences facilitate circular RNA production;Dongming Liang等;《GENES & DEVELOPMENT》;20141003;第28卷;第2233-2247页，主要涉及第2234页右栏Results第1段、图1-A、图2-A及第2246页左栏第2段 * |
| 环状RNA研究进展;陈学英等;《生命科学》;20150930;第27卷(第9期);第1125-1132页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105524924A (en) | 2016-04-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524924B (en) | Cyclic RNA circ-ZKSCAN1 use | |
| CN106222170B (en) | Circular rna circ-CCNY and application thereof | |
| CN106191067B (en) | Circular rna circ-NFATC3 and application thereof | |
| RU2693938C2 (en) | Use of alphavirus in preparation of antitumor drugs | |
| CN109837306A (en) | Contain the excretion body and its preparation method and application of miRNA-204-5p | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN106834290B (en) | Circular RNA and application thereof | |
| CN103642927A (en) | Reagent for detecting autophagy signal pathway, PCR (polymerase chain reaction) detection method and application of reagent | |
| WO2019206341A1 (en) | Rab22a-noefs fusion gene line for diagnosis and/or treatment of osteosarcoma and application thereof | |
| CN107760784A (en) | Circular rna circ FOXP1 purposes | |
| CN107828888A (en) | Circular rna circ PTPRA purposes | |
| CN109908369B (en) | Application of novel circular RNA circCRKL in prostate cancer treatment | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN107267616A (en) | A kind of application of Noncoding gene biomarker in liver cancer | |
| CN107190005A (en) | Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment | |
| CN108531483B (en) | Annular RNA related to nucleus pulposus of intervertebral disc and application | |
| CN110283912A (en) | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker | |
| CN114540502A (en) | Detection method and kit for gastric cancer chemotherapy drug sensitivity and application of NSUN2 detection | |
| CN105441405A (en) | A BMX spliceosome and applications thereof in lung cancer drug resistance | |
| CN107227362A (en) | A kind of gene related to liver cancer and its application | |
| CN109536452B (en) | Visual nasopharyngeal carcinoma cell and application thereof | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| Chen et al. | Phenotype and genotype heterogeneous resistance of L-forms of Mycobacterium tuberculosis by magnetic nanoparticle | |
| CN106729751B (en) | Application of microRNA molecule in detection and treatment of breast cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |