CN105441405A - A BMX spliceosome and applications thereof in lung cancer drug resistance - Google Patents
A BMX spliceosome and applications thereof in lung cancer drug resistance Download PDFInfo
- Publication number
- CN105441405A CN105441405A CN201410432181.5A CN201410432181A CN105441405A CN 105441405 A CN105441405 A CN 105441405A CN 201410432181 A CN201410432181 A CN 201410432181A CN 105441405 A CN105441405 A CN 105441405A
- Authority
- CN
- China
- Prior art keywords
- bmx
- cell
- spliced body
- polynucleotide
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A BMX spliceosome is provided. The nucleotide sequence of the BMX spliceosome is shown as SEQ ID NO:3. A host cell containing a gene coding the BMX spliceosome and a method of detecting functions of the BMX spliceosome by utilization of the host cell are also provided by the invention. The BMX spliceosome or the host cell containing the BMX spliceosome can be used for testing drug resistance of lung cancer cells.
Description
Technical field
The present invention relates to biological technical field, particularly, relate to BMX spliced body and the application in drug resistance of lung cancer thereof.
Background technology
Lung cancer is one of disease that in current global range, hazardness is maximum.Clinically, though the third generation has some advantages based on the conjoint therapy treatment nonsmall-cell lung cancer of platinum, but the therapeutic modality in conjunction with several cytotoxic drug does not obtain treats better effect than platinum double reagent, show that this methods for the treatment of reaches bottleneck.
Along with to the biological further investigation of lung cancer and the further understanding to lung cancer morbidity molecular mechanism, the key pathogenetic gene according to existing in different individual patients tumour carries out molecular targeted therapy targetedly.More successful example is namely for the micromolecular inhibitor in the targeting EGFR kinases territory designed by EGF-R ELISA (EGFR) activated form sudden change (such as L858R point mutation, 19 exon deletion mutantions), comprise Gefitinib (Gefitinib, and Tarceva (Erlotinib, Tarceva) Iressa).These micromolecular inhibitors are evident in efficacy to the patients with lung cancer with the sudden change of above-mentioned EGFR kinases territory clinically, but the appearance of some medicament-resistant mutations (amplification etc. of such as EGFR kinases territory T790M point mutation, MET or HER2 gene) but greatly weakens the result for the treatment of of targeted drug, and do not have good resolution policy at present.Therefore, find and potential key pathogenetic gene and drug resistance related gene in qualification lung cancer, the targeted drug new for research and development and solution drug resistance problems are significant.
Cancer gene group research in recent years finds, except carcinogenic transgenation, the fusion gene caused due to genomic instability or the improper shearing of gene are also the key factors that cancer occurs.Such as, the fusion gene of ALK comprises in lymphatic cancer and lung cancer in various malignant tumour generation, wherein in lung cancer, the ALK fusion gene of two kinds of forms is TFG-ALK and KIF5B-ALK, makes ALK have the activity of lasting Tyrosylprotein kinase after these genes and ALK merge.
While detection fusion gene, very polygenic improper shearing is found existence.Research finds the variable sheer of some genes and the generation of cancer develops and anti-medicine exists close contacting.Typical example is suppressor gene p53, it can be present in the ovarian cancer of 54.7% by variant, reduce ovarian cancer cell the sensitivity of chemotherapeutics is responded, its expression becomes positive correlation with the recurrence of ovarian cancer.
In sum, in order to Diagnosis and Treat cancer, this area is in the urgent need to exploitation and the material that cancer occurs or cancer therapy drug resistance is relevant.
Summary of the invention
The object of this invention is to provide a kind of have promote proliferation of lung cancer cells and increase the BMX of lung carcinoma cell to cancer therapy drug resistance improper spliced body.
Another object of the present invention is to provide the improper spliced body detection method of a kind of BMX and application.
A first aspect of the present invention, provides the improper spliced body of a kind of BMX (being called BMX Δ N below), the N end of described spliced body protein delation wild-type BMX, only retains C and holds kinases territory.
In another preference, the 1-383 position of described spliced body protein delation wild-type BMX aminoacid sequence.
In another preference, described wild-type BMX aminoacid sequence is as shown in SEQIDNO.:2.
In another preference, the described aminoacid sequence of spliced body protein delation as shown in SEQIDNO.:2 1-383 position.
In another preference, the aminoacid sequence of described spliced body albumen is as shown in SEQIDNO.:4 1-292 position.
A second aspect of the present invention, provides a kind of polynucleotide, the spliced body albumen of the described BMX described in polynucleotide encoding a first aspect of the present invention.
In another preference, described polynucleotide contain the nucleotide sequence shown in SEQIDNO.:3.
In another preference, described polynucleotide are encoding wild type BMX albumen (aminoacid sequence as shown in SEQIDNO.:2) not.
In another preference, described polynucleotide BMX Δ N is that the nucleotide sequence of wild-type BMX is sheared by the 942nd specific cleavage sites and formed, and is No. 8 intron partial sequences before the 942nd.
A third aspect of the present invention, provides a kind of carrier, and described carrier contains polynucleotide as according to the second aspect of the invention.
A fourth aspect of the present invention, provides a kind of genetically engineered host cell, and described genetically engineered host cell comprises in carrier described in a third aspect of the present invention or genome the polynucleotide be integrated with described in a second aspect of the present invention.
In another preference, described host cell comprises prokaryotic cell prokaryocyte (as intestinal bacteria etc.) or eukaryotic cell (yeast cell, Chinese hamster ovary celI etc.).
A fifth aspect of the present invention, provides a kind of method preparing spliced body albumen as described in a first aspect of the present invention, comprises step:
A (), in the condition of applicable expression, cultivates the genetically engineered host cell described in fourth aspect present invention, thus express the BMX spliced body albumen described in first aspect present invention; With
BMX spliced body albumen described in (b) isolated or purified.
A sixth aspect of the present invention, provide the purposes of the spliced body albumen described in a kind of a first aspect of the present invention or the polynucleotide described in a second aspect of the present invention, its quilt (a) is for the preparation of the reagent or the test kit that detect cancer susceptibility and/or cancer cell resistance; Or (b) is for screening the inhibitor suppressing BMX Δ N, described inhibitor specificity or Selective depression BMX Δ N.
In another preference, described cancer comprises nonsmall-cell lung cancer, cancer of the stomach.
In another preference, described reagent comprises: primer, probe, reference substance, chip.
In another preference, described test kit comprises described reagent and working instructions.
A seventh aspect of the present invention, provide a kind of PCR primer pair for increase polynucleotide as according to the third aspect of the invention or its fragment, described PCR primer pair comprises the first primer and the second primer, the bond site of described first primer is positioned at No. 8 introns of BMX gene, the bond site of the second primer is positioned at 9 exons of BMX gene, and the length >=150bp of amplified production that described primer pair amplifies.
In another preference, the length >=250bp of the amplified production that described primer pair amplifies, preferably >=400bp.
In another preference, described primer pair does not increase the nucleotide sequence of wild-type BMX.
In another preference, the sequence of the first described primer is as shown in SEQIDNO.:7.
In another preference, the length of described first primer and the second primer is 15-50bp, is preferably 15-35bp.
In another preference, the first described primer and the second primer are as shown in SEQIDNO.:9 and 10.
In another preference, when there is the polynucleotide sequence of BMX Δ N in amplification system, the pcr amplification product that described primer pair amplifies contains the above-mentioned shearing site of described BMX spliced body.
A eighth aspect of the present invention, provide a kind of biochip that can be used for the Yeast Nucleic Acid of the spliced body of detection by quantitative as described in a first aspect of the present invention, described chip comprises solid phase carrier and is positioned at the detection site on described solid phase carrier, and described detection site contains the probe for detecting the polynucleotide described in a second aspect of the present invention specifically.
In another preference, described probe contains the above-mentioned shearing site of described BMX spliced body.
A ninth aspect of the present invention, provides a kind of test kit, and described test kit comprises:
One container and be positioned at described container for measure the BMX spliced body albumen described in a first aspect of the present invention reagent, for detecting the reagent of the polynucleotide described in a second aspect of the present invention or its combination; With
Working instructions.
In another preference, described comprises nucleic acid chip for the reagent detecting the polynucleotide described in second aspect.
In another preference, described reagent is selected from lower group:
The primer of spliced body described in (a) specific amplification or primer pair;
B the nucleic acid molecule of () specificity and described spliced body carries out the probe of hybridizing.
In another preference, described test kit is selected from the sample of lower group for detecting: the neoplasmic tissue sample of human non-small cell lung cancer, human non-small cell lung cancer's clone.
A tenth aspect of the present invention, provides and a kind ofly determines that whether thing to be tested is the method for the material suppressing or promote the BMX spliced body protein-active as described in a first aspect of the present invention, it is characterized in that, comprise step:
A (), in test group, under thing to be tested exists, cultivates lung carcinoma cell; And in negative control group, when existing without described tester and other condition is identical, cultivate described lung carcinoma cell;
B () detects the expression amount A of BMX spliced body mRNA or its albumen described in lung carcinoma cell described in test group; And compare with the expression amount B of BMX spliced body mRNA described in lung carcinoma cell described in control group or its albumen;
Wherein, if described expression amount A is significantly lower than described expression amount B, then represent that described thing to be tested is the material of the BMX spliced body protein-active suppressed as described in a first aspect of the present invention;
If described expression amount A is significantly higher than described expression amount B, then represent that described thing to be tested is the material of the BMX spliced body protein-active promoted as described in a first aspect of the present invention.
In another preference, described " significantly lower than " refer to expression amount A and expression amount B ratio≤0.5, preferably≤0.3, more preferably≤0.2.
In another preference, described " significantly lower than " refer to expression amount A and expression amount B ratio >=2, preferably >=3, more preferably >=4.
In another preference, described method also comprises step (c): for the material of the BMX spliced body protein-active described in the suppression first aspect present invention that previous step identifies, and measures further it to the rejection ability of growth of tumour cell or kill ability to tumour cell.
In another preference, described material to be tested comprises: micromolecular compound, miRNA, siRNA, albumen (as antibody) etc.
In another preference, described screening cell comprises non-small cell lung cancer cell.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Following accompanying drawing for illustration of specific embodiment of the invention scheme, and is not used in the scope of the invention limiting and defined by claims.
Fig. 1 shows the expression level that ExonArray detects each exon of BMX gene.
Fig. 2 shows 5'RACE in conjunction with the improper shearing situation of sequencing technologies qualification BMX.Wherein, each swimming lane is as follows: 1871 and 2491 represent 2 lung cancer sample cDNA for detecting, and all have BMX Δ N positive expression, Neg1 and Neg2 represents two the lung cancer sample cDNA expressed without BMX Δ, as negative control.
Fig. 3 shows RT-PCR and detects the expression of BMX Δ N in lung cancer cell line and cancerous lung tissue.Wherein, Fig. 3 A shows the result that specificity RT-PCR detects BMX Δ N in multiple lung cancer cell line.Fig. 3 B shows specificity RT-PCR carries out detecting BMX Δ N expression of results to clinical lung cancer and the other control tissue sample of cancer.Fig. 3 C shows specificity RT-PCR and detects the result expressing BMX Δ N in 174 routine nonsmall-cell lung cancers.
Wherein, each swimming lane is as follows: in Fig. 3 A, and 1848,5800,5803,5807,5810,5844,5866,5872,5883,5907,5908 represent 11 kinds of different human lung adenocarcinoma cell systems, and 5889 represent mankind's squamous cell lung carcinoma clone.In Fig. 3 B, #1, #2, #3, #4 represent the numbering of 4 lung cancer patients, Neg1 and Neg2 represents without the patient that BMX Δ N expresses in 2 lung cancer samples, and the Ai Pang normal lung tissue of this patient is taken from N representative, and the lung tumor tissue of this patient is taken from T representative.In Fig. 3 C, #5-21 represents the lung cancer sample of 17 lung cancer patients, and neg represents the lung cancer sample of the lung cancer patient of expressing without BMX Δ N.
Fig. 4 shows the expression detecting total BMX control tissue sample by clinical lung cancer and cancer with quantitative Real-timePCR.
Fig. 5 shows BMX Δ N and expresses the propagation and an active non-anchor dependence growth that promote lung cell A549.Wherein, Fig. 5 A show by carrier in lung cancer cell line A549 after transfection total length BMX and BMX Δ N with WesternBlot measure both express result.Fig. 5 B shows the proliferation results of the lung cell A549 after transfected total length BMX and BMX Δ N and not transfected compared with control cells.An active non-anchor that Fig. 5 C and 5D shows the lung cell A549 after transfected total length BMX and BMX Δ N and not transfected compared with control cells relies on growth result.
Fig. 6 shows BMX Δ N and lowers the propagation and an active non-anchor dependence growth that suppress lung carcinoma cell CRL5803.Wherein, Fig. 6 A show realtimePCR detected by respectively transfection two kinds of different shRNA (sh1 and sh2) of target BMX after lung cancer cell line CRL5803 in the mrna expression level of BMX Δ N.Fig. 6 B has shown by difference transfection the growth result of the BMX Δ N in the lung cancer cell line CRL5803 after two kinds of different shRNA (sh1 and sh2) of target BMX.An active non-anchor of the lung cancer cell line CRL5803 after Fig. 6 C and D has shown by difference transfection two kinds of different shRNA (sh1 and sh2) of target BMX relies on growth result.
Fig. 7 shows BMX Δ N and expresses the tolerance situation of raising EGFR sudden change lung carcinoma cell PC9 for Gefitinib.
Embodiment
The present inventor is through extensive and deep research, be surprised to find that first, the improper spliced body of a kind of BMX is there is in Non-small cell lung carcinoma tissue, this improper spliced body is suitable as and detects tumour cell (especially lung carcinoma cell) to the mark (marker) of the drug-resistant intensity of targeting EGFR activated mutant class medicine very much, completes the present invention on this basis.
Particularly, the present inventor adopts high-throughput ExonArray to carry out full-length genome exon expression pattern analysis, detect the expression level of the BMX gene extron of Non-small cell lung carcinoma tissue and Carcinoma side normal tissue sample, and adopt 5'RACE to clone BMX nitrogen end sequence, BMX end sequence is known by order-checking RACE product, further design Specific PCR primers obtains BMX and BMX Δ N product, sequence relatively, bamboo product is for the Specific PCR primers of BMX Δ N, in 300 Non-small cell lung carcinoma tissues and a large amount of control group sample, find that BMX Δ N has expression in the Non-small cell lung carcinoma patient tissue of 12%, by transfection BMX Δ N, for the speed of growth of the lung carcinoma cell after transfected, an active non-anchor growing state and showing in the result of study for the Growth of Cells result under EGFR micromolecular inhibitor Gefitinib different concns, BMX Δ N can be formed and the correlation factor of degree cancer therapy drug resistance as lung carcinoma cell.
Tyrosylprotein kinase BMX (BonemarrowX-linkedkinase) and BMX Δ N
BMX (BonemarrowX-linkedkinase), is also ETK, is non-acceptor class Tyrosylprotein kinase in born of the same parents, participates in many barss transduction pathway and comprises activation STAT3 signal.
The accession number of the nucleotide sequence of the wild-type BMX of the total length of people is 660 (GeneID in NCBIGene), total length is 2530bp (SEQIDNO.:1), its ORF is positioned at 112-2139 position, the accession number of the aminoacid sequence of wild-type BMX is CAA58169.1, total length is 675aa (SEQIDNO.:2), and maturation protein is positioned at 1-675 position, and wherein 7-147 position is PH structural domain, 289-394 position is SH2 structural domain, and 412-667 position is kinase domain.
Research of the present invention shows, in Non-small cell lung carcinoma patient tissue, at least have the improper spliced body BMX Δ N of a kind of BMX of 12% expression.BMX Δ N also has and expresses in multiple lung cancer cell line.BMX Δ N process LAN is relevant with BMX Tot Prot in increase cell, and promotes that proliferation of lung cancer cells and an active non-anchor rely on growth, also with to EGFR micromolecular inhibitor Gefitinib produces the relevant property of resistance.
In addition, research of the present invention shows, compared with wild-type BMX, BMX Δ N of the present invention can promote the formation resistance of tumour cell more significantly, especially for EGFR inhibitor (as Gefitinib etc. replaces Buddhist nun's class medicine).
The Isolation and Identification of BMX Δ N
Present invention also offers the Isolation and Identification method of BMX Δ N.Based on information provided by the present invention, Isolation and Identification BMX Δ N can be carried out conveniently by ordinary method or equipment.
In one particular embodiment of the present invention, described method comprises: carry out full-length genome exon expression pattern analysis by the tumor tissues of 40 routine lung cancer and the other control tissue of 20 routine cancers.Operate according to the Standard Operating Procedure of Affymetrix company HumanExon1.0ST chip, simple process and the mark namely first carrying out RNA sample, then carries out the steps such as follow-up hybridization, wash-out, dyeing and scanning.RMA (RobustMultichipAverage) method is utilized to carry out background correction, stdn (normalization) to the signal of exon probe sets and add up.The relative expression levels of more each exon, finds the breakpoint location that BMX gene is possible, carries out follow-up experimental verification and research.
In another preference of the present invention, to be separated or the method for preparing BMX Δ N comprises step:
(1) tumor tissues of nonsmall-cell lung cancer is collected;
(2) RNA of above-mentioned tumor tissues is extracted;
(3) process and mark the RNA of above-mentioned tumor tissues;
(4) RNA and the HumanExon1.0ST chip hybridization of above-mentioned tumor tissues, wash-out, dyeing and scanning;
(5) correct with the signal of RMA method to Exon probe sets, stdn is with cumulative;
(6) ExonArray analyzes the expression level of each exon of BMX;
(7) BMX nitrogen end sequence is cloned by 5'RACE;
(8) compared the sequence of spliced body by the clone BMX nitrogen end sequence of order-checking 5'RACE gained, design Specific PCR primers is to obtain described BMX spliced body.
Obtain the method for BMX Δ N nucleotide sequence or corresponding complementary sequence
Present invention also offers a kind of method obtaining BMX Δ N nucleotide sequence or corresponding complementary sequence, comprise step:
(1) sample is collected;
(2) RNA of sample is processed;
(3) RNA sample ExonArray step (2) obtained analyzes the expression level of each exon of BMX;
(4) clone the N-terminal sequence of BMX by 5'RACE and check order;
(5) design Specific PCR primers qualification amplification BMX and BMX Δ N product and check order and compare, obtain BMX Δ N sequence and improper shearing site;
(6) design for the Specific PCR primers of amplification BMX Δ N to obtain BMX Δ N sequence product.
In a preference of the present invention, the BMX Δ N described in step (2) is selected from lower group: Non-small cell lung carcinoma tissue.
In another preference, described testing sample comprises: Non-small cell lung carcinoma tissue, cell, organ or its combination.
In another preference, described testing sample is from multiple lung cancer cell line.Testing sample, from people or non-human mammal, is more preferably people.
In the present invention, the method detecting BMX Δ N is not particularly limited, representative from comprising (but being not limited to): ExonArray method, RobustMultichipAverage method, 5'RACE method, RT-PCR method, real-timePCR method, soft-fractrue rock mass method, slow-virus transfection method, cell culture method, in situ hybridization (ISH), constant temperature rolling circle amplification (RCA), (Sanger sequencing) or biochip method.
Chip
Present invention also offers a kind of biochip for detecting BMX Δ N, described chip comprises solid phase carrier and is positioned at the check point on described solid phase carrier, and described check point is used for nucleotide sequence or the complementary sequence that (or catching) specifically detects BMX Δ N or its correspondence.
This chip comprises following component:
Solid phase carrier (as substrate or microballoon) and the oligonucleotide probe be fixed in order on solid phase carrier.
Detection chip of the present invention containing one or more, preferably can contain >=5, more preferably >=10, the check point of best >=20 BMX Δ N.
Described solid phase carrier can adopt the various common used materials in gene chip field, such as but not limited to nylon membrane, and the slide modified through active group (as aldehyde radical, amino etc.) or silicon chip, the slide, plastic sheet etc. of unmodified.Described oligonucleotide probe is biotinylation or is with fluorescently-labeled probe.
The preparation of described BMX Δ N chip can adopt the common manufacturing method of biochip known in the art.Such as, if what solid phase carrier adopted is modify slide or silicon chip, the 5' end of probe is containing amido modified poly-dT string, oligonucleotide probe can be mixed with solution, then point sample instrument is adopted to modify on slide or silicon chip by its point, be arranged in predetermined sequence or array, place and spend the night with fixing, just can obtain BMX Δ N chip of the present invention.
Test kit
Present invention also offers a kind of test kit, this test kit comprises the reagent or chip that measure BMX Δ N;
Wherein, described reagent is selected from lower group:
The primer of BMX Δ N described in (a) specific amplification or primer pair;
B the nucleic acid molecule of () specificity and described BMX Δ N carries out the probe of hybridizing;
Wherein, described chip is nucleic acid chip, and described chip has the check point of the nucleic acid molecule of BMX Δ N described in specific detection.
Due to nothing No. 8 intron sequences in the ripe mRNA sequence of wild-type BMX, therefore specific amplified variable sheer body of the present invention can be carried out with specific binding in the primer of No. 8 intron sequences.
In the present invention, a kind of preferred PCR primer pair comprises the first primer and the second primer, the bond site of described first primer is positioned at No. 8 introns of BMX gene, the bond site of the second primer is positioned at 9 exons of BMX gene, and the length >=150bp of the amplified production that described primer pair amplifies, more preferably, >=250bp, preferably >=400bp.Usually, the length≤1200bp of described amplified production.
Major advantage of the present invention comprises:
(1) BMX Δ N of the present invention can be used for detecting tumour cell (especially lung carcinoma cell) or its growing state.
(2) BMX Δ N of the present invention can be used for the resistance effect detecting tumour cell.
(3) BMX Δ N of the present invention can be used as target spot, for researching and developing new targeted drug and developing new antitumor drug.
(4) BMX Δ N of the present invention can be used as the reference index of reflection clinical EGFR micromolecular inhibitor treatment prognosis situation.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number are weight percent and parts by weight.
Universal method
1. the extraction of cell total rna:
(A) for RNA extract vessel all through going RNase process, glassware and sample loading gun spend RNase reagent RNaseZapTM (RNaseDecontaminationsolution) process; The sterilized water of plastics containing 1/1000DEPC soaks 24 hours, 120 DEG C, 30min autoclaving twice, dries for 60 DEG C; Deionized water adds DEPC process 24 hours by 1/1000, autoclave sterilization;
(B) DEPC water is prepared: the aqua sterilisa taking the DEPC 1000ml of 1g dissolves, 37 DEG C of magnetic stirrer 1h or stirred overnight at room temperature, autoclaving;
(C) take out the cell of due-in lump RNA, discard the substratum in 60mm Tissue Culture Dish, PBS adds 1mlTrizol after washing 2 times, is blown down by cell, and move to 1.5mlEP pipe (DNase and RNase-free), room temperature leaves standstill 5min;
(D) every 1mlTrizol reagent adds 0.2ml chloroform, and vibrate 15 seconds, room temperature leaves standstill 2-3min;
(E) 4 DEG C, 12000g is centrifugal, 15min; Proceeded in new EP pipe by upper strata aqueous phase, add the Virahol of equivalent, mixing, room temperature places 10min, 4 DEG C, the centrifugal 15min of 12000g;
(F) abandon supernatant, add the washing with alcohol RNA precipitation of 1ml75%, 4 DEG C, the centrifugal 5min of 7500g, abandons supernatant, air drying 10min;
(G) add 50 μ l without the water dissolution RNA of RNase, fully dissolve;
(H) 1% agarose gel electrophoresis detects the integrity of total serum IgE, and spectrophotometer detects concentration and the purity of RNA, and after record, packing is frozen in-80 DEG C of preservations;
2.RT (reverse transcription)
(A) often kind of each 2 μ g of cell total rna are got, by following system successively application of sample (volume 15 μ l):
RNA2μg
Random primer 1 μ l
Water (μ l) trim to 15 μ l
(B) put 5min in 70 DEG C of constant temperature PCR instrument, take out immediately afterwards and be placed on ice;
(C) add following mixture 10 μ l/ to manage, operate on ice:
(D) 60min is reacted in 42 DEG C of constant temperature PCR instrument;
4 DEG C of coolings, preserve cDNA for-20 DEG C.
3.RT-PCR
(A) above-mentioned cDNA product sterilized water is diluted 5 times, the cDNA got after 1-2 μ l dilution carries out PCR reaction as template;
(B) reacted constituent is added one by one according to following system:
| 10 × PCR buffer is (containing MgCl 220mM) | 2.5μl |
| DNTP mix (each 10mM) | 2.0μl |
| Primer1(Forward,10μM) | 0.5μl |
| Primer2(Reverse,10μM) | 0.5μl |
| Taq enzyme (5u/ μ l) | 0.3μl |
| cDNA | 1.0μl |
| dd H 2O | 18.2μl |
| Amount to | 25μl |
(C), after adding sample, the centrifugal several seconds, put in PCR instrument and carry out amplified reaction, condition is as follows:
(D) PCR primer electrophoresis: claim 2g agar Icing Sugar to add (sepharose of 2%) in 100ml0.5 × tbe buffer liquid, be heated to be poured on after agarose particle all dissolves in microwave oven on the prior rubber moulding sealed, plug comb, drive bubble away, treat the solid application of sample of gelling after half an hour: 5 μ lPCR product+1 μ l6 × sample-loading buffers; 80V, electrophoresis 20min; Analyze with gel Cheng Xiangyi afterwards, take pictures.
4.Real-timeRT-PCR
(A) cDNA product sterilized water is diluted 100 times, the cDNA got after 1 μ l dilution carries out following reaction as template;
(B) reacted constituent is added one by one according to following system:
| 2×SYBR Green Realtime PCR Master Mix | 10μl |
| Primer1(Forward,10μM) | 0.4μl |
| Primer2(Reverse,10μM) | 0.4μl |
| CDNA (after 1:100 dilution) | 9.2μl |
| Amount to | 20μl |
(C), after adding sample, the centrifugal several seconds, put in ABI-7500fastreal-timePCR instrument and carry out amplified reaction, condition is as follows:
Melting curve (MeltingCurve) is analyzed
(D) interpretation of result: carry out data analysis with the special software AppliedBiosystems of ABI-7500fastreal-timePCR instrument.
Cell strain
Cell strain used is in the present invention cell strain that is commercially available or routine, mainly comprises:
Human lung carcinoma cell lines CRL-1848, CRL-5800, CRL-5803, CRL-5807, CRL-5810, CRL-5844, CRL-5866, CRL-5872, CRL-5883, CRL-5889, CRL-5907, CRL-5908 and A549
Embodiment 15'RACE analyzes the improper shearing site of BMX
5'RACE is according to SMARTer
tMrACEcDNAAmplificationKit (ClontechLaboratoriesInc, MountainView, CA) test kit specification sheets operates.
First, according to RNeasyMiniKit (Qiagen, Hilden, Germany) test kit specification sheets extracting RNA from lung tumor tissue, get 1 μ gRNA subsequently, the 5'RACECDS primer A provided with test kit and SMARTerIIA oligonucleotide carry out reverse transcription; With with RACE universal primer A mixture (UPM) 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3'(SEQI DNO.:5) and the BMX gene specific primer GSP1:5'-GGTTCAAGTCCTTTTCCGTGACTCCTCA-3'(SEQIDNO.:7 of 5'-CTAATACGACTCACTATAGGGC-3'(SEQIDNO.:6) coupling) or GSP2:5'-CCCGAAGTGGTTCAATGGAAGACAGGA-3'(SEQIDNO.:8) carry out PCR reaction, direct Sequencing is carried out to PCR primer, or PCR primer is cloned checks order again after pGEM-T carrier (purchased from Promega company).
Result
The order-checking of mankind's full-length genome exon is carried out to lung cancer clinical sample, finds to express between each exon very polygenic there are differences, comprise BMX gene (see Fig. 1).In these lung cancer samples, found a kind of improper BMX spliced body (being called BMX Δ N below) newly in conjunction with sequencing technologies by 5'RACE, it remains one section of intron sequences at transcriptional level, and has lacked the exon of nitrogen end.
As shown in Figure 2, which show the position that primer GSP1 and GSP2 is corresponding in BMX coding region sequence, and the breaking point position of BMX variable sheer.PCR result shows, the fragment length of universal primer and GSP1 primer amplification is 1177bp, and the fragment length of universal primer and GSP2 primer amplification is 695bp, and in 2 lung cancer samples, the breaking point position of BMX variable sheer is the same; Wherein, swimming lane 1871 and 2491 represents 2 lung cancer sample cDNA for detecting, and all has BMX Δ N positive expression, Neg1 and Neg2 represents two the lung cancer sample cDNA expressed without BMX Δ, as negative control.Sequencing result shows, alternative splicing occurs between No. 8 introns and 9 exons.
Embodiment 2.RNA extracting, RT-PCR and realtimePCR
RevertAidTMFirstStrandcDNASynthesisKit (purchased from American Fermentas company is used in the present embodiment, article No. K1622), SYBRGreenRealtimePCRMasterMix (purchased from American TOYOBO company, article No. TY-QPK-201), the reagent such as Taq enzyme and instrument.
Goal gene primer is as follows:
BMX Δ N (RT-PCR the primer sequence):
Forwardprimer：5'-AGGGTGGGATTTGATATTGCATGG-3'(SEQIDNO.:9)
Reverseprimer：5'-CCAGGGACACAGAGTCGGGGA-3'(SEQIDNO.:10)
BMX Δ N (realtime the primer sequence):
Forwardprimer：5'-CAGTAACCAAAAAGAAAGAAATG-3'(SEQIDNO.:11)
Reverseprimer：5'-TGTGTTGATGATAATGAATAAGC-3'(SEQIDNO.:12)
GAPDH:Forwardprimer：5'-GCGACACCCACTCCTCCACCTTT-3'(SEQIDNO.:13)
Reverseprimer：5'-TGCTGTAGCCAAATTCGTTGTCATA-3'(SEQIDNO.:14)
The expression of BMX Δ N in lung cancer cell line (CRL-1848, CRL-5800, CRL-5803, CRL-5807, CRL-5810, CRL-5844, CRL-5866, CRL-5872, CRL-5883, CRL-5889, CRL-5907, CRL-5908) and cancerous lung tissue is detected with RT-PCR.
Result is as being shown in Fig. 3 A, and shown in 3B and 3C, GAPDH is contrast.In figure 3 a, BMX Δ N all has expression in human non-small cell lung cancer's clone in detected 12.(1848,5800,5803,5807,5810,5844,5866,5872,5883,5907,5908 represent 11 kinds of different human lung adenocarcinoma cell systems, and 5889 represent mankind's squamous cell lung carcinoma clone).
In figure 3b, BMX Δ N all has expression in the lung tumor tissue of 4 lung cancer patients, without expressing in the other lung healthy tissues of cancer.(#1, #2, #3, #4 represent the numbering of 4 lung cancer patients, Neg1 and Neg2 represents without the patient that BMX Δ N expresses in 2 lung cancer samples, and the Ai Pang normal lung tissue of this patient is taken from N representative, and the lung tumor tissue of this patient is taken from T representative.)。
In fig. 3 c, BMX Δ N all has expression in the cancerous lung tissue of detected other 17 lung cancer patients.(#5-21 represents the lung cancer sample of 17 lung cancer patients, and neg represents the lung cancer sample of the lung cancer patient of expressing without BMX Δ N.)
In the clinical lung cancerous tissue sample that BMX Δ N is positive, find that the expression level of total BMX albumen is significantly higher than the clinical lung cancerous tissue sample (Fig. 4) of BMX Δ N feminine gender in these cells by quantitative real-timePCR.
Embodiment 3. cell proliferation experiment
In the present embodiment, pack slow virus with control group plasmid pCDH-CopGFP and the plasmid of expressing BMX and BMX Δ N two kinds of albumen respectively and infect A549 cell; Pack slow virus with the plasmid of the shRNA of control group plasmid pLKO.1-puro and expression target BMX and infect CRL-5803 cell.
Normal culturing cell, when Growth of Cells is to logarithmic phase, digestion is re-suspended cell also, and adjustment concentration of cell suspension is 7500cells/ml, and every hole adds the bed board that 200 μ l cell suspensions carry out 96 orifice plates, often organizes cell and does 5 multiple holes, inoculate 4 ~ 6 piece of 96 orifice plate altogether;
Cell is placed in 37 DEG C, 5%CO
2incubator is cultivated, and carries out first time MTT and detect and be designated as the 0th day after 12h, detects once later, collect the data of 4 ~ 5 days altogether every 24h;
During detection, every hole adds 20 μ lMTT solution, 37 DEG C hatch 4 hours after, exhaust supernatant with vacuum pump, every hole adds 100 μ lDMSO dissolve purple crystallizations, and shaken at room temperature is until fully dissolve;
Microplate reader detects the light absorption value at 570nm wavelength place, using 630nm as reference wavelength;
According to the light absorption value recorded, with the light absorption value of the 0th day for the relative light absorption value of benchmark, and be the relative light absorption value of X-coordinate with incubation time be ordinate zou, draw the growth curve often organizing cell.
Result
Express respectively in lung cancer cell line A549 by the carrier (pCDH-CMV-EF1-CopGFP) carrying total length wild-type BMX and BMX Δ N sequence, transfection has the cell of empty carrier for contrast.Fig. 5 A shows wild-type BMX and BMX Δ N protein all has expression in A549 clone.Meanwhile, BMX and BMX Δ N can improve the multiplication capacity (Fig. 5 B) of A549 cell.
Two of target BMX kinds of different sh1RNA and sh2RNA are expressed in lung cancer cell line CRL-5803, two kinds of shRNA significantly lower the mRNA level in-site (see Fig. 6 A) of endogenous BMX Δ N, and two kinds of shRNA effectively can suppress the external competence for added value (Fig. 6 B) of CRL-5803 clone.
BMXsh1_ forward sequence:
5'-CCGGGAGTGCTGATAAGAATGAATACTCGAGTATTCATTCTTATCAGCACTCTTTTTG-3'(SEQIDNO.:15)
BMXsh1_ reverse sequence:
5'-AATTCAAAAAGAGTGCTGATAAGAATGAATACTCGAGTATTCATTCTTATCAGCACTC-3'(SEQIDNO.:16)
Target sequence:
GAGTGCTGATAAGAATGAATA(SEQIDNO.:17)
BMXsh2_ forward sequence:
5'-CCGGCCATTGAACCACTTCGGGAAACTCGAGTTTCCCGAAGTGGTTCAATGGTTTTTG-3'(SEQIDNO.:18)
BMXsh2_ reverse sequence:
5'-AATTCAAAAACCATTGAACCACTTCGGGAAACTCGAGTTTCCCGAAGTGGTTCAATGG-3'(SEQIDNO.:19)
Target sequence:
CCATTGAACCACTTCGGGAAA(SEQIDNO.:20)
Embodiment 4. soft-fractrue rock mass is tested
At the present embodiment, tested by soft-fractrue rock mass, rely on energy for growth for an active non-anchor analyzing tumour cell.Method is as follows:
1) 3% low melting-point agarose (Agarose) is prepared: with 1 × PBS preparation, after autoclaving, be cooled to 39 DEG C, be placed in 39 DEG C of water-baths and be incubated, prevent from solidifying;
2) 1% lower floor's glue bed board: the perfect medium (37 DEG C of preheatings) getting 2 times of volumes dilutes the final concentration of the low melting-point agarose to 1% of 3%, as: 3% low melting-point agarose of 9ml perfect medium+4.5ml, abundant mixing, the low melting-point agarose of 2ml1% is added in each hole in 6 orifice plates, room temperature leaves standstill 15min, treats that it naturally cools to and solidifies;
3) preparation of 0.8% upper strata glue: the upper strata glue prepared is placed in 39 DEG C of water-baths and is incubated, and prevents from solidifying.Fill a prescription as follows:
4) preparation of experimental cell: the cell of 0.125% trysinization logarithmic phase, centrifugal and cell is counted, the density of suspension cell is diluted to 5 × 10
3/ ml;
5) celliferous upper strata glue mixed solution is prepared: by 0.8%Ag/Media and above-mentioned cell suspension (5 × 10
3/ ml) mix by the volume ratio of 1:1, blow even;
6) repopulating cell: celliferous upper strata glue mixed solution is planted on 1% lower floor's glue, each hole of 6 orifice plates adds 2ml mixed solution, is placed in 4 DEG C of cooling 10min, solid to the gelling of celliferous upper strata, rear each hole adds 2ml perfect medium, is placed in 37 DEG C of cell culture incubators and cultivates;
7) observation is taken pictures: cultivate 10 ~ 14 days, observes colony in soft agar and occurs date and growing state, Taking Pictures recording;
8) violet staining: after 2 weeks, discards the perfect medium in hole, dyes 2 hours, use ddH afterwards on decolorization swinging table by 0.005% crystal violet solution room temperature
2o rinsing 6 times, each 5min;
9) statistical study: take pictures, with ImageJ software statistics clone number, carries out data analysis.
Result
Express respectively in lung cancer cell line A549 by the carrier (pCDH-CMV-EF1-CopGFP) carrying total length wild-type BMX and BMX Δ N sequence, transfection has the cell of empty carrier for contrast.An active non-anchor that the process LAN of external soft agar assay display BMX and BMX Δ N in lung cancer cell types can increase cell relies on energy for growth, and wherein the process LAN of BMX Δ N relies on energy for growth stronger (see Fig. 5 C and Fig. 5 D) relative to the process LAN of BMX to an active non-anchor increasing A549 cell strain.
Two of target BMX kinds of different sh1RNA and sh2RNA are expressed in lung cancer cell line CRL-5803.The downward of external soft agar assay display BMX Δ N significantly suppress an active non-anchor dependence energy for growth (Fig. 6 C and 6D) of CRL-5803 cell strain.
Embodiment 5. detects the tolerance of cell for medicine
In the present embodiment, BMX Δ N positive cell is studied to the tolerance of medicine.Wherein, express respectively in the lung cancer cell line PC9 suddenlyd change with EGFR activated form by the carrier carrying total length wild-type BMX and BMX Δ N sequence, transfection has the cell of empty carrier for contrast.The tolerance degree of PC9 cell for EGFR micromolecular inhibitor Gefitinib is detected by cell survival experiment.Method is as follows:
1) pack slow virus with control group plasmid pCDH-CopGFP (purchased from SystemBiosciences (SBI) company) and the plasmid of expressing BMX and BMX Δ N two kinds of albumen respectively and infect PC9 cell (purchased from ATCC company);
2) normal culturing cell, when Growth of Cells is to logarithmic phase, digestion is re-suspended cell also, and adjustment concentration of cell suspension is 7500 cells/ml, and every hole adds the bed board that 200 μ l cell suspensions carry out 96 orifice plates; A series of different drug concentration gradient is set, often organizes each drug level of cell and do 5 multiple holes;
3) cell is placed in 37 DEG C, 5%CO
2incubator is cultivated, and adds the Pei Ji containing respective concentration medicine after 24h; Cultivate 72h;
4) detect time every hole add 20 μ lMTT solution, 37 DEG C hatch 4 hours after, exhaust supernatant with vacuum pump, every hole adds 100 μ lDMSO dissolve purple crystallizations, and shaken at room temperature is until fully dissolve;
5) microplate reader detects the light absorption value at 570nm wavelength place, using 630nm as reference wavelength;
6) according to the light absorption value that records, take drug level as the light absorption value of zero be the relative light absorption value of benchmark, and be the relative light absorption value of X-coordinate with gradient drug concentration be ordinate zou curve plotting.
Result
As shown in Figure 7, MTT (cell survival and growth detection method) result display, along with the increase of Gefitinib concentration, the PC9 cell of process LAN BMX Δ N demonstrates the tolerance (Fig. 7) stronger to Gefitinib, this demonstrates BMX Δ N expression and improves the tolerance of EGFR sudden change lung carcinoma cell PC9 for Gefitinib.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. a BMX spliced body albumen, is characterized in that, the N end of described spliced body protein delation wild-type BMX, only retains C and holds kinases territory;
Preferably, the 1-383 position of described spliced body protein delation wild-type BMX aminoacid sequence.
2. polynucleotide, is characterized in that, the spliced body albumen of described polynucleotide encoding BMX according to claim 1.
3. polynucleotide as claimed in claim 2, it is characterized in that, the nucleotide sequence of described polynucleotide is as shown in SEQIDNO.:3.
4. a carrier, is characterized in that, it is containing, for example polynucleotide according to claim 2.
5. a genetically engineered host cell, is characterized in that, it comprises in carrier according to claim 4 or genome and is integrated with polynucleotide according to claim 2.
6. prepare a method for spliced body albumen as claimed in claim 1, it is characterized in that, comprise step:
A (), in the condition of applicable expression, cultivates genetically engineered host cell according to claim 5, thus express BMX spliced body albumen according to claim 1; With
BMX spliced body albumen described in (b) isolated or purified.
7. a purposes for spliced body albumen as claimed in claim 1 or polynucleotide according to claim 2, is characterized in that, (a) is for the preparation of the reagent or the test kit that detect cancer susceptibility and/or cancer cell resistance; Or (b) is for screening the inhibitor suppressing BMX Δ N, described inhibitor specificity or Selective depression BMX Δ N.
8. the PCR primer pair for increase polynucleotide as claimed in claim 2 or its fragment, it is characterized in that, described PCR primer pair comprises the first primer and the second primer, the bond site of described first primer is positioned at No. 8 introns of BMX gene, the bond site of the second primer is positioned at 9 exons of BMX gene, and the length >=150bp of amplified production that described primer pair amplifies.
9. a test kit, is characterized in that, described test kit comprises:
One container and be positioned at described container for measuring the reagent of BMX spliced body albumen according to claim 1, the reagent requiring the polynucleotide described in 2 for test right or its combination; With
Working instructions.
10. determine that whether thing to be tested is a method for the material suppressing or promote BMX spliced body protein-active as claimed in claim 1, it is characterized in that, comprise step:
A (), in test group, under thing to be tested exists, cultivates lung carcinoma cell; And in negative control group, when existing without described tester and other condition is identical, cultivate described lung carcinoma cell;
B () detects the expression amount A of BMX spliced body mRNA or its albumen described in lung carcinoma cell described in test group; And compare with the expression amount B of BMX spliced body mRNA described in lung carcinoma cell described in control group or its albumen;
Wherein, if described expression amount A is significantly lower than described expression amount B, then represent that described thing to be tested is the material suppressing BMX spliced body protein-active as claimed in claim 1;
If described expression amount A is significantly higher than described expression amount B, then represent that described thing to be tested is the material promoting BMX spliced body protein-active as claimed in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410432181.5A CN105441405B (en) | 2014-08-28 | 2014-08-28 | BMX spliced body and its application in drug resistance of lung cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410432181.5A CN105441405B (en) | 2014-08-28 | 2014-08-28 | BMX spliced body and its application in drug resistance of lung cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105441405A true CN105441405A (en) | 2016-03-30 |
| CN105441405B CN105441405B (en) | 2019-06-18 |
Family
ID=55552043
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410432181.5A Active CN105441405B (en) | 2014-08-28 | 2014-08-28 | BMX spliced body and its application in drug resistance of lung cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105441405B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106928337A (en) * | 2017-04-11 | 2017-07-07 | 南华大学 | BMX spliced bodies and its application in drug resistance of lung cancer |
| CN113736812A (en) * | 2021-09-06 | 2021-12-03 | 武汉翼康基因科技有限公司 | PcMINI vector and construction method and application thereof |
| CN114317485A (en) * | 2021-12-30 | 2022-04-12 | 南京巨匠生物科技有限公司 | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995029185A1 (en) * | 1994-04-22 | 1995-11-02 | Sugen, Inc. | Novel megakaryocytic protein tyrosine kinases |
| CN101437822A (en) * | 2006-05-11 | 2009-05-20 | Irm责任有限公司 | Compounds and compositions as protein kinase inhibitors |
-
2014
- 2014-08-28 CN CN201410432181.5A patent/CN105441405B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995029185A1 (en) * | 1994-04-22 | 1995-11-02 | Sugen, Inc. | Novel megakaryocytic protein tyrosine kinases |
| CN101437822A (en) * | 2006-05-11 | 2009-05-20 | Irm责任有限公司 | Compounds and compositions as protein kinase inhibitors |
Non-Patent Citations (8)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106928337A (en) * | 2017-04-11 | 2017-07-07 | 南华大学 | BMX spliced bodies and its application in drug resistance of lung cancer |
| CN113736812A (en) * | 2021-09-06 | 2021-12-03 | 武汉翼康基因科技有限公司 | PcMINI vector and construction method and application thereof |
| CN114317485A (en) * | 2021-12-30 | 2022-04-12 | 南京巨匠生物科技有限公司 | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105441405B (en) | 2019-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102575295B (en) | Can be used for the method for detection BRAF sudden change, primer, probe and test kit | |
| CN109890394A (en) | The Microrna of biomarker as endometriosis | |
| CN105524924B (en) | Cyclic RNA circ-ZKSCAN1 use | |
| CN103146688A (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
| CN106222170A (en) | Circular rna circ CCNY and application thereof | |
| CN106995858A (en) | A kind of lncRNA related to liver cancer diagnosis and treatment | |
| CN107739753A (en) | The detection reagent that Pygo2 genes R46S is mutated in Wnt signal paths based on peptide nucleic acid probe | |
| CN108753969A (en) | Application of the long-chain non-coding RNA in hepatocellular carcinoma diagnosis and treatment | |
| CN108374048A (en) | A kind of lncRNA markers for diagnosing and treating hepatocellular carcinoma | |
| CN109593848A (en) | A kind of tumour correlated series, long-chain non-coding RNA and its application | |
| CN106967719B (en) | Application of long-chain non-coding RNA as prostate cancer molecular marker | |
| CN105219881A (en) | The test kit of a kind of detection by quantitative ERCC1-202 and application | |
| CN105441405A (en) | A BMX spliceosome and applications thereof in lung cancer drug resistance | |
| CN107586850A (en) | Application of the Noncoding gene in liver cancer diagnosis and treatment | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| CN108085389B (en) | LncRNA related to breast cancer and application thereof | |
| CN105624325B (en) | The diagnosis and treatment marker of adenocarcinoma of lung | |
| CN114438207B (en) | Annular RNA biomarker for breast cancer and application thereof | |
| CN105950720A (en) | Beta-catenin gene mutation detection reagent in Wnt signal path and applications of beta-catenin gene mutation detection reagent | |
| CN108660211A (en) | A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application | |
| CN106520776B (en) | A kind of breast cancer kit for screening | |
| CN109628594A (en) | One kind long-chain non-coding RNA relevant to liver cancer and its application | |
| CN107828871A (en) | The detection reagent that FoxM1 genes P271Q is mutated in Wnt signal paths based on peptide nucleic acid probe | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN108707672A (en) | Applications of the DUXAP8 in diagnosis of hepatoma and treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200908 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |