CN114317485A - Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application - Google Patents
Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application Download PDFInfo
- Publication number
- CN114317485A CN114317485A CN202111651558.2A CN202111651558A CN114317485A CN 114317485 A CN114317485 A CN 114317485A CN 202111651558 A CN202111651558 A CN 202111651558A CN 114317485 A CN114317485 A CN 114317485A
- Authority
- CN
- China
- Prior art keywords
- leu
- mutant
- ala
- reverse transcriptase
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to the technical field of biology, in particular to a recombinant murine leukemia virus reverse transcriptase mutant, a preparation method and application thereof. The recombinant murine leukemia virus reverse transcriptase mutant provided by the invention improves the thermal stability of the wild type recombinant murine leukemia virus reverse transcriptase by carrying out point mutation molecular modification on the enzyme, and simultaneously improves the reverse transcription efficiency of the product and the reverse transcription capability of long-fragment cDNA. In addition, the invention also provides a recombinant expression vector capable of expressing the mutant, and the recombinant expression vector can efficiently express the mutant after being transformed into escherichia coli.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a recombinant murine leukemia virus reverse transcriptase mutant, a preparation method and application thereof.
Background
Reverse transcriptase (Reverse transcriptase) is an enzyme that directs deoxynucleotide triphosphate synthesis of complementary dna (cdna) using RNA as a template. Reverse transcriptase (M-MLV) was isolated from Moloney Murine Leukemia Virus and has been genetically altered to remove its associated ribonuclease H activity (an enzyme that specifically cleaves RNA molecules on hybridized strands of DNA and RNA) and used for first strand synthesis of cDNA and primer extension. The enzyme needs magnesium ions or manganese ions as auxiliary factors, when mRNA is taken as a template, single-stranded DNA (ssDNA) is firstly synthesized, then double-stranded DNA (dsDNA) in a hairpin type is synthesized by taking the single-stranded DNA as the template under the action of reverse transcriptase and DNA polymerase I, and then nuclease S1 cuts the double-stranded DNA into two single strands.
Thus, reverse transcriptase can be used to reverse transcribe the mRNA of any gene into a cDNA copy, and the cDNA inserted into the vector can then be amplified in large quantities. The cDNA can also be labeled as a radioactive molecular probe. M-MLV reverse transcriptase is currently used for first strand cDNA synthesis, cDNA probe generation, RNA transcription, sequencing and RNA reverse transcription reactions. The enzyme deletes RNaseH activity by point mutation, has the same activity as wild type DNA polymerase and obviously improves the extending capability.
However, the current wild-type reverse transcriptase lacking RNaseH activity still has certain defects, mainly manifested by poor reverse transcription capability for large-fragment cDNA and poor thermostability.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a novel recombinant murine leukemia virus reverse transcriptase mutant, so that the mutant can solve the technical problems of poor reverse transcription capability and thermal stability of reverse transcriptase M-MLV on large-fragment cDNA in the prior art.
It is another object of the present invention to provide a biomaterial capable of encoding the above mutant and a method for preparing the above mutant using the biomaterial, which enables mass production of the above mutant product having purity and activity meeting market requirements.
The present invention also aims at applying the obtained mutant product in reverse PCR of new coronavirus SARS-CoV-2 or preparing product for reverse PCR of new coronavirus SARS-CoV-2 to provide sufficient technological support for medicine development, medicine screening and scientific research of new coronavirus SARS-CoV-2.
In order to solve the technical problems and achieve the purpose, the invention provides the following technical scheme:
in a first aspect, the present invention provides a recombinant murine leukemia virus reverse transcriptase mutant, said mutant being obtained by the replacement of at least one amino acid residue with a wild-type recombinant murine leukemia virus reverse transcriptase having the amino acid sequence as depicted in SEQ ID No. 1.
In an alternative embodiment, the mutant has the amino acid sequence as set forth in SEQ ID No. 2.
In a second aspect, the present invention provides a biomaterial comprising any one of:
a nucleic acid molecule encoding a mutant according to any one of the preceding embodiments;
(ii) a recombinant vector comprising (i) said nucleic acid molecule, said recombinant vector having as its origin pET22 b;
(iii) a transformant comprising (i) said nucleic acid molecule or (ii) said recombinant vector, said transformant host being selected from the group consisting of E.coli.
In alternative embodiments, the e.coli is selected from e.coli Rosetta or e.coli BL 21.
In a third aspect, the present invention provides a method for preparing a mutant according to any one of the preceding embodiments, comprising constructing a recombinant expression vector of wild-type recombinant murine leukemia virus reverse transcriptase, amplifying to obtain a linear recombinant expression vector DNA, subjecting the linear recombinant expression vector DNA to site-specific mutagenesis, cyclizing with a homologous recombinase to obtain a recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase, transforming the recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase into host bacteria, fermenting and culturing, disrupting the bacterial cells, and collecting the mutant recombinant murine leukemia virus reverse transcriptase.
In an alternative embodiment, two site-directed mutagenesis is performed using two sets of primer pairs, wherein the nucleotide sequence of the forward primer of the first primer pair is set forth in SEQ ID No.3 and the nucleotide sequence of the reverse primer is set forth in SEQ ID No. 4; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID No.5, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 6.
In an alternative embodiment, the nucleotide sequence of the forward primer used for said amplification is shown as SEQ ID No.7 and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 8.
In an alternative embodiment, the original vector of the recombinant expression vector is pET22 b.
In an alternative embodiment, the homologous recombinase is UvsXase and the host bacterium is selected from e.coli Rosetta or e.coli BL 21.
In a fourth aspect, the present invention provides the use of a mutant according to any one of the preceding embodiments in a SARS-CoV-2 virus qPCR, or in the preparation of a SARS-CoV-2 virus qPCR product.
In an alternative embodiment, the SARS-CoV-2 virus qPCR product comprises a positive primer having a nucleotide sequence as shown in SEQ ID No.9 and a negative primer having a nucleotide sequence as shown in SEQ ID No. 10.
The recombinant murine leukemia virus reverse transcriptase mutant provided by the invention realizes the improvement of the thermal stability of the mutant by carrying out point mutation molecular modification on the wild type recombinant murine leukemia virus reverse transcriptase, and also improves the reverse transcription efficiency of the product and the reverse transcription capability of long-fragment cDNA. In addition, the invention also provides a recombinant expression vector capable of expressing the mutant, and the recombinant expression vector can efficiently express the mutant after being transformed into escherichia coli.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a schematic diagram showing mutation sites of mutant M-MLV provided in example 1 of the present invention;
FIG. 2 shows the results of PCR experiments for M-MLV point mutation in example 1 of the present invention;
FIG. 3 is SDS-PAGE results of mutant M-MLVs expressed in examples 2 and 3 of the present invention;
FIG. 4 shows the reverse transcription cDNA yields under different temperature conditions in Experimental example 1 of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. The components of embodiments of the present invention generally described and illustrated in the figures herein may be arranged and designed in a wide variety of different configurations.
Thus, the following detailed description of the embodiments of the present invention, presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
It should be noted that: like reference numbers and letters refer to like items in the following figures, and thus, once an item is defined in one figure, it need not be further defined and explained in subsequent figures.
In a particular embodiment, in a first aspect, the present invention provides a recombinant murine leukemia virus reverse transcriptase mutant, said mutant being obtained by substitution of at least one amino acid residue of a wild-type recombinant murine leukemia virus reverse transcriptase having the amino acid sequence as depicted in SEQ ID No. 1.
It is to be understood that the wild-type recombinant murine leukemia virus reverse transcriptase of the present invention includes naturally expressed reverse transcriptase of recombinant murine leukemia virus, and may also include reverse transcriptase obtained by modifying the prior art for other defects of the wild-type recombinant murine leukemia virus reverse transcriptase different from the modification of the object of the present invention, for example, amino acid sequence obtained by simple mutation in the prior art for losing RNase activity of the wild-type recombinant murine leukemia virus reverse transcriptase, may be used as the modified material of the present invention because it does not affect the thermostability and reverse transcription ability of the long fragment of the wild-type recombinant murine leukemia virus reverse transcriptase, and should be considered to be included in the wild-type recombinant murine leukemia virus reverse transcriptase of the present invention. The above-described SEQ ID No.1 of the present invention should be understood as an example only, and therefore, the open-ended writing manner adopted should be acceptable.
Meanwhile, the substitution of at least one amino acid residue in the present invention refers to the substitution of amino acid residues for the purpose of improving the thermal stability and reverse transcription ability of the recombinant murine leukemia virus reverse transcriptase, and any amino acid point mutation that can achieve the above functions is within the scope of the present invention.
In an alternative embodiment, the mutant has the amino acid sequence as set forth in SEQ ID No. 2.
It should be understood that the number of point mutations that can improve the thermostability and the reverse transcription ability of the recombinant murine leukemia virus reverse transcriptase is enormous and not exhaustive, and as an example, the present invention provides a combination of point mutations represented by G55A and F189L in the amino acid sequence shown in SEQ ID No. 2.
In a second aspect, the present invention provides a biomaterial comprising any one of:
a nucleic acid molecule encoding a mutant according to any one of the preceding embodiments;
(ii) a recombinant vector comprising (i) said nucleic acid molecule, said recombinant vector having as its origin pET22 b;
(iii) a transformant comprising (i) said nucleic acid molecule or (ii) said recombinant vector, said transformant host being selected from the group consisting of E.coli.
In alternative embodiments, the e.coli is selected from e.coli Rosetta or e.coli BL 21.
It is understood that the sequence of the above-mentioned nucleic acid molecule is not limited to one due to the correspondence between the amino acid residues of the base codons, and all nucleic acid molecules capable of encoding the above-mentioned mutants are understood as the scope of protection of the above-mentioned nucleic acid molecules.
In order to obtain the mutant, the three-dimensional structure of the obtained wild type recombinant M-MLV is analyzed through a homologous model, and then the site-directed mutation is carried out on the recombined wild type M-MLV through a point mutation technology. Then, a proper vector is selected to construct to obtain a recombinant vector mutant, and finally, the correctly mutated recombinant expression vector is transformed into escherichia coli for protein expression.
In a third aspect, the present invention provides a method for preparing a mutant according to any one of the preceding embodiments, comprising constructing a recombinant expression vector of wild-type recombinant murine leukemia virus reverse transcriptase, amplifying the recombinant expression vector to obtain a linear recombinant expression vector DNA, subjecting the linear recombinant expression vector DNA to site-specific mutagenesis, cyclizing the site-specific mutagenesis using a homologous recombinase to obtain a recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase, transforming the recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase into host bacteria, fermenting and culturing the host bacteria, disrupting the bacterial cells, and collecting the mutant recombinant murine leukemia virus reverse transcriptase.
In an alternative embodiment, two site-directed mutagenesis is performed using two sets of primer pairs, wherein the nucleotide sequence of the forward primer of the first primer pair is set forth in SEQ ID No.3 and the nucleotide sequence of the reverse primer is set forth in SEQ ID No. 4; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID No.5, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 6.
In an alternative embodiment, the nucleotide sequence of the forward primer used for said amplification is shown as SEQ ID No.7 and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 8.
In an alternative embodiment, the original vector of the recombinant expression vector is pET22 b.
In an alternative embodiment, the homologous recombinase is UvsXase and the host bacterium is selected from e.coli Rosetta or e.coli BL 21.
In a fourth aspect, the present invention provides the use of a mutant according to any one of the preceding embodiments in a SARS-CoV-2 virus qPCR, or in the preparation of a SARS-CoV-2 virus qPCR product.
In an alternative embodiment, the SARS-CoV-2 virus qPCR product comprises a positive primer having a nucleotide sequence as shown in SEQ ID No.9 and a negative primer having a nucleotide sequence as shown in SEQ ID No. 10.
Some embodiments of the invention are described in detail below with reference to the accompanying drawings. The embodiments described below and the features of the embodiments can be combined with each other without conflict.
Example 1
The three-dimensional structure of the wild type recombinant M-MLV is simulated, the amino acid sequence of the wild type recombinant M-MLV is shown as SEQID No.1, and two mutation points are determined to be G55A and F189L. And the recombinant expression vector formed by the mutated recombinant M-MLV mutant and the vector pET22b is transformed into escherichia coli, and then positive escherichia coli is obtained by screening and used for the expression of the recombinant M-MLV mutant, and the specific steps are as follows:
(1) the amino acid sequence of the wild type recombinant M-MLV is modeled by Swiss-Model software to obtain the three-dimensional structure, and two mutation target sites of G55A and F189L are determined, wherein the point mutation sites are shown in FIG. 1.
(2) Cloning the recombinant M-MLV nucleic acid sequence by using a site-directed Mutagenesis Kit (CloneUFO Fast Mutagenesis Kit) of Nanjing Jumbo Biotech Co., Ltd, amplifying DNA of a wild-type recombinant M-MLV expression vector pET-22b (+)/M-MLV according to the instruction to obtain a linear form recombinant expression vector DNA, and cyclizing by using a homologous recombinase UvsXase (Nanjing Jumbo Biotech Co., Ltd) to obtain a complete mutant reverse transcriptase recombinant expression vector. Samples were made using the following set of site-directed mutagenesis primer sets (1) to mutate Gly at position 55 to Ala (SEQ ID No.3 and SEQ ID No.4), and sample (2) to mutate Gly at position 55 to Ala (SEQ ID No.3 and SEQ ID No.4) while mutating Phe at position 189 to Leu (SEQ ID No.5 and SEQ ID No. 6). The PCR cloning conditions were: 94 ℃ for 5min, 95 ℃ for 15s, 58 ℃ for 15s, 72 ℃ for 2min, 72 ℃ for 10min, 10 ℃ infinity. The gel electrophoresis result of the PCR product is shown in FIG. 2, and it is seen from FIG. 2 that the size of the bands obtained by gel electrophoresis of the PCR product is equal before and after the point mutation of G55A alone in the sample (1) and the point mutation of G55A and F189L simultaneously in the sample (2), which proves that the size of the mutant linear vector obtained by PCR is correct.
TABLE 1 primer pairs for point mutations in example 1
Example 2
In this example, the recombinant expression vector of mutant reverse transcriptase obtained in example 1 was transformed into E.coli Rosetta to obtain transformed strain Mut-1/E.coli Rosetta, which was inoculated into 20mL LB liquid medium containing 100mg/mL ampicillin and shake-cultured at 37 ℃ and 220rpm for 12 hours to obtain a seed solution. 100 mul of seed liquid is inoculated into 100mL LB liquid culture medium containing 100mg/mL ampicillin, shake culture is carried out at 37 ℃ and 220rpm until the thallus concentration of the fermentation liquid reaches OD600 to 0.6, IPTG is added to 100mg/mL, and low-temperature induction expression is carried out at 16 ℃ and 180rpm for 16 h.
Then, the collected cells were subjected to inducible expression, resuspended in phosphate buffer (50mmol/L PBS +0.3mol/L NaCl + 0.5% Triton X-100), disrupted in a cell homogenizer (700bar 5min), centrifuged at 4 ℃ and 9000rpm for 10min, and the supernatant was collected as a crude enzyme solution. And (3) eluting the crude enzyme solution obtained by treatment with an eluent containing imidazole with different concentrations (50mmol/L, 100mmol/L, 150mmol/L and 200mmol/L) in sequence according to the specification of the Ni-NTA His Tag Kit, and collecting elution peaks to obtain the mutant recombinant murine leukemia virus reverse transcriptase.
Example 3
This example also provides a method for preparing a mutant recombinant murine leukemia virus reverse transcriptase, which differs from example 2 only in that E.coli Rosetta is replaced with E.coli BL 21.
The result of the mutant recombinant murine leukemia virus reverse transcriptase expressed by E.coli Rosetta or E.coli BL21 provided by the invention is shown in FIG. 3, and the expression level of E.coli Rosetta is higher than that of E.coli BL 21.
Experimental example 1
This experiment example examined the effect of temperature on the effect of the mutant recombinant murine leukemia virus reverse transcriptase and the wild-type recombinant murine leukemia virus reverse transcriptase obtained in example 2 on the cDNA obtained by reverse transcription of the novel coronavirus SARS-CoV-2 RNA.
(1) The extraction method of RNA comprises the following steps: ATGPure of Biotechnology Ltd of Nanjing JudgeTMRNA was extracted from a commercially available sample of a novel coronavirus by using the Virus RNA Extraction Kit (Column) (RV301) Kit method.
(2) After the obtained RNA was passed through the purity and concentration test, cDNA was obtained by reverse transcription using the mutant recombinant murine leukemia virus reverse transcriptase obtained in example 2 and the wild-type recombinant murine leukemia virus reverse transcriptase under the following conditions:
preparing the following mixed solution in an RNase-free centrifuge tube:
the experiment requires adding RNase inhibitor, and ATG from Nanjing giant organism science and technology Limited can be selectedTMRnasin(ATG#RC102)。
The procedure was as follows:
then, 10. mu.l of the obtained cDNA sample was subjected to 1% agarose nucleic acid electrophoresis together with a cDNA sample obtained using wild-type M-MLV (amino acid sequence shown in SEQ ID No. 1). The cDNA yields obtained by reverse transcription are shown in FIG. 4, which shows that the cDNA synthesis yields of the mutants are higher than those of the wild type at different reaction temperatures and that they are efficiently amplified at 65 ℃.
Experimental example 2
In this experimental example, the effect of cDNA obtained by reverse transcription of the mutant recombinant murine leukemia virus reverse transcriptase and the wild-type recombinant murine leukemia virus reverse transcriptase obtained in example 2 for fluorescent quantitative qPCR reaction was examined, and the detection was performed by using commercially available N gene of a novel coronavirus as a detection target according to the following steps:
reverse transcription at different temperatures to obtain cDNA template, and using N gene primers N-F and N-R of new coronavirus according to ATGStart of Biotech Co., Ltd of KyotoTMThe Plus qPCR SYBR Green Master Mix (Q111) method was used for qPCR experiments.
New crown N gene primer:
N-F：CAGTAGGGGAACTTCTCCTGCTAGAATGGCTGG(SEQ ID No.7)；
N-R：CCTTTACCAGACATTTTGCTCTCAAGCTGG(SEQ ID No.8)；
the reaction Buffer was configured as follows:
qPCR experimental procedure was as follows:
the qPCR amplification results were as follows:
the qPCR result shows that the mutant has lower Ct value and higher detection sensitivity at the same temperature compared with the wild type, and the template can still be detected at the high temperature of 65 ℃, which indicates that the mutant reverse transcriptase has better heat resistance.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Nanjing Judge Biotech Co., Ltd
<120> recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 716
<212> PRT
<213> Moloney murine Leukemia virus
<400> 1
Met Gly Gly Ser His His His His His His Gly Met Ala Ser Met Thr
1 5 10 15
Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His
20 25 30
Met Thr Leu Asn Ile Glu Asp Glu Tyr Arg Leu His Glu Thr Ser Lys
35 40 45
Glu Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser Asp Phe Pro Gln
50 55 60
Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg Gln Ala Pro
65 70 75 80
Leu Ile Ile Leu Leu Lys Ala Thr Ser Thr Pro Val Ser Ile Lys Gln
85 90 95
Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys Pro His Ile Gln
100 105 110
Arg Leu Leu Asp Gln Gly Ile Leu Val Pro Cys Gln Ser Pro Trp Asn
115 120 125
Thr Pro Leu Leu Pro Val Lys Lys Pro Gly Thr Asn Asp Tyr Arg Pro
130 135 140
Val Gln Asp Leu Arg Glu Val Asn Lys Arg Val Glu Asp Ile His Pro
145 150 155 160
Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His
165 170 175
Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe Cys Leu Arg
180 185 190
Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp Arg Asp Pro
195 200 205
Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu Pro Gln Gly
210 215 220
Phe Lys Asn Ser Pro Thr Leu Phe Asp Glu Ala Leu Arg Arg Asp Leu
225 230 235 240
Ala Asp Phe Arg Ile Gln His Pro Asp Leu Ile Leu Leu Gln Tyr Val
245 250 255
Asp Asp Leu Leu Leu Ala Ala Thr Ser Glu Leu Asp Cys Gln Gln Gly
260 265 270
Thr Arg Ala Leu Leu Gln Thr Leu Gly Asp Leu Gly Tyr Arg Ala Ser
275 280 285
Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr
290 295 300
Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys Glu Thr
305 310 315 320
Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu Arg Glu Phe
325 330 335
Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly Phe Ala Glu
340 345 350
Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Thr Gly Thr Leu Phe Asn
355 360 365
Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln Glu Ile Lys Gln Ala Leu
370 375 380
Leu Thr Ala Pro Ala Leu Gly Leu Pro Asp Leu Thr Lys Pro Phe Glu
385 390 395 400
Leu Phe Val Asp Glu Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln
405 410 415
Lys Leu Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu
420 425 430
Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala
435 440 445
Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly Gln Pro
450 455 460
Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu Val Lys Gln Pro
465 470 475 480
Pro Asp Arg Trp Leu Ser Asn Ala Arg Met Thr His Tyr Gln Ala Leu
485 490 495
Leu Leu Asp Thr Asp Arg Val Gln Phe Gly Pro Val Val Ala Leu Asn
500 505 510
Pro Ala Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu Gln His Asn Cys
515 520 525
Leu Asp Ile Leu Ala Glu Ala His Gly Thr Arg Pro Asp Leu Thr Asp
530 535 540
Gln Pro Leu Pro Asp Ala Asp His Thr Trp Tyr Thr Gly Gly Ser Ser
545 550 555 560
Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val Thr Thr Glu
565 570 575
Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr Ser Ala Gln
580 585 590
Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu Arg Met Ala Glu Gly
595 600 605
Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg Tyr Ala Phe Ala Thr Ala
610 615 620
His Ile His Gly Glu Ile Tyr Arg Arg Arg Gly Leu Leu Thr Ser Glu
625 630 635 640
Gly Lys Glu Ile Lys Asn Lys Asp Glu Ile Leu Ala Leu Leu Lys Ala
645 650 655
Leu Phe Leu Pro Lys Arg Leu Ser Ile Ile His Cys Pro Gly His Gln
660 665 670
Lys Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala
675 680 685
Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr Leu Leu
690 695 700
Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn
705 710 715
<210> 2
<211> 716
<212> PRT
<213> Artificial Sequence
<220>
<223> SEQ ID No.1 obtained via G55A and F189L
<400> 2
Met Gly Gly Ser His His His His His His Gly Met Ala Ser Met Thr
1 5 10 15
Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His
20 25 30
Met Thr Leu Asn Ile Glu Asp Glu Tyr Arg Leu His Glu Thr Ser Lys
35 40 45
Glu Pro Asp Val Ser Leu Ala Ser Thr Trp Leu Ser Asp Phe Pro Gln
50 55 60
Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg Gln Ala Pro
65 70 75 80
Leu Ile Ile Leu Leu Lys Ala Thr Ser Thr Pro Val Ser Ile Lys Gln
85 90 95
Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys Pro His Ile Gln
100 105 110
Arg Leu Leu Asp Gln Gly Ile Leu Val Pro Cys Gln Ser Pro Trp Asn
115 120 125
Thr Pro Leu Leu Pro Val Lys Lys Pro Gly Thr Asn Asp Tyr Arg Pro
130 135 140
Val Gln Asp Leu Arg Glu Val Asn Lys Arg Val Glu Asp Ile His Pro
145 150 155 160
Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His
165 170 175
Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Leu Cys Leu Arg
180 185 190
Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp Arg Asp Pro
195 200 205
Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu Pro Gln Gly
210 215 220
Phe Lys Asn Ser Pro Thr Leu Phe Asp Glu Ala Leu Arg Arg Asp Leu
225 230 235 240
Ala Asp Phe Arg Ile Gln His Pro Asp Leu Ile Leu Leu Gln Tyr Val
245 250 255
Asp Asp Leu Leu Leu Ala Ala Thr Ser Glu Leu Asp Cys Gln Gln Gly
260 265 270
Thr Arg Ala Leu Leu Gln Thr Leu Gly Asp Leu Gly Tyr Arg Ala Ser
275 280 285
Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr
290 295 300
Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys Glu Thr
305 310 315 320
Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu Arg Glu Phe
325 330 335
Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly Phe Ala Glu
340 345 350
Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Thr Gly Thr Leu Phe Asn
355 360 365
Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln Glu Ile Lys Gln Ala Leu
370 375 380
Leu Thr Ala Pro Ala Leu Gly Leu Pro Asp Leu Thr Lys Pro Phe Glu
385 390 395 400
Leu Phe Val Asp Glu Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln
405 410 415
Lys Leu Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu
420 425 430
Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala
435 440 445
Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly Gln Pro
450 455 460
Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu Val Lys Gln Pro
465 470 475 480
Pro Asp Arg Trp Leu Ser Asn Ala Arg Met Thr His Tyr Gln Ala Leu
485 490 495
Leu Leu Asp Thr Asp Arg Val Gln Phe Gly Pro Val Val Ala Leu Asn
500 505 510
Pro Ala Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu Gln His Asn Cys
515 520 525
Leu Asp Ile Leu Ala Glu Ala His Gly Thr Arg Pro Asp Leu Thr Asp
530 535 540
Gln Pro Leu Pro Asp Ala Asp His Thr Trp Tyr Thr Gly Gly Ser Ser
545 550 555 560
Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val Thr Thr Glu
565 570 575
Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr Ser Ala Gln
580 585 590
Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu Arg Met Ala Glu Gly
595 600 605
Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg Tyr Ala Phe Ala Thr Ala
610 615 620
His Ile His Gly Glu Ile Tyr Arg Arg Arg Gly Leu Leu Thr Ser Glu
625 630 635 640
Gly Lys Glu Ile Lys Asn Lys Asp Glu Ile Leu Ala Leu Leu Lys Ala
645 650 655
Leu Phe Leu Pro Lys Arg Leu Ser Ile Ile His Cys Pro Gly His Gln
660 665 670
Lys Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala
675 680 685
Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr Leu Leu
690 695 700
Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn
705 710 715
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> G55A site-directed mutagenesis forward primer
<400> 3
ttagccacgt acttgcgagc gaaacatcag 30
<210> 4
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> G55A site-directed mutagenesis negative primer
<400> 4
ctgatgtttc gctcgcaagt acgtggctaa 30
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> F189L site-directed mutagenesis forward primer
<400> 5
atcttaaaga cgcgttattt tgcctccgac 30
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> F189L site directed mutagenesis negative primer
<400> 6
gtcggaggca aaataacgcg tctttaagat 30
<210> 7
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> N gene amplification forward primer for novel coronavirus
<400> 7
cagtagggga acttctcctg ctagaatggc tgg 33
<210> 8
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> negative primer for amplification of N gene of novel coronavirus
<400> 8
cctttaccag acattttgct ctcaagctgg 30
Claims (10)
1. A mutant of recombinant murine leukemia virus reverse transcriptase, wherein the mutant is obtained by replacing at least one amino acid residue of a wild-type recombinant murine leukemia virus reverse transcriptase having the amino acid sequence of SEQ ID No. 1.
2. The mutant according to claim 1, wherein the mutant has an amino acid sequence as set forth in SEQ ID No. 2.
3. Biomaterial, characterized in that it comprises any of the following:
a nucleic acid molecule encoding a mutant according to claim 1 or 2;
(ii) a recombinant vector comprising (i) said nucleic acid molecule, said recombinant vector having as its origin pET22 b;
(iii) a transformant comprising (i) said nucleic acid molecule or (ii) said recombinant vector, said transformant host being selected from the group consisting of E.coli.
4. The biomaterial according to claim 3, wherein the E.coli is selected from E.coli Rosetta or E.coli BL21.
5. The method of preparing the mutant according to claim 1 or 2, wherein the method comprises constructing a recombinant expression vector of wild-type recombinant murine leukemia virus reverse transcriptase, amplifying to obtain a linear recombinant expression vector DNA, subjecting the linear recombinant expression vector DNA to site-specific mutagenesis, cyclizing with a homologous recombinase to obtain a recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase, transforming the recombinant expression vector of mutant recombinant murine leukemia virus reverse transcriptase into host bacteria, fermenting and culturing, disrupting the bacterial cells, and collecting the mutant recombinant murine leukemia virus reverse transcriptase.
6. The method according to claim 5, wherein two sets of primer pairs are used for the two site-directed mutagenesis, wherein the nucleotide sequence of the forward primer of the first primer pair is shown as SEQ ID No.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4; the nucleotide sequence of the forward primer of the second primer pair is shown as SEQ ID No.5, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 6.
7. The method of claim 6, wherein the original vector of the recombinant expression vector is pET22 b.
8. The method according to claim 7, wherein the homologous recombinase is UvsXase and the host bacterium is E.coli Rosetta or E.coli BL 21.
9. Use of the mutant of claim 1 or 2 in qPCR for SARS-CoV-2 virus or in the preparation of a product of qPCR for SARS-CoV-2 virus.
10. The use according to claim 9, wherein the SARS-CoV-2 virus qPCR product comprises a positive primer having a nucleotide sequence shown as SEQ ID No.9 and a negative primer having a nucleotide sequence shown as SEQ ID No. 10.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111651558.2A CN114317485B (en) | 2021-12-30 | 2021-12-30 | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111651558.2A CN114317485B (en) | 2021-12-30 | 2021-12-30 | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317485A true CN114317485A (en) | 2022-04-12 |
| CN114317485B CN114317485B (en) | 2023-04-11 |
Family
ID=81019286
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111651558.2A Active CN114317485B (en) | 2021-12-30 | 2021-12-30 | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317485B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1430670A (en) * | 2000-05-26 | 2003-07-16 | 茵维特罗根公司 | Thermostable reverse transcriptases and uses thereof |
| WO2007022045A2 (en) * | 2005-08-10 | 2007-02-22 | Stratagene California | Mutant reverse transcriptase and methods of use |
| US20080227661A1 (en) * | 2005-08-10 | 2008-09-18 | Stratagene California | Mutant reverse transcriptase and methods of use |
| CN101613680A (en) * | 2009-01-23 | 2009-12-30 | 广州华银医药科技有限公司 | Moloneys mouse leukemia virus reverse transcriptase mutant and expression method thereof and application |
| CN105441405A (en) * | 2014-08-28 | 2016-03-30 | 中国科学院上海生命科学研究院 | A BMX spliceosome and applications thereof in lung cancer drug resistance |
| WO2018110595A1 (en) * | 2016-12-14 | 2018-06-21 | タカラバイオ株式会社 | Heat-resistant reverse transcriptase mutant |
| CN111471662A (en) * | 2020-04-14 | 2020-07-31 | 江南大学 | SlEH1 mutant and application thereof in enantiotropic hydrolyzed epoxides |
| CN113544257A (en) * | 2018-12-24 | 2021-10-22 | 思兰克斯有限公司 | Characterization and inactivation of endogenous retroviruses in chinese hamster ovary cells |
| CN114277192A (en) * | 2021-12-30 | 2022-04-05 | 南京巨匠生物科技有限公司 | Amplification system composition for RT-LAMP reaction, RT-LAMP method of RNA virus and application |
-
2021
- 2021-12-30 CN CN202111651558.2A patent/CN114317485B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1430670A (en) * | 2000-05-26 | 2003-07-16 | 茵维特罗根公司 | Thermostable reverse transcriptases and uses thereof |
| WO2007022045A2 (en) * | 2005-08-10 | 2007-02-22 | Stratagene California | Mutant reverse transcriptase and methods of use |
| US20080227661A1 (en) * | 2005-08-10 | 2008-09-18 | Stratagene California | Mutant reverse transcriptase and methods of use |
| CN101613680A (en) * | 2009-01-23 | 2009-12-30 | 广州华银医药科技有限公司 | Moloneys mouse leukemia virus reverse transcriptase mutant and expression method thereof and application |
| CN105441405A (en) * | 2014-08-28 | 2016-03-30 | 中国科学院上海生命科学研究院 | A BMX spliceosome and applications thereof in lung cancer drug resistance |
| WO2018110595A1 (en) * | 2016-12-14 | 2018-06-21 | タカラバイオ株式会社 | Heat-resistant reverse transcriptase mutant |
| CN110291196A (en) * | 2016-12-14 | 2019-09-27 | 宝生物工程株式会社 | Thermostable reverse transcriptase mutant |
| CN113544257A (en) * | 2018-12-24 | 2021-10-22 | 思兰克斯有限公司 | Characterization and inactivation of endogenous retroviruses in chinese hamster ovary cells |
| CN111471662A (en) * | 2020-04-14 | 2020-07-31 | 江南大学 | SlEH1 mutant and application thereof in enantiotropic hydrolyzed epoxides |
| CN114277192A (en) * | 2021-12-30 | 2022-04-05 | 南京巨匠生物科技有限公司 | Amplification system composition for RT-LAMP reaction, RT-LAMP method of RNA virus and application |
Non-Patent Citations (2)
| Title |
|---|
| TAMARA MATUTE ET AL.: "Homebrew reagents for low-cost RT-LAMP", 《JOURNAL OF BIOMOLECULAR TECHNIQUES》 * |
| 王贤松等: "莫洛尼鼠白血病病毒逆转录酶的原核表达纯化及其生物学活性", 《生物工程学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317485B (en) | 2023-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112795551B (en) | High Wen Ni-resistant transcriptase mutant and application thereof | |
| CN111484987B (en) | Heat-resistant DNA polymerase mutant with high amplification activity | |
| CN110982801B (en) | Transaminase mutant and construction method and application thereof | |
| CN112795546B (en) | High-temperature-resistant reverse transcriptase mutant with high reverse transcription efficiency and application thereof | |
| CN110846291B (en) | Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof | |
| CN111073871A (en) | DNA polymerase mutant with improved thermal stability as well as construction method and application thereof | |
| CN112359032B (en) | Mutant esterase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof | |
| CN114262697A (en) | Bsu DNA polymerase and Bsu DNA polymerase mutant as well as gene, plasmid and genetic engineering bacteria thereof | |
| CN114317485B (en) | Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application | |
| CN111100851B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of chiral diaryl alcohol compound | |
| CN108424943B (en) | Method for producing 2 '-deoxy-2' -fluoro-beta-D-arabinosyladenylate | |
| CN113249349B (en) | Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof | |
| CN114480334B (en) | Reverse transcriptase mutants for detection of novel coronaviruses | |
| CN114480337B (en) | Reverse transcriptase mutant and reverse transcription method | |
| CN112795549B (en) | Reverse transcriptase mutant | |
| CN114250206B (en) | Methyltransferase mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| CN112626044A (en) | Mutant and construction method and application thereof | |
| CN114369587B (en) | Vaccinia virus capping enzyme mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| CN112899255B (en) | DNA polymerase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof | |
| CN114480345B (en) | MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof | |
| CN114574464B (en) | High-fidelity DNA polymerase mutant and application thereof | |
| CN114480336B (en) | Nucleic acid detection kit containing reverse transcriptase mutant | |
| CN112079903B (en) | Mutant of mismatching binding protein and coding gene thereof | |
| CN112980811B (en) | RNA polymerase mutant and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof | |
| CN114480338B (en) | Reverse transcriptase mutants for nucleic acid detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |