CN113249349B - Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof - Google Patents

Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof Download PDF

Info

Publication number
CN113249349B
CN113249349B CN202110690363.2A CN202110690363A CN113249349B CN 113249349 B CN113249349 B CN 113249349B CN 202110690363 A CN202110690363 A CN 202110690363A CN 113249349 B CN113249349 B CN 113249349B
Authority
CN
China
Prior art keywords
leu
seq
ala
gly
alcohol dehydrogenase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110690363.2A
Other languages
Chinese (zh)
Other versions
CN113249349A (en
Inventor
江晶洁
马富强
张艺凡
陆泽林
杨广宇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Institute of Biomedical Engineering and Technology of CAS
Original Assignee
Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Institute of Biomedical Engineering and Technology of CAS filed Critical Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority to CN202110690363.2A priority Critical patent/CN113249349B/en
Publication of CN113249349A publication Critical patent/CN113249349A/en
Application granted granted Critical
Publication of CN113249349B publication Critical patent/CN113249349B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a mutant alcohol dehydrogenase, a recombinant vector, a preparation method and application thereof, wherein the mutant alcohol dehydrogenase is mutated on an amino acid sequence shown in SEQ ID No.2, and mutation sites are selected from one or more of T105N, G137S, A165E and S180D. Compared with wild alcohol dehydrogenase, the mutant alcohol dehydrogenase of the invention has improved enzyme activity of both single-point mutant and combined mutant; particularly, the activity of the combined mutant is improved by 6 times, and the single-point mutant superposition effect is shown; the mutant alcohol dehydrogenase of the invention has excellent catalytic activity, can be used for catalyzing the reduction of aldehyde/ketone compounds, and has larger application potential.

Description

Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to mutant alcohol dehydrogenase, a recombinant vector, and a preparation method and application thereof.
Background
Alcohol Dehydrogenases (ADHs) are a widely distributed group of oxidoreductases, exemplified by NAD+、NADP+Or PQQ is a coenzyme, and plays an important role in the biotransformation process of human and mammalian livers, plant tissues and microbial cells. The chiral alcohol with high enantioselectivity is produced based on ADH catalysis, and is used as a biocatalyst which is widely applied to the fields of medicine, chemical engineering chiral intermediate synthesis and the like, such as antiepileptic drug levetiracetam chiral precursor (S) -2-aminobutanamide, antiretroviral drug atazanavir intermediate (2R, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol for treating and preventing AIDS virus, and duloxetine chiral precursor (S) -3-dimethylamino for depression and urinary incontinence indicationsThe synthesis of compounds such as (E) -1- (2-thienyl) -1-propanol, etc.
The existing alcohol dehydrogenase can be used as a biocatalyst, and the aldehyde/ketone compound is reduced by a one-step enzyme method to prepare a chiral intermediate with single optical purity, so that the synthetic steps of the chiral intermediate can be simplified, the difficulty in chemical resolution can be avoided, and the production pollution can be reduced. However, in the field of industrial synthesis, the key problem of low enzyme catalytic activity still exists when chiral intermediates are prepared by an enzyme method. Therefore, it is necessary to perform directed evolution modification on the existing alcohol dehydrogenase to improve the catalytic activity thereof, so as to solve the problems of low stereoselectivity, complicated post-treatment process, high production cost and the like in the prior art.
Disclosure of Invention
The technical problem to be solved by the present invention is to provide a mutant alcohol dehydrogenase, a recombinant vector, and a preparation method and an application thereof, aiming at the defects in the prior art.
In order to solve the technical problems, the invention adopts the technical scheme that:
the invention provides a mutant alcohol dehydrogenase, which is (a 1) or (a 2):
(a1) a polypeptide which is obtained by deleting, replacing or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.2 and has the same function with the polypeptide consisting of the amino acid sequence shown in SEQ ID No. 2;
(a2) a polypeptide having at least 90% homology with the polypeptide consisting of the amino acid sequence shown in SEQ ID No. 2.
Wherein, the enzyme activities of (a 1) and (a 2) are greatly improved. More specifically, the mutant alcohol dehydrogenase is obtained by mutating the amino acid sequence shown in SEQ ID No.2, wherein the mutation site is selected from one or more of T105N, G137S, A165E and S180D.
Preferably, the mutation site is T105N, G137S, A165E, S180D, T105N-G137S, T105N-A165E, T105N-S180D, G137S-A165E, G137S-S180D, A165E-S180D, T105N-G137S-A165E, T105N-G137S-S180D, T105N-A165E-S180D, G137S-A165E-S180D or T105N-G137S-A165E-S180D.
Preferably, the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the T105N single-site mutation is shown as SEQ ID No. 3;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of G137S is shown as SEQ ID No. 4;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of A165E is shown as SEQ ID No. 5;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of S180D is shown as SEQ ID No. 6;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S is shown as SEQ ID No. 7;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E is shown as SEQ ID No. 8;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-S180D is shown as SEQ ID No. 9;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the G137S-A165E combined site mutation is shown as SEQ ID No. 10;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-S180D is shown as SEQ ID No. 11;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the mutation of the A165E-S180D combined site is shown as SEQ ID No. 12;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E is shown as SEQ ID No. 13;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-S180D is shown as SEQ ID No. 14;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E-S180D is shown as SEQ ID No. 15;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-A165E-S180D is shown as SEQ ID No. 16;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E-S180D is shown as SEQ ID No. 17.
The mutant alcohol dehydrogenase of the invention has excellent catalytic activity, can be used for catalyzing the reduction of aldehyde/ketone compounds, and has obviously improved reduction activity compared with the wild alcohol dehydrogenase.
The present invention also provides a gene encoding the mutant alcohol dehydrogenase as described above, which is (b 1) or (b 2) below:
(b1) a polynucleotide obtained by deleting, replacing or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 1;
(b2) a polynucleotide having at least 90% homology with a polynucleotide consisting of the nucleotide sequence shown in SEQ ID No. 1.
Preferably, the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N is shown as SEQ ID No. 28;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S is shown as SEQ ID No. 29;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E is shown as SEQ ID No. 30;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of S180D is shown as SEQ ID No. 31;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-G137S is shown as SEQ ID No. 32;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E is shown as SEQ ID No. 33;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-S180D is shown as SEQ ID No. 34;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-A165E is shown as SEQ ID No. 35;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-S180D is shown as SEQ ID No. 36;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E-S180D is shown as SEQ ID No. 37;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E is shown as SEQ ID No. 38;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-S180D is shown as SEQ ID No. 39;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E-S180D is shown as SEQ ID No. 40;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of G137S-A165E-S180D is shown as SEQ ID No. 41;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E-S180D is shown as SEQ ID No. 42.
The present invention also provides a recombinant vector comprising the gene as described above. The recombinant vector is a cloning vector or an expression vector. More preferably, the recombinant vector is a pET28a plasmid containing the above gene.
Preferably, the preparation method of the recombinant vector comprises the following steps: and carrying out PCR amplification on the first vector by adopting a mutation amplification primer pair to obtain a recombinant vector, wherein the mutation amplification primer pair contains a nucleotide sequence corresponding to a mutation site of the mutant alcohol dehydrogenase, and the first vector contains a gene encoding an amino acid sequence shown as SEQ ID No. 2.
Preferably, the pair of mutation amplification primers comprises: at least one pair of amplification primer pair of amplification mutation site T105N shown as SEQ ID No.20 and SEQ ID No.21, amplification primer pair of amplification mutation site G137S shown as SEQ ID No.22 and SEQ ID No.23, amplification primer pair of amplification mutation site A165E shown as SEQ ID No.24 and SEQ ID No.25, and amplification primer pair of amplification mutation site S180D shown as SEQ ID No.26 and SEQ ID No. 27.
In the construction of a single-site mutant alcohol dehydrogenase (single-site mutant), PCR amplification was carried out using one of the above-described mutation amplification primer pairs; in the construction of a mutant alcohol dehydrogenase (combinatorial mutant) having a combination site mutation, PCR amplification is carried out using at least two of the above-described pairs of mutation amplification primers.
Preferably, before the step of performing PCR amplification on the first vector by using the mutation amplification primer pair, the method further comprises a step of constructing the first vector, and specifically comprises: amplifying a target gene by using an amplification primer pair with a sequence shown as SEQ ID No. 18-SEQ ID No.19, wherein the target gene is a coding sequence corresponding to an amino acid sequence shown as SEQ ID No. 2; connecting the target gene to an empty vector, transforming, and extracting positive plasmids to obtain a first vector.
Preferably, the method further comprises, before the step of performing PCR amplification on the first vector by using the mutant amplification primer pair, the following steps: screening the mutant site of the mutant alcohol dehydrogenase.
The protein engineering is based on the relationship between the structural rule and the biological function of protein molecules, and carries out gene modification or gene synthesis by means of chemistry, physics and molecular biology to modify the existing protein or manufacture a new protein to meet the requirements of human on production and life. Rational design is the most common method in protein engineering, and utilizes computer-aided molecular model combined with site-directed mutagenesis to realize protein function optimization, such as improvement of catalytic activity, thermal stability, acid and alkali resistance, etc. In order to effectively optimize the enzyme catalytic activity of the protein, the invention carries out homology modeling structural analysis on the alcohol dehydrogenase, and predicts the key amino acid residues of the enzyme bound with the substrate according to the reported structure-function information, including T105N, G137S, A165E and S180D.
The recombinant vector can be used for producing mutant alcohol dehydrogenase and can be applied to chiral intermediate synthesis.
The invention also provides a recombinant engineering bacterium, which comprises the recombinant vector. The recombinant engineering bacteria can produce mutant alcohol dehydrogenase and can be applied to aldehyde/ketone reduction to generate chiral intermediates.
The invention also provides an application of the recombinant vector or the recombinant engineering bacterium in production and preparation of alcohol dehydrogenase.
The invention has the beneficial effects that:
compared with wild alcohol dehydrogenase, the mutant alcohol dehydrogenase of the invention has improved enzyme activity of both single-point mutant and combined mutant; particularly, the activity of the combined mutant is improved by 6 times, and the single-point mutant superposition effect is shown;
the mutant alcohol dehydrogenase of the invention has excellent catalytic activity, can be used for catalyzing the reduction of aldehyde/ketone compounds, and has larger application potential.
Drawings
FIG. 1 is a schematic diagram of a crystal structure of alcohol dehydrogenase protein mimic provided in example 3 of the present invention.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Reagents and instruments used in the examples are all conventional in the art and are not specifically described. The experimental procedures, in which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, such as those in the literature, in books, or as recommended by the manufacturer of the kits. The reagents used in the examples are all commercially available.
Example 1
This example provides a mutant alcohol dehydrogenase comprising: a polypeptide which is obtained by deleting, replacing or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.2 and has the same function with the polypeptide consisting of the amino acid sequence shown in SEQ ID No. 2; or a polypeptide having at least 90% homology with the polypeptide consisting of the amino acid sequence shown in SEQ ID No. 2.
Specifically, the mutant alcohol dehydrogenase is obtained by mutating the amino acid sequence shown in SEQ ID No.2, wherein the mutation site is selected from one of T105N, G137S, A165E and S180D (single-site mutation, corresponding to single-point mutant) or more than one combination (combination site mutation, corresponding to combination mutant).
More specifically, the mutation sites are T105N, G137S, A165E, S180D, T105N-G137S, T105N-A165E, T105N-S180D, G137S-A165E, G137S-S180D, A165E-S180D, T105N-G137S-A165E, T105N-G137S-S180D, T105N-A165E-S180D, G137S-A165E-S180D or T105N-G137S-A165E-S180D.
Wherein the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the T105N single-site mutation is shown as SEQ ID No. 3; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of G137S is shown as SEQ ID No. 4; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of A165E is shown as SEQ ID No. 5; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of S180D is shown as SEQ ID No. 6; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S is shown as SEQ ID No. 7; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E is shown as SEQ ID No. 8; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-S180D is shown as SEQ ID No. 9; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the G137S-A165E combined site mutation is shown as SEQ ID No. 10; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-S180D is shown as SEQ ID No. 11; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the mutation of the A165E-S180D combined site is shown as SEQ ID No. 12; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E is shown as SEQ ID No. 13; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-S180D is shown as SEQ ID No. 14; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E-S180D is shown as SEQ ID No. 15; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-A165E-S180D is shown as SEQ ID No. 16; the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E-S180D is shown as SEQ ID No. 17.
Example 2
This example provides a gene encoding the mutant alcohol dehydrogenase of example 1, which is: a polynucleotide obtained by deleting, replacing or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 1; or a polynucleotide having at least 90% homology with the polynucleotide consisting of the nucleotide sequence shown in SEQ ID No. 1.
Specifically, the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N is shown as SEQ ID No. 28; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S is shown as SEQ ID No. 29; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E is shown as SEQ ID No. 30; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of S180D is shown as SEQ ID No. 31; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-G137S is shown as SEQ ID No. 32; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E is shown as SEQ ID No. 33; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-S180D is shown as SEQ ID No. 34; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-A165E is shown as SEQ ID No. 35; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-S180D is shown as SEQ ID No. 36; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E-S180D is shown as SEQ ID No. 37; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E is shown as SEQ ID No. 38; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-S180D is shown as SEQ ID No. 39; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E-S180D is shown as SEQ ID No. 40; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of G137S-A165E-S180D is shown as SEQ ID No. 41; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E-S180D is shown as SEQ ID No. 42.
Example 3
Constructing a mutant alcohol dehydrogenase comprising the steps of:
1. cloning of wild-type alcohol dehydrogenase Gene
The wild alcohol dehydrogenase gene is subjected to codon optimization by taking escherichia coli as a host cell to obtain an optimized alcohol dehydrogenase gene (namely a target gene), the nucleic acid sequence of the optimized alcohol dehydrogenase gene is SEQ ID No.1, and the expressed amino acid sequence of the optimized alcohol dehydrogenase gene is SEQ ID No. 2. The SEQ ID No.1 is taken as a target gene, and an upstream amplification primer SEQ ID No.18 and a downstream amplification primer SEQ ID No.19 are adopted to amplify the target gene. Wherein, the sequence of SEQ ID No.18 is: 5' -ACTGCTCATATGATGACTCATAAAGCAACG-3' (wherein the restriction enzyme NdeI recognition site is underlined); the sequence of SEQ ID No.19 is: 5' -TCAGCTCTCGAGTCACCCCTGCAATATTTTG-3' (wherein the restriction enzyme XhoI recognition site is underlined). The amplification conditions were: amplification was carried out at 95 ℃ for 2 min, followed by amplification at 56 ℃ for 20 sec, at 72 ℃ for 90 sec for 30 cycles, and finally at 72 ℃ for 10 min.
After the reaction is finished, detecting the PCR amplification product by agarose gel electrophoresis with the mass percentage of 1.5 percent to obtain a 0.8 kb band, wherein the length of the band accords with an expected result. The desired fragment was recovered and purified by the standard procedures of a kit, and the desired fragment and pET28a plasmid were digested simultaneously with restriction endonucleases XhoI and NdeI, and then ligated with T4 DNA ligase, and the resulting ligation product was transformed into competent cells of Escherichia coli BL21(DE3), and the transformed cells were plated on LB plate containing 50. mu.g/ml kanamycin to extract positive clone plasmid, and sequencing was performed, whereby it was revealed that the cloned alcohol dehydrogenase gene had the correct sequence and had been correctly ligated to pET28a plasmid, and recombinant plasmid pET28 a-alcohol dehydrogenase was obtained. Wherein the wild-type alcohol dehydrogenase is derived fromEscherichia coliDesignated Ec alcohol dehydrogenase protein; the alcohol dehydrogenase gene is provided by Suzhou Jinweizhi Biotech limited; the PCR amplification enzyme is KOD high-fidelity polymerase provided by Toyo Boseki.
2. Expression and purification of alcohol dehydrogenase proteins
Inoculating the engineering bacteria in Glycine max tube at a volume ratio of 1% into a 4 mL LB medium test tube containing 100 μ g/mL Kan, culturing at 37 deg.C and 220 rpm for 12 h(ii) a Transferring 4 mL of the strain solution to a 1L LB medium shake flask containing 50. mu.g/mL Kan, and culturing at 37 deg.C and 220 rpm for 2.5 h to OD600When the concentration reached about 0.9, 0.1 mM IPTG inducer was added, and the mixture was subjected to induction culture at 25 ℃ and 200 rpm for 14 hours. And ultrasonically crushing the escherichia coli thallus suspension obtained after fermentation, and performing one-step Ni-NTA affinity chromatography treatment to obtain alcohol dehydrogenase protein with the purity of more than 95%, wherein the amino acid sequence of the alcohol dehydrogenase protein is SEQ ID No. 2.
3. Multiple sequence alignment and Consensus analysis of alcohol dehydrogenase homologous proteins
3.1. Entering a Pfam database homepage (http:// Pfam. xfam. org /), inputting an amino acid SEQUENCE of alcohol dehydrogenase in a SEQUENCE SEARCH tool for searching, directly feeding back an alignment result of the amino acid SEQUENCE of the whole family of the protein by a server, displaying the abundance of various amino acids of each mutation site in a bar graph form, and automatically generating the consensus SEQUENCE of the protein family by the website.
3.2. Inputting an amino acid sequence shown by SEQ ID No.2 into an NCBI protein database and a Pfam database, finding out all protein sequences with the consistency of more than 30 percent with the amino acid sequence (shown as SEQ ID No. 2) of the alcohol dehydrogenase protein by using a Blast tool, deleting the repeated identical sequences in the protein sequences, arranging the rest amino acid sequences into a fasta format, inputting Clustalx1.83 software for multi-sequence comparison, and outputting comparison results in an aln, dnd and fasta format, wherein the dnd file is used for constructing an evolutionary tree file, the aln and fasta files are sequence files with different forms, and analyzing conserved amino acid regions of the proteins.
4. Simulation of three-dimensional structure of alcohol dehydrogenase protein and selection of mutation hot spot
4.1. A prediction of the three-dimensional structure of the alcohol dehydrogenase protein (amino acid sequence SEQ ID No. 2) was obtained by the Swissmodel on-line tool pair.
4.2. PyMOL is used for observing the crystal structure of alcohol dehydrogenase protein (the amino acid sequence is shown as SEQ ID No. 2), the mutant site to be selected and the mutant form are reviewed according to the structural information, and the mutant site which is most likely to improve the activity of the alcohol dehydrogenase protein is screened out under the following screening conditions:
(1) the standard for judging a certain locus as a candidate locus is as follows:
(1.1) the majority of proteins of the family have an overall high degree of amino acid abundance at that site;
(1.2) the amino acids at this site are conserved;
(1.3) the amino acid with higher occurrence frequency at the site has larger difference of physicochemical properties, such as charge difference, polarity intensity, steric hindrance and the like, with the amino acid of the alcohol dehydrogenase protein at the site.
(2) Near the active center, i.e. away from the catalytic residues (amino acid residues in the 10 a range), the amino acid residues in the embedded or semi-embedded state are removed.
After the above two-step screening, 8 different sites were remained, most of which were located on the surface of the alcohol dehydrogenase protein molecule, as shown in FIG. 1.
(3) According to the crystal structure of the alcohol dehydrogenase protein, the 8 mutant forms are analyzed in detail one by one, and mutants which are related to the possibility of improving the catalytic activity of the alcohol dehydrogenase protein are screened.
In this example, 4 single-point mutants were designed, and the mutation sites thereof were: T105N, G137S, a165E, S180D; and (3) carrying out activity measurement on the 4 alcohol dehydrogenase single-point mutants to screen 4 mutant alcohol dehydrogenases with improved enzyme activity, wherein the mutation sites are as follows: the amino acid sequences of the corresponding single-point mutants of T105N, G137S, A165E and S180D are SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively.
5. Construction, expression and purification of mutant alcohol dehydrogenase
5.1. Construction of alcohol dehydrogenase protein single-point mutant
Taking the recombinant plasmid pET28 a-alcohol dehydrogenase in the step 1 as a template, taking a pair of complementary oligonucleotides with mutation sites as amplification primers, and carrying out whole plasmid PCR amplification by using KOD high fidelity enzyme to obtain a recombinant plasmid with a specific mutation site;
the amplification primer pairs used were:
(1) in the amplification primer pair for amplifying the mutation site T105N, the upstream amplification primer is shown as SEQ ID No.20, and the downstream amplification primer is shown as SEQ ID No. 21.
The sequence of SEQ ID No.20 is:
5' - ATGGCCCCCTTTCCAACATCAGCCGTGCGCAGATGG- 3'。
the sequence of SEQ ID No.21 is:
5'- CCATCTGCGCACGGCTGATGTTGGAAAGGGGGCCAT -3'。
(2) in the amplification primer pair for amplifying the mutation site G137S, the upstream amplification primer is shown as SEQ ID No.22, and the downstream amplification primer is shown as SEQ ID N0.23.
The sequence of SEQ ID No.22 is:
5' - CGCGATGTTACCGCACTCCGAAGGGCGTATTGTGATG -3'。
the sequence of SEQ ID No.23 is:
5' - CATCACAATACGCCCTTCGGAGTGCGGTAACATCGCG -3'。
(3) in the amplification primer pair for amplifying the mutation site A165E, the upstream amplification primer is shown as SEQ ID No.24, and the downstream amplification primer is shown as SEQ ID No. 25.
The sequence of SEQ ID No.24 is:
5' - GCGGCCAGTAAATATGAGCTGGAGGCGTGGTCAGAT -3'。
the sequence of SEQ ID No.25 is:
5' - ATCTGACCACGCCTCCAGCTCATATTTACTGGCCGC-3'。
(4) in the amplification primer pair for amplifying the mutation site S180D, the upstream amplification primer is shown as SEQ ID No.26, and the downstream amplification primer is shown as SEQ ID No. 27.
The sequence of SEQ ID No.26 is:
5' - GCATGGAGCTGCGCCACGACGGAATTAAAGTCAGCC-3'。
the sequence of SEQ ID No.27 is:
5' - GGCTGACTTTAATTCCGTCGTGGCGCAGCTCCATGC-3'。
the amplification conditions were: amplifying at 95 ℃ for 2 min, then at 56 ℃ for 20 sec, at 72 ℃ for 90 sec for 30 cycles, and finally at 72 ℃ for 10 min; recovering PCR amplification products by glue, digesting the glue recovery products for 2 h at 37 ℃ by using DpnI enzyme, and degrading the initial template; and (3) transforming the digestion product into escherichia coli BL21(DE3) competent cells, coating the competent cells on an LB agar plate containing 50 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, screening positive clones, and carrying out sequencing verification to obtain the recombinant bacteria containing the alcohol dehydrogenase single-point mutant. Wherein the KOD Hi-Fi enzyme is provided by Takara; the DpnI enzyme is supplied by Fermentas.
5.2. Construction of alcohol dehydrogenase protein combination mutants
And (2) accumulating and combining the single-point mutants with improved stability by using a construction method similar to the single-point mutants, selecting a plurality of mutation sites for combination in an amino acid sequence shown in SEQ ID No.2, and selecting 2-4 mutation sites from the 4 mutation sites for combination to respectively obtain different alcohol dehydrogenase combined mutants:
(1) 2 mutation sites are selected for combination, 6 kinds of mutant alcohol dehydrogenases can be constructed, and the combined mutation sites are respectively: T105N-G137S, T105N-A165E, T105N-S180D, G137S-A165E, G137S-S180D and A165E-S180D, wherein the amino acid sequences of the 6 mutant alcohol dehydrogenases are respectively SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 and SEQ ID No.12 in sequence.
(2) Selecting 3 mutation sites for combination to construct 4 mutant alcohol dehydrogenases, wherein the combined mutation sites are respectively: T105N-G137S-A165E, T105N-G137S-S180D, T105N-A165E-S180D and G137S-A165E-S180D, wherein the amino acid sequences of the 4 mutant alcohol dehydrogenases are respectively SEQ ID No.13, SEQ ID No.14, SEQ ID No.15 and SEQ ID No.16 in sequence.
(3) 4 mutation sites are selected for combination, 1 mutant alcohol dehydrogenase can be constructed, and the combined mutation sites are as follows: T105N-G137S-A165E-S180D, and the amino acid sequence of the 1 mutant alcohol dehydrogenase is SEQ ID No. 17.
Wherein the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N is shown as SEQ ID No. 28; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S is shown as SEQ ID No. 29; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E is shown as SEQ ID No. 30; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of S180D is shown as SEQ ID No. 31; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-G137S is shown as SEQ ID No. 32; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E is shown as SEQ ID No. 33; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-S180D is shown as SEQ ID No. 34; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-A165E is shown as SEQ ID No. 35; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-S180D is shown as SEQ ID No. 36; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E-S180D is shown as SEQ ID No. 37; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E is shown as SEQ ID No. 38; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-S180D is shown as SEQ ID No. 39; the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E-S180D is shown as SEQ ID No. 40; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of G137S-A165E-S180D is shown as SEQ ID No. 41; the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E-S180D is shown as SEQ ID No. 42.
Test example 1
Characterization of enzymatic Properties of mutant alcohol dehydrogenases
The enzyme activity test is carried out on the wild type alcohol dehydrogenase and the mutant alcohol dehydrogenase provided by the embodiment 3, and the method for determining the activity of the conventional alcohol dehydrogenase specifically comprises the following steps:
taking a 96-well plate, respectively adding the 96-well plate into the 96-well plate according to the reference numbers 1-6, wherein the final concentrations are 0 mu M, 500 mu M, 1000 mu M, 1500 mu M and 2000 mu M, supplementing 100 mu L with phosphate buffer solution with pH 7.0, uniformly mixing, detecting at 340 nm and recording the absorbance value; from the above-mentioned measured values, a standard curve Y ═ k ×, where Y is the value of absorbance, X is the concentration (mM) of the N-alcohol dehydrogenase, and R of the curve is obtained2>99.5 percent. Enzyme coupling involves alcohol dehydrogenase and coenzyme NAD+Labeling with spectrophotometer (UV 2550) and enzyme at 30 deg.COD detection by Instrument (Biotek)340In case of an increase within 360 s, the molar extinction coefficient =0.00622 μ M, 100 uL reaction system:
Figure DEST_PATH_IMAGE002_6A
activity of protease (U/ml) = Δ OD × V/∈ × l × t × m; wherein: Δ OD: a change in the average absorbance; v: a reaction volume; epsilon: the absorption coefficient; l: width of the cuvette; t: reaction time; m: (ii) enzyme mass;
the detection results are as follows:
TABLE 1 characterization of enzymatic Properties of wild-type alcohol dehydrogenase, mutant alcohol dehydrogenase
Figure DEST_PATH_IMAGE004_6A
As can be seen from Table 1, the 15 mutant alcohol dehydrogenases include single-site mutants and combined mutants, and compared with wild alcohol dehydrogenases, the enzyme activities of the single-site mutants and the combined mutants are improved; especially, the activity of the combined mutant is improved by 6 times, and the single-point mutant additive effect is shown. In conclusion, the mutant alcohol dehydrogenase of the invention has higher catalytic activity and larger application potential.
While embodiments of the invention have been disclosed above, it is not limited to the applications listed in the description and the embodiments, which are fully applicable in all kinds of fields of application of the invention, and further modifications may readily be effected by those skilled in the art, so that the invention is not limited to the specific details without departing from the general concept defined by the claims and the scope of equivalents.
Sequence listing
<110> institute of biomedical engineering technology of Suzhou, China academy of sciences
<120> mutant alcohol dehydrogenase, recombinant vector, and preparation method and application thereof
<160> 42
<170> SIPOSequenceListing 1.0
<210> 1
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 2
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 2
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 3
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 3
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 4
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 4
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 5
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 5
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 6
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 6
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 7
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 7
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 8
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 8
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Glu Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 9
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 9
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 10
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 10
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 11
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 11
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 12
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 12
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Gly Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 13
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 13
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Ser Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 14
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 14
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Ala Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 15
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 15
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Glu Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 16
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 16
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Thr Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 17
<211> 269
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 17
Met Thr His Lys Ala Thr Glu Ile Leu Thr Gly Lys Val Met Gln Lys
1 5 10 15
Ser Val Leu Ile Thr Gly Cys Ser Ser Gly Ile Gly Leu Glu Ser Ala
20 25 30
Leu Glu Leu Lys Arg Gln Gly Phe His Val Leu Ala Gly Cys Arg Lys
35 40 45
Pro Asp Asp Val Glu Arg Met Asn Ser Met Gly Phe Thr Gly Val Leu
50 55 60
Ile Asp Leu Asp Ser Pro Glu Ser Val Asp Arg Ala Ala Asp Glu Val
65 70 75 80
Ile Ala Leu Thr Asp Asn Cys Leu Tyr Gly Ile Phe Asn Asn Ala Gly
85 90 95
Phe Gly Met Tyr Gly Pro Leu Ser Asn Ile Ser Arg Ala Gln Met Glu
100 105 110
Gln Gln Phe Ser Ala Asn Phe Phe Gly Ala His Gln Leu Thr Met Arg
115 120 125
Leu Leu Pro Ala Met Leu Pro His Ser Glu Gly Arg Ile Val Met Thr
130 135 140
Ser Ser Val Met Gly Leu Ile Ser Thr Pro Gly Arg Gly Ala Tyr Ala
145 150 155 160
Ala Ser Lys Tyr Glu Leu Glu Ala Trp Ser Asp Ala Leu Arg Met Glu
165 170 175
Leu Arg His Asp Gly Ile Lys Val Ser Leu Ile Glu Pro Gly Pro Ile
180 185 190
Arg Thr Arg Phe Thr Asp Asn Val Asn Gln Thr Gln Ser Asp Lys Pro
195 200 205
Val Glu Asn Pro Gly Ile Ala Ala Arg Phe Thr Leu Gly Pro Glu Ala
210 215 220
Val Val Asp Lys Val Arg His Ala Phe Ile Ser Glu Lys Pro Lys Met
225 230 235 240
Arg Tyr Pro Val Thr Leu Val Thr Trp Ala Val Met Val Leu Lys Arg
245 250 255
Leu Leu Pro Gly Arg Val Met Asp Lys Ile Leu Gln Gly
260 265
<210> 18
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
actgctcata tgatgactca taaagcaacg 30
<210> 19
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
tcagctctcg agtcacccct gcaatatttt 30
<210> 20
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
atggccccct ttccaacatc agccgtgcgc agatgg 36
<210> 21
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
ccatctgcgc acggctgatg ttggaaaggg ggccat 36
<210> 22
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
cgcgatgtta ccgcactccg aagggcgtat tgtgatg 37
<210> 23
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
catcacaata cgcccttcgg agtgcggtaa catcgcg 37
<210> 24
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
gcggccagta aatatgagct ggaggcgtgg tcagat 36
<210> 25
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
atctgaccac gcctccagct catatttact ggccgc 36
<210> 26
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
gcatggagct gcgccacgac ggaattaaag tcagcc 36
<210> 27
<211> 36
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
ggctgacttt aattccgtcg tggcgcagct ccatgc 36
<210> 28
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 29
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 30
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 31
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 32
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 33
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacga ggaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 34
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 35
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 36
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 37
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacgg tgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 38
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacagc 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 39
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgcgctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 40
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcacga ggaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 41
<211> 810
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaccatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtga 810
<210> 42
<211> 809
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
atgactcata aagcaacgga gatcctgaca ggtaaagtta tgcaaaaatc ggtcttaatt 60
accggatgtt ccagtggaat tggcctggaa agcgcgctcg aattaaaacg ccagggtttt 120
catgtgctgg caggttgccg gaaaccggat gatgttgagc gcatgaacag catgggattt 180
accggcgtgt tgatcgatct ggattcacca gaaagtgttg atcgcgcagc cgacgaggtg 240
atcgccctga ccgataattg tctgtatggg atctttaaca atgccggatt cggcatgtat 300
ggcccccttt ccaacatcag ccgtgcgcag atggaacagc agttttccgc caactttttc 360
ggcgcacacc agctcaccat gcgcctgtta cccgcgatgt taccgcactc cgaagggcgt 420
attgtgatga catcatcggt gatgggatta atctccacgc cgggtcgtgg cgcttacgcg 480
gccagtaaat atgagctgga ggcgtggtca gatgcactgc gcatggagct gcgccacgac 540
ggaattaaag tcagcctgat cgaacccggt cccattcgta ctcgcttcac cgacaacgtc 600
aaccagacgc aaagtgataa accagtcgaa aatcccggca tcgccgcccg ctttacgttg 660
ggaccggaag cggtggtgga caaagtacgc catgctttta ttagcgagaa gccgaagatg 720
cgctatccgg tgacgctggt gacctgggcg gtaatggtgc ttaagcgcct gctgccgggg 780
cgcgtgatgg acaaaatatt gcaggggtg 809

Claims (10)

1. A mutant alcohol dehydrogenase characterized in that the mutant alcohol dehydrogenase is mutated at an amino acid sequence shown in SEQ ID No.2 at a mutation site selected from the group consisting of T105N, G137S, A165E and S180D.
2. The mutant alcohol dehydrogenase according to claim 1, wherein the mutation site is T105N, G137S, a165E, S180D, T105N-G137S, T105N-a165E, T105N-S180D, G137S-a165E, G137S-S180D, a165E-S180D, T105N-G137S-a165E, T105N-G137S-S180D, T105N-a165E-S180D, G137S-a165E-S180D, or T105N-G137S-a 165E-S180D.
3. The mutant alcohol dehydrogenase according to claim 2, wherein the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of T105N is represented by SEQ ID No. 3;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of G137S is shown as SEQ ID No. 4;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of A165E is shown as SEQ ID No. 5;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the single-site mutation of S180D is shown as SEQ ID No. 6;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S is shown as SEQ ID No. 7;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E is shown as SEQ ID No. 8;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-S180D is shown as SEQ ID No. 9;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the G137S-A165E combined site mutation is shown as SEQ ID No. 10;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-S180D is shown as SEQ ID No. 11;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the mutation of the A165E-S180D combined site is shown as SEQ ID No. 12;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E is shown as SEQ ID No. 13;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-S180D is shown as SEQ ID No. 14;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-A165E-S180D is shown as SEQ ID No. 15;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of G137S-A165E-S180D is shown as SEQ ID No. 16;
the amino acid sequence of the mutant alcohol dehydrogenase corresponding to the combined site mutation of T105N-G137S-A165E-S180D is shown as SEQ ID No. 17.
4. A gene encoding the mutant alcohol dehydrogenase of any one of claims 1-3.
5. The gene as claimed in claim 4, wherein the nucleotide sequence of the mutant alcohol dehydrogenase having the mutation site of T105N is shown as SEQ ID No. 28;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S is shown as SEQ ID No. 29;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E is shown as SEQ ID No. 30;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of S180D is shown as SEQ ID No. 31;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-G137S is shown as SEQ ID No. 32;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E is shown as SEQ ID No. 33;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-S180D is shown as SEQ ID No. 34;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-A165E is shown as SEQ ID No. 35;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of G137S-S180D is shown as SEQ ID No. 36;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of A165E-S180D is shown as SEQ ID No. 37;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E is shown as SEQ ID No. 38;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-S180D is shown as SEQ ID No. 39;
the nucleotide sequence of the mutant alcohol dehydrogenase with the coding mutation site of T105N-A165E-S180D is shown as SEQ ID No. 40;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of G137S-A165E-S180D is shown as SEQ ID No. 41;
the nucleotide sequence of the mutant alcohol dehydrogenase with the mutation site of T105N-G137S-A165E-S180D is shown as SEQ ID No. 42.
6. A recombinant vector comprising the gene of claim 4 or 5.
7. The recombinant vector according to claim 6, wherein the recombinant vector is prepared by a method comprising the steps of: and carrying out PCR amplification on the first vector by adopting a mutation amplification primer pair to obtain a recombinant vector, wherein the mutation amplification primer pair contains a nucleotide sequence corresponding to a mutation site of the mutant alcohol dehydrogenase, and the first vector contains a gene encoding an amino acid sequence shown as SEQ ID No. 2.
8. The recombinant vector according to claim 7, wherein the pair of mutation amplification primers comprises: at least one pair of amplification primer pair of amplification mutation site T105N shown as SEQ ID No.20 and SEQ ID No.21, amplification primer pair of amplification mutation site G137S shown as SEQ ID No.22 and SEQ ID No.23, amplification primer pair of amplification mutation site A165E shown as SEQ ID No.24 and SEQ ID No.25, and amplification primer pair of amplification mutation site S180D shown as SEQ ID No.26 and SEQ ID No. 27.
9. A recombinant engineered bacterium comprising the recombinant vector according to any one of claims 6 to 8.
10. Use of the recombinant vector of claim 6 or the recombinant engineered bacterium of claim 9 in the production and preparation of alcohol dehydrogenase.
CN202110690363.2A 2021-06-22 2021-06-22 Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof Active CN113249349B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110690363.2A CN113249349B (en) 2021-06-22 2021-06-22 Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110690363.2A CN113249349B (en) 2021-06-22 2021-06-22 Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN113249349A CN113249349A (en) 2021-08-13
CN113249349B true CN113249349B (en) 2022-01-25

Family

ID=77189107

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110690363.2A Active CN113249349B (en) 2021-06-22 2021-06-22 Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113249349B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114150024B (en) * 2021-12-03 2023-06-20 河北省科学院生物研究所 Bifunctional enzyme biocatalyst and preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112522224A (en) * 2020-12-28 2021-03-19 华东理工大学 Alcohol dehydrogenase mutant with improved activity and stereoselectivity, recombinant vector, genetic engineering bacteria and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112522224A (en) * 2020-12-28 2021-03-19 华东理工大学 Alcohol dehydrogenase mutant with improved activity and stereoselectivity, recombinant vector, genetic engineering bacteria and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WP_000148959.1;无;《NCBI》;20201216;第1页 *

Also Published As

Publication number Publication date
CN113249349A (en) 2021-08-13

Similar Documents

Publication Publication Date Title
CN110846291B (en) Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof
JP4493333B2 (en) Enzyme modification method and oxidoreductase mutant
CN112877307B (en) Amino acid dehydrogenase mutant and application thereof
WO2011090054A1 (en) Nadh oxidase mutant having improved stability and use thereof
CN111073871B (en) DNA polymerase mutant with improved thermal stability as well as construction method and application thereof
CN113073089A (en) Novel method for improving enzyme activity of NMN biosynthetic enzyme Nampt
CN112359032B (en) Mutant esterase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof
CN113249349B (en) Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof
CN112626044B (en) Mutant and construction method and application thereof
CN112301014B (en) Esterase mutant with improved thermal stability and application thereof
CN112646791B (en) Mutant and construction method and application thereof
CN114250206B (en) Methyltransferase mutant, recombinant vector, recombinant engineering bacterium and application thereof
CN112899255B (en) DNA polymerase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof
CN108690837B (en) Method for improving heat stability of polymer protein and alcohol dehydrogenase with improved heat stability
CN110846289A (en) Acinetobacter baumannii xanthine dehydrogenase mutant and application thereof
CN114480342A (en) Mutant PET hydrolase, recombinant vector, recombinant engineering bacterium and application thereof
CN114317485B (en) Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application
CN114621944B (en) Arginine deiminase mutant with improved enzyme activity
CN112680425B (en) Alcohol dehydrogenase mutant and application thereof
CN113846082B (en) Halohydrin dehalogenase mutant, encoding gene, recombinant vector, recombinant genetic engineering bacteria and application thereof
CN114480311A (en) Catechol dioxygenase mutant, recombinant vector, preparation method and application thereof
CN116574709A (en) DNA polymerase BstX mutant and construction method and application thereof
CN116590254A (en) DNA polymerase mutant and construction method and application thereof
CN114480345A (en) MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof
CN116694596A (en) DNA polymerase BstX mutant with improved thermal stability, construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant